Gene duplication enables a novel function to evolve

Posted 14 January 2011 by

The Sensuous Curmudgeon calls our attention to a new study by researchers at the University of Illnois and the Chinese Academy of Sciences that traces the evolution of a new function via gene duplication. Since I'm not a molecular guy, I'll very briefly describe it and refer you to the news release and published paper (behind the PNAS paywall). Very briefly, the Antarctic eelpout has a gene that codes for an antifreeze protein, a member of a protein family called AFP III, that enables the eelpout to survive the freezing temperatures in Antarctic waters. It has been hypothesized on genetic homology grounds that the antifreeze gene evolved via duplication of a gene that codes for sialic acid synthase, a cellular enzyme, and subsequent selection for the antifreeze function in one of the duplicates via an escape from adaptive conflict process. From the linked news release:
"This is the first clear demonstration - with strong supporting molecular and functional evidence - of escape from adaptive conflict as the underlying process of gene duplication and the creation of a completely new function in one of the daughter copies," Cheng said. "This has not been documented before in the field of molecular evolution."
And from the Abstract:
We report here clear experimental evidence for EAC-driven evolution of type III antifreeze protein gene from an old sialic acid synthase (SAS) gene in an Antarctic zoarcid fish. We found that an SAS gene, having both sialic acid synthase and rudimentary ice-binding activities, became duplicated. In one duplicate, the N-terminal SAS domain was deleted and replaced with a nascent signal peptide, removing pleiotropic structural conflict between SAS and ice-binding functions and allowing rapid optimization of the C-terminal domain to become a secreted protein capable of noncolligative freezing-point depression. This study reveals how minor functionalities in an old gene can be transformed into a distinct survival protein and provides insights into how gene duplicates facing presumed identical selection and mutation pressures at birth could take divergent evolutionary paths.
As the Curmudgeon points out, this is precisely the kind of evidence that Disco 'Tute attack mouse Casey Luskin asked for a year ago:
Many scientific papers purporting to show the evolution of "new genetic information" do little more than identify molecular similarities and differences between existing genes and then tell evolutionary just-so stories of duplication, rearrangement, and subsequent divergence based upon vague appeals to "positive selection" that purport to explain how the gene arose. But exactly how the gene arose is never explained. In particular, whether chance mutations and unguided natural selection are sufficient to produce the relevant genetic changes is almost never assessed.
There it is, Casey.

736 Comments

Flint · 14 January 2011

In particular, whether chance mutations and unguided natural selection are sufficient to produce the relevant genetic changes is almost never assessed.

Well, this is just one single case, so it remains "almost" never, right?

fnxtr · 14 January 2011

Followed by "You can't prove it was unguided". (headshake)

mrg · 14 January 2011

This one has been getting raked over the coals in the comments on PHYSORG:

http://www.physorg.com/news/2011-01-gene-functions.html

Complete with scriptural citations. One good thing I've noticed in my other work with conspiracy theorists: they never quote sacred texts.

The Curmudgeon · 14 January 2011

Gasp! A link to my humble blog by Panda's Thumb. My cup runneth over.

Karen S. · 14 January 2011

Followed by “You can’t prove it was unguided”. (headshake)
Or front-loaded. Or that Satan hasn't created a delusion in your mind.

raven · 14 January 2011

gate.net: Xylitol is also not normally metabolized, but Mortlock and his colleagues were able to develop strains (generally through spontaneous mutations, but sometimes with u.v. ray or chemical induced mutations) that could use it because ribitol dehydrogenase (which is usually present in the cells to convert ribitol to D-ribulose) was able to slightly speed up the conversion of xylitol to D-xylulose, for which metabolic pathways already exist. The ability of the strains to utilize xylitol was increased as much as 20 fold when first production of ribitol dehydrogenase was deregulated (the enzyme was produced all the time, not just when ribitol was present), then duplication of the ribitol dehydrogenase genes occurred, then the structure of the enzyme was changed such that its efficiency at working with xylitol was improved, and finally, in at least one case, a line regained control of the modified ribitol dehydrogenase gene so that the enzyme was only produced in the presence of xylitol. Here we have a complete example of a new metabolic pathway being developed through duplication and modification of an existing pathway.
Here is another example of gene duplication followed by divergence to create a new metabolic pathway. This is from experimental evolution so it was observed in real time.

Vince · 14 January 2011

Any one willing to bet on how far back Luskin and dupes will move the goalposts on this one? My prediction: First they'll shot in the dark trying to make it look like something else, then they'll move the posts back by saying something like "....but it hasn't been observed in nature...."

Mike Elzinga · 14 January 2011

Whenever ID/creationist carping about “new information” comes up, I wonder why they have never observed the properties of water compared with the properties of hydrogen and oxygen.

Or, if one wants a little more drama, the properties of salt compared with the properties of sodium and chlorine.

And one doesn't even have to get beyond the brainpower of ID/creationists by using compounds as examples. Why does a solid piece of lead have different properties than a single atom of lead? And why do these properties vary with temperature?

All they have to do to win a Nobel is demonstrate that the laws of physics and chemistry no longer apply to complex phenomena at some level and why. Then they should be able to demonstrate at which particular level of complexity this kicks in and also the mechanism that prevents further assemblies of matter and/or prevents the emergence of new phenomena as complexity increases.

Piece of cake, Casey; go get ‘em!

Doc Bill · 14 January 2011

Casey will take his cue from Behe and call it a trivial change. Simple microevolution. Parlor trick. See it all the time. Fly is still a fly. Move on, folks, no evolution to see here. Same for whales. Pish posh.

OgreMkV · 14 January 2011

Not sure if I should mention this, but you can get a full preliminary copy of the article here:

http://www.life.illinois.edu/ccheng/Deng%20et%20al%20PNAS2010_online.pdf

It's very, very thick, but interesting.

mrg · 14 January 2011

OgreMkV said: It's very, very thick, but interesting.
Ook! It'll stop a layperson the size of a 500-pound gorilla dead in his tracks.

DS · 14 January 2011

Gee, gene duplication and divergence documented as a major mechanism of evolution. What a shock! Who would have guessed?

Now all Dembski has to to is to calculate the exact amount of CCSSII before the duplication and after in order to see what evolution is capable of. He can still claim that it can't do better than this of course, but he can't claim that there are no beneficial mutations, or that there is no new information, or that no new protein has evolved, or any of that other crap. Not that anyone was ever fooled by his hand waving in the first place.

OgreMkV · 14 January 2011

My bet is on the 'design' of the lab experiment.

"This only proves that intelligence can create novel systems."

Of course this would be a complete misread of the article because the researchers didn't actually do experiments. They just (hah!) analyzed the gene sequences from a variety of fish.

There's some golden quote-mine material in there too. I can't wait to see one of the sentences from the first two paragraphs and then hammer them with the rest of the material.

Comon attack gerbil, don't let us down.

Mike Elzinga · 14 January 2011

Doc Bill said: Casey will take his cue from Behe and call it a trivial change. Simple microevolution. Parlor trick. See it all the time. Fly is still a fly. Move on, folks, no evolution to see here. Same for whales. Pish posh.
They use that argument fairly often; but the reality is that a change in a gene can send an evolving organism in a different direction just as a change in the location of a molecule can affect the evolution of any branching system. There are lots of directions a system can go from where it is; especially when it is already at a high level of complexity. Thus the changes are really not all that dramatic; they are simply made to seem that way because of the tendency of ID/creationists to assume that the present evolutionary state of an organism was the goal. It’s the Lottery Winner Fallacy again. But when you compare such changes to the changes in properties that emerge in simpler systems, those changes in simpler systems are by far more dramatic. Why aren’t these impossible for ID/creationists?

mrg · 14 January 2011

But it's ... just MICROEVOLUTION! Not MACROEVOLUTION! It doesn't ADD information! And there are NO transtional fossils! And DARTH VADER was an EVOLUTIONIST!

DS · 14 January 2011

OgreMkv,

Thanks for the link.

mrg · 14 January 2011

OgreMkV said: Comon attack gerbil, don't let us down.
Maybe woodchuck? A hoary marmot if I ever saw one. "Gopher the jugular."

Wheels · 14 January 2011

"Attack mouse." I like it.

You don't have to wait to find out how the cdesign proponentsits will react, there was already a recent Cornelius Hunter trackback on Uncommon Descent addressing the research about new genes becoming essential for survival in fruit flies. DID THOSE DARWINISTS EVER CONSIDER THAT THE GENES WERE NOT THE PRODUCT OF EVOLUTION? WHY NO, OF COURSE NOT!

They also have posts up addressing the recent scandals that the NCSE (via the New Mexico CESME) calls ID "Creationism re-labeled" and that they endorse teaching evolution a fact!

I guess it's nice of them to finally pay attention after all these years?

mrg · 14 January 2011

Wheels said: They also have posts up addressing the recent scandals that the NCSE (via the New Mexico CESME) calls ID "Creationism re-labeled" and that they endorse teaching evolution a fact!
"I am shocked, shocked, that anyone would mistake our Low Cost Swan for a duck ... stop quacking, you're supposed to honk."

OgreMkV · 14 January 2011

Someday I need to tell you guys about the time I was chased out of Herman park by a pack/gang/samurai army of squirrels.

fnxtr · 14 January 2011

Mike Elzinga said: Whenever ID/creationist carping about “new information” comes up, I wonder why they have never observed the properties of water compared with the properties of hydrogen and oxygen. Or, if one wants a little more drama, the properties of salt compared with the properties of sodium and chlorine. (snip)
Mike, I was thinking of your posts the other day as the temperature here swung above and below freezing. The snow on the roof would never turn to icicles on the eaves if not for the local temperature fluctations, or even the heat leaking through from inside the house. And the icicles would never form if the heat leakage from inside the house was greater.

Doc Bill · 14 January 2011

Someday I need to tell you guys about the time I was chased out of Herman park by a pack/gang/samurai army of squirrels.
In Kew Gardens I saw a tourist trying to take a picture of a swan with its wings out, and he had his wife behind him flapping her arms up and down to attract the swan. Well, it worked. The swan chased the lady, knocked her down and tried to mate with her. (I didn't think she was all that attractive, but I'm not a swan.) Anyway, the tourist thought it was great and kept taking pictures ignoring his wife's screams.

W. H. Heydt · 14 January 2011

Doc Bill said:
Someday I need to tell you guys about the time I was chased out of Herman park by a pack/gang/samurai army of squirrels.
In Kew Gardens I saw a tourist trying to take a picture of a swan with its wings out, and he had his wife behind him flapping her arms up and down to attract the swan. Well, it worked. The swan chased the lady, knocked her down and tried to mate with her. (I didn't think she was all that attractive, but I'm not a swan.) Anyway, the tourist thought it was great and kept taking pictures ignoring his wife's screams.
Was her name Leda? Did she lay eggs? Did she have two pairs of twins? --W. H. Heydt Old Used Programmer

RBH · 14 January 2011

The Curmudgeon said: Gasp! A link to my humble blog by Panda's Thumb. My cup runneth over.
Gotta steal my stuff from somewhere! Did the trackback make the trip?

The Curmudgeon · 14 January 2011

RBH said:Did the trackback make the trip?
I haven't allowed trackbacks for a year or two. They're often spammy. But I just enabled them for that one post. Nothing shows up, at least not yet.

RBH · 14 January 2011

The Curmudgeon said:
RBH said:Did the trackback make the trip?
I haven't allowed trackbacks for a year or two. They're often spammy. But I just enabled them for that one post. Nothing shows up, at least not yet.
Probably too late unless I figure out how to send another one independent of posting the OP, or something or other.

Mike Elzinga · 14 January 2011

fnxtr said: The snow on the roof would never turn to icicles on the eaves if not for the local temperature fluctations, or even the heat leaking through from inside the house. And the icicles would never form if the heat leakage from inside the house was greater.
The ancient Greeks, from at least the times of Lucretius and Democritus, were aware of and wondered about the properties of matter. Even alchemy, in attempting to manipulate the properties of matter, had some concept that there was something about matter that could be manipulated with the right rituals. The fact that ID/creationists are so compulsively focused on bringing down evolution means that they take no notice of everything that is going on right in front of them every second of their petty little existences. Even the most superficial observations of the behavior of matter opens up an entire universe of marvelous phenomena all pointing to evolution at all levels of complexity.

MSG · 14 January 2011

You guys can mock Luskin all you want. He will still continue to embarrass Darwinists on a daily basis. For the latest smackdown see his post here:

http://www.evolutionnews.org/2011/01/marsupials_embryos_develop_dif042271.html#more

More and more data like this is being uncovered, which completely contradicts the myth of common descent. Darwinists have no choice but to ignore it.

As for gene duplication leading to novel functions, this phenomenon is perfectly consistent with ID. Let me know when you guys can find an example of DNA forming spontaneously from random arrangements of chemicals...

Mike Elzinga · 14 January 2011

MSG said: Let me know when you guys can find an example of DNA forming spontaneously from random arrangements of chemicals...
Thanks for showing up here and providing an exquisite example of an ID/creationist who notices nothing going on in the real world. Of course you can provide the scientific community with the mechanism that prevents matter from evolving beyond a specified level of complexity. And of course you also know that nothing happens with atoms and molecules; they just lie around waiting to be placed in some arrangement by some sectarian deity. Where do you hang your Nobel Prize medal?

Ichthyic · 14 January 2011

You guys can mock Luskin all you want.

why, thanks!

...and please send our thanks also to Casey for his continued permission to allow us to mock his inanity publicly, with no fear of either libel suit or factual disagreement.

say, do you know when Casey is gonna finish his book:

"The Mouse that Squeaked Very Loudly"

MSG · 14 January 2011

Where do you hang your Nobel Prize medal?
Right next to the evidence of DNA spontaneously creating itself... Have you read Signature in the Cell?

mrg · 14 January 2011

MSG said: Have you read Signature in the Cell?
Does it make more sense than Casey Luskin?

Mike Elzinga · 14 January 2011

MSG said: Right next to the evidence of DNA spontaneously creating itself... Have you read Signature in the Cell?
Yeah; it’s pretty lousy science fiction pretending to be something more than it is. Many of us here have delved deeply into the shallow writings of ID/creationists; and that goes all the way back to when the Institute for Creation “Research” was formed in the 1970s and right on through its morph into ID after the Supreme Court Decision of 1987 (ever heard of that?). We know their misconceptions and misrepresentations better than they do. But all of us have also gone far beyond that and became real, working scientists who actually know something about science. You can’t make that claim, can you?

John_S · 14 January 2011

MSG said: As for gene duplication leading to novel functions, this phenomenon is perfectly consistent with ID.
Not according to William Dembski's mathematics, it isn't. Or isn't "gene duplication leading to novel functions" an example of an increase in "complex specified information"? Oh, wait - we don't actually know exactly what "complex specified (Dembski) information" is ... he'll define it further after he reads the peer-reviewed paper (God forbid he should waste his time producing one on the subject himself for free when he can sell books to the rubes) and invents some more mathematical BS.

mrg · 14 January 2011

Mike Elzinga said: Yeah; it’s pretty lousy science fiction pretending to be something more than it is.
"Pseudoscience pseudofiction." Probably not in a league with David Icke though ... it takes a certain amount of chutzpah to claim the British royal family is descended from reptilian aliens, or that vaccine programs inject the populace with mind-control chips.

J. L. Brown · 14 January 2011

http://pandasthumb.org/archives/2009/12/signature-in-th.html#more

That's the one where Meyer couldn't even bother to make his assertions consistent, or avoid the tired creationist canard about abiogenesis and a 'hurricane in a junkyard', right?

http://www.talkorigins.org/indexcc/CB/CB010.html

Nah, not at the top of my reading list -- there are other brave souls who risk their sanity to take down trash like that.

(Note to self: ID-apologist troll will complain about 'ID isn't creationism!' and 'That analysis is for proteins, not DNA!' and greatly belabor pretending to miss the actual merits of the argument.)

Ichthyic · 14 January 2011

MSG

None for me thanks, I have an allergy.

David vun Kannon, FCD · 14 January 2011

MSG said:
Where do you hang your Nobel Prize medal?
Right next to the evidence of DNA spontaneously creating itself... Have you read Signature in the Cell?
Of course, DNA does spontaneously self-assemble. That is why the nanotech folks like to use it. If MSG is asking for the nucleobases to self assemble, he has some serious catching up to do on the OOL research.

jkc · 14 January 2011

MSG said: You guys can mock Luskin all you want. He will still continue to embarrass Darwinists on a daily basis. For the latest smackdown see his post here: http://www.evolutionnews.org/2011/01/marsupials_embryos_develop_dif042271.html#more

The 2011 edition of Ken Miller textbook Biology states, "Similar patterns of embryological development provide further evidence that organisms have descended from a common ancestor." (p. 469) But what happens when supposedly similar types of organisms have very different patterns of embryological development? Would that count as evidence against common ancestry? In fact, researchers are finding striking differences in the development of vertebrates.

— Luskin
I'll let the experts weigh in on the scientific merit of Luskin's claim, but from a layman's standpoint I will say that the very existence of both placentals and marsupials seems to be totally antithetical to ID. Why would the designer have even needed to create two different types of mammals, differing only in reproductive system, to fill very similar ecological niches on different continents? Evolution and continental drift are much more plausible explanations.

DS · 14 January 2011

MSG said: You guys can mock Luskin all you want. He will still continue to embarrass Darwinists on a daily basis. For the latest smackdown see his post here: http://www.evolutionnews.org/2011/01/marsupials_embryos_develop_dif042271.html#more More and more data like this is being uncovered, which completely contradicts the myth of common descent. Darwinists have no choice but to ignore it. As for gene duplication leading to novel functions, this phenomenon is perfectly consistent with ID. Let me know when you guys can find an example of DNA forming spontaneously from random arrangements of chemicals...
The only one Luskin embarrasses is himself. When you can explain all of the evidence that is consistent with the well tested theory of descent with modification, then you can start whining about the supposed evidence that contradicts it. You do know that a theory is not a myth right? You do know the difference between myths and real science, right? I'm not sure what you are claiming. Are you saying that gene duplications are caused by an intelligent agent? You do know that the molecular mechanism of gene duplication are well documented don't you? Are you saying that divergence after gene duplication is caused by an intelligent agent? You do know that mechanisms of mutation are well documented don't you? Are you saying that novel functions cannot arise without the aid of an intelligent agent? Are you saying that you have any evidence of the existence of this intelligent agent? Are you saying that you have some evidence as to the motives and methods of this intelligent agent? Or maybe you are just saying that anything that science discovers is consistent with some nebulous version of some ill-conceived scenario involving some supposed intelligence for which there is absolutely no evidence whatsoever? As far as I can tell, creationists and ID advocates are the only ones who actually claim that DNA can form spontaneously from random arrangements of chemicals, so you are the one who needs to provide evidence of that. That's pretty much how "poof" is supposed to work isn't it?

Cubist · 14 January 2011

MSG said: ...gene duplication leading to novel functions... is perfectly consistent with ID.
That's nice. Is there anything which isn't "perfectly consistent with ID"? Seriously: Is there anything... anything at all... which would not be "perfectly consistent with ID"? I say no, on the grounds that ID (which can be accurately summarized in seven words: "somehow, somewhere, somewhen somebody intelligent did something") is so goddamn vague that there's no substance to ID for anything to be inconsistent with. So... yeah, nothing in this paper is inconsistent with ID. Of course, unicorns poofing into existence in Washington DC and dancing a quafrille around the Washington Monument wouldn't be inconsistent with ID, either...

DS · 14 January 2011

jkc said:

The 2011 edition of Ken Miller textbook Biology states, "Similar patterns of embryological development provide further evidence that organisms have descended from a common ancestor." (p. 469) But what happens when supposedly similar types of organisms have very different patterns of embryological development? Would that count as evidence against common ancestry? In fact, researchers are finding striking differences in the development of vertebrates.

— Luskin
This is just total bullshit. It's a complete misrepresentation of an entire field of science. Whatever Luskin is claiming is "different patterns of embryological development" are in fact not evidence against common descent. Of course there are differences in development in different organisms, that is the way evolution works. You have to look at the underlying similarities not just the superficial differences. This is like saying that two different buildings could not have been built by the same company because one has a tin roof and one has a slate roof! That's just nuts. Just go to the thread on the NABT meetings and watch the Sean Carroll presentation. All vertebrates have exactly the same sets of hox genes and all are expressed in the same basic spatio-temporal pattern. This is remarkable evidence of common descent and completely inconsistent with any reasonable ID hypothesis. Look at the threads bout Haeckel and his embryos. We now know the molecular basis for the phenomena that he first described. This is extremely striking evidence of common descent and cannot reasonably be explained by any creationist or ID scenario. Luskin can hide behind his ignorance all he wants, but it isn't going to fool anybody. Evolutionary development has not only dramatically confirmed the predictions of descent with modification, but it has done so in ways that most people could never have imagined just a few years ago.

harold · 14 January 2011

MSG -

I want to be fair.

I want to compare the theory of intelligent design to the theory of evolution, and see which, if either, is the better explanation of the diversity and nested hierarchical relationships we see in the biosphere.

The problem is, although I have read pretty extensively on the subject, I don't know what that theory of intelligent design it.

It all just seems to be lame evolution denial.

But again, I want to be fair, so answer a few basic questions for me.

1) Who is the designer?

2) Exactly what did the designer design?

3) How did the designer design it?

4) When did the designer design it?

5) What is an example of something that might not have been designed?

MSG · 14 January 2011

Is there anything which isn’t “perfectly consistent with ID”?
Sure. One example would be a plausible naturalistic explanation for the origin of life. Scientists have been struggling for over a hundred years to come up with such an explanation, but all we've got so far are a few wildly imaginative guesses that don't hold up under even the slightest amount of scrutiny. How long will it take for Darwinists to admit the obvious: that the information-rich sequences found in DNA could only have arisen by means of intelligence? Another example that would be inconsistent with ID is junk DNA. Scientists have long claimed that the non-coding portions of our DNA serve as evidence for descent with modification, but this paradigm has been shattered by recent genomic research. For starters, check out the following: http://www.nature.com/nature/journal/v465/n7301/pdf/nature09144.pdf http://www.pnas.org/content/early/2010/07/01/1004139107.short Now let's get back to gene duplication. You all are touting the recent research by Cheng et al. as some massive victory over ID. (Strange how Darwinists take so much delight in "defeating" a theory which is supposed to be so largely irrelevant. But anyway...) Even though we MAY have found evidence for gene duplication leading to new functionality, the larger body of evidence still points to the process being insufficient overall. This point is made nicely in the following peer-reviewed paper: http://onlinelibrary.wiley.com/doi/10.1002/cplx.20365/abstract

fnxtr · 14 January 2011

Great, more Trolling For Credits(tm).

MSG · 14 January 2011

Harold, I appreciate your respectful tone. I will try to address your questions the best I can.
1) Who is the designer?
I believe the designer is YHWH, God of the Bible and Father of Jesus Christ. However, ID is compatible with almost any sort of designer and it has no inherent religious implications.
2) Exactly what did the designer design?
In short, everything. We have good evidence to suggest that the designer was responsible for the origin of life. The designer likely has intervened several other times in life's history. As Michael Behe has aptly demonstrated, a design event seems to have been necessary in order to form the first prokaryotic (and later eukaryotic) cells. The fossil record also points to a design event during the Cambrian. I suspect further research may uncover additional instances of design.
3) How did the designer design it?
The designer's mechanism is not currently known, but we shouldn't let this distract us. Remember when Alfred Wegener first proposed the theory of continental drift, he was unable to describe the exact mechanism that caused the continents to move. Like the initial theory of continental drift, ID has significant explanatory power, and it should not be dismissed because it currently lacks a precise mechanism.
4) When did the designer design it?
I've covered this in my response to question 2.
5) What is an example of something that might not have been designed?
Any micro-evolutionary feature - e.g. the ability of certain bacteria to consume nylon.

raven · 14 January 2011

Let me know when you guys can find an example of DNA forming spontaneously from random arrangements of chemicals…
We found one on a water world-rocky planet 2/3 of the way out towards the Galactic rim. But that planet will never evolve intelligent life. That is simply beyond the power of non-deity guided evolution.

DS · 14 January 2011

MSG said:
Is there anything which isn’t “perfectly consistent with ID”?
Sure. One example would be a plausible naturalistic explanation for the origin of life. Scientists have been struggling for over a hundred years to come up with such an explanation, but all we've got so far are a few wildly imaginative guesses that don't hold up under even the slightest amount of scrutiny. How long will it take for Darwinists to admit the obvious: that the information-rich sequences found in DNA could only have arisen by means of intelligence? Another example that would be inconsistent with ID is junk DNA. Scientists have long claimed that the non-coding portions of our DNA serve as evidence for descent with modification, but this paradigm has been shattered by recent genomic research. For starters, check out the following: http://www.nature.com/nature/journal/v465/n7301/pdf/nature09144.pdf http://www.pnas.org/content/early/2010/07/01/1004139107.short Now let's get back to gene duplication. You all are touting the recent research by Cheng et al. as some massive victory over ID. (Strange how Darwinists take so much delight in "defeating" a theory which is supposed to be so largely irrelevant. But anyway...) Even though we MAY have found evidence for gene duplication leading to new functionality, the larger body of evidence still points to the process being insufficient overall. This point is made nicely in the following peer-reviewed paper: http://onlinelibrary.wiley.com/doi/10.1002/cplx.20365/abstract
A "plausible naturalistic explanation for the origin of life" would absolutely NOT be inconsistent with ID in exactly the same way that a plausible method for producing a plastic tire would not be inconsistent in any way with the possibility of producing a rubber tire. Just because it could have happened one way doesn't mean that it did happen that way or had to happen that way. The information in DNA comes from billions of years of random mutation and natural selection, along with drift and other natural processes. Why can't creationists just admit this and stop playing silly word games? If junk DNA is inconsistent with ID then ID is dead, period. No matter how many examples you find of DNA which could have a possible function, there is still a large proportion of almost all eukaryotic DNA that is just plain junk by any reasonable definition. This is exactly what one would expect from random mutation and natural selection. If you disagree, the burden of proof is on you dot demonstrate conclusively a function for ALL of the the DNA, otherwise, by your own criteria, your hypothesis is falsified. By the way, it's not only the presence of junk DNA but the precise pattern of the distribution of certain sequences in a nested hierarchy that is once again strong evidence for common descent. Gene duplication has long been known to be a major mechanism of evolution. The only victory would be getting creationists to admit the obvious, that they were wrong all along. There is no barrier to what this process can accomplish, given enough time. It is certainly sufficient to account for all of the observations of modern comparative genomics. To pretend otherwise is just blatant dishonesty.

John_S · 14 January 2011

MSG said:
Is there anything which isn’t “perfectly consistent with ID”?
Sure. One example would be a plausible naturalistic explanation for the origin of life.
OK, let's admit some god or the Flying Spaghetti Monster created life 3.5 billion years ago. Your move.

Dale Husband · 14 January 2011

MSG said: Scientists have been struggling for over a hundred years to come up with such an explanation, but all we've got so far are a few wildly imaginative guesses that don't hold up under even the slightest amount of scrutiny. How long will it take for Darwinists to admit the obvious: that the information-rich sequences found in DNA could only have arisen by means of intelligence?
Then you should have no trouble debunking this video: http://www.youtube.com/watch?v=U6QYDdgP9eg Let's see you do just that, Mr. Big Shot!

RBH · 14 January 2011

MSG wrote
Even though we MAY have found evidence for gene duplication leading to new functionality, the larger body of evidence still points to the process being insufficient overall. This point is made nicely in the following peer-reviewed paper: http://onlinelibrary.wiley.com/doi/[…]365/abstract
Well, let's see. That paper says right there in the abstract that
All life depends on the biological information encoded in DNA with which to synthesize and regulate various peptide sequences required by an organism's cells. Hence, an evolutionary model accounting for the diversity of life needs to demonstrate how novel exonic regions that code for distinctly different functions can emerge.
And that's precisely what the Cheng paper shows: how a novel exonic region produced by a gene duplication can be shaped by natural selection to perform a "distinctly different function." Maybe it's escaped MSG that the main engine of evolution is descent with modification.. Those "novel" functions are almost always produced from existing raw material doing something else. They don't appear, as by a designer's miracle, de novo as the article seems to suggest. As it happens, I know something about that author. He's a long-time internet crank, currently spreading his nonsense on TalkRational as "Atheistoclast," terming himself a neoLamarkian.

RBH · 14 January 2011

BTW, I strongly recommend that MSG read about T. Ryan Gregory's Onion Test and tell us how ID handles it. In particular, how does ID account for the 5-fold range of genome sizes in Allium?

Dale Husband · 14 January 2011

MSG said: I believe the designer is YHWH, God of the Bible and Father of Jesus Christ. However, ID is compatible with almost any sort of designer and it has no inherent religious implications. We have good evidence to suggest that the designer was responsible for the origin of life. The designer likely has intervened several other times in life's history. As Michael Behe has aptly demonstrated, a design event seems to have been necessary in order to form the first prokaryotic (and later eukaryotic) cells. The fossil record also points to a design event during the Cambrian. I suspect further research may uncover additional instances of design. The designer's mechanism is not currently known, but we shouldn't let this distract us. Remember when Alfred Wegener first proposed the theory of continental drift, he was unable to describe the exact mechanism that caused the continents to move. Like the initial theory of continental drift, ID has significant explanatory power, and it should not be dismissed because it currently lacks a precise mechanism.
An explanation which allows for everything is good for nothing and is really no explanation at all. All you are saying is, "I can't explain how it happened, therefore I will ASSUME it was designed, thus abandoning science.

raven · 14 January 2011

MSG said: …gene duplication leading to novel functions… is perfectly consistent with ID.
Most ID creationists most of the time say that gene duplication leading to novel functions has never been seen. But of course, there are numerous examples. One is the subject of this post and I posted one on evolution of a novel metabolic pathway. What the creationists are doing is what they always do. Move the goalposts. And just lie.
casey Luskin: More and more data like this is being uncovered, which completely contradicts the myth of common descent. Darwinists have no choice but to ignore it.
This statement is pure, centuries old creationism. So much for the lie that ID isn't creationism with a sheet over it. It's also wrong of course. The data for common descent is overwhelming.

raven · 14 January 2011

msg: Let me know when you guys can find an example of DNA forming spontaneously from random arrangements of chemicals…
There you go, one of many examples. Time to move your goal posts again.
csh.org: Finally, DiMauro and coworkers have recently reported that 3′, 5′-cyclic AMP and GMP will spontaneously form homo-A and homo-G oligonucleotides, respectively, in aqueous solution (Costanzo et al. 2009). These authors propose that nucleotides activated as cyclic monophosphates are potentially prebiotic, based on their earlier demonstration of 3′, 5′-cyclic AMP formation in formamide solutions containing phosphate minerals (Costanzo et al. 2007).
But we've done better. We now have a self replicating RNA molecule. It partially designed itself. Because it evolves over time. A self replicating evolving lineage is a common defintion of life. No god was needed whatsoever.

Matt G · 14 January 2011

Don't let the troll derail this conversation. A nice tidy example of exaptation at the molecular level. I picked up various objects today (a bar magnet, a screwdriver, a pair of tongs) and passed them off to my students as a knife, fork and spoon. It's basically the same stunt from Dover in which a partial mousetrap served as a tie clip. Something serves one purpose well, and is merely OK at another; through duplication and modification, one copy can come to serve the second function better, and then perhaps exclusively. Did anyone happen to catch the article a few years back called 52 uses for a bat wing? It essentially addresses Dawkins' old question: "what good is half a wing?".

raven · 14 January 2011

msg: How long will it take for Darwinists to admit the obvious: that the information-rich sequences found in DNA could only have arisen by means of intelligence?
Fallacy of Argument from Personal Ignorance and Incredulity. Proves nothing. Hitchens rule. An assertion made without proof can be dismissed without proof. This is an assertion without proof and therefore, a waste of photons, electrons, and time.

Ichthyic · 14 January 2011

How long will it take for Darwinists to admit the obvious

How long will it be until the profoundly ignorant admit that assertion /= evidence?

well, probably we'll have to wait until they also can admit that lying /= honesty.

given the history of the efficacy of lying, I'd say...

we'll be waiting a long, long time.

Ichthyic · 14 January 2011

“Atheistoclast,”

THAT'S who this is?

*headdesk*

some people just should not be allowed near computers.

Mike Elzinga · 15 January 2011

Ichthyic said: “Atheistoclast,” THAT'S who this is? *headdesk* some people just should not be allowed near computers.
Well, he certainly has the ID/creationist shtick down pat. He has no conceptual understanding of either real science or of ID/creationist pseudo-science; but he recites the old worn out, memorized clichés exactly as every identical rube follower of ID/creationism has since the 1970s. Now he is considered an “intellectual” within the ID/creationist subculture. It was my encounters with ID/creationist “erudition” that made me realize the IQ scale has no lower bound. It goes negative when an individual has learned everything wrong and then loses the capacity for correction also.

raven · 15 January 2011

“Atheistoclast,” THAT’S who this is?
Fake non-intellectual is right. I saw him on Jerry Coyne's blog. He posts links to science abstracts and papers. They have nothing to do with whatever point he is trying and failing to make and often instead contradict it. He doesn't have enough background to actually understand what he is linking to. Which is what he did above with the Cheng paper.

ben · 15 January 2011

Ichthyic said: MSG None for me thanks, I have an allergy.
Me too, I wake up in the middle of the night with a whanging headache and almost always end up vomiting repeatedly. Just like after reading anything by Casey Luskin.

Dave Wisker · 15 January 2011

Ichthyic said: “Atheistoclast,” THAT'S who this is? *headdesk* some people just should not be allowed near computers.
Not only that, he has managed to publish in a journal that has little, if anything, to do with evolution or molecular biology. I've read the paper. It reviews a few carefully chosen examples (the Cheng paper is one of them), and tries to offer alternate explanations for them. The problem with the alternate explanations are they have nothing particularly compelling to back them up.

mrg · 15 January 2011

RBH said: As it happens, I know something about that author. He's a long-time internet crank, currently spreading his nonsense on TalkRational as "Atheistoclast," terming himself a neoLamarkian.
That rings a bell -- he's a Holocaust Denier, too, right? I would place an even bet that he's an HIV denier, too ... the worst of the ugly: "Stop taking ARVs, they're REALLY what's making you sick!"

DS · 15 January 2011

Well that explains it. No wonder he made such a transparently fallacious argument. He claimed that a plausible explanation for the origin of life would be inconsistent with ID, while at the same time claiming that a plausible explanation, (well supported by fifty years of evidence), for the origin of new genes and new functions and new information was NOT incompatible with ID. He didn't have to move the goalposts, he just used different shaped goalposts for every own goal!

TomS · 15 January 2011

MSG said:
2) Exactly what did the designer design?
In short, everything.
5) What is an example of something that might not have been designed?
Any micro-evolutionary feature - e.g. the ability of certain bacteria to consume nylon.
You now see why shrewd creationists don't like to make positive statements. When they do attempt to say something, they only contradict themselves.

RBH · 15 January 2011

raven said:
“Atheistoclast,” THAT’S who this is?
Fake non-intellectual is right. I saw him on Jerry Coyne's blog. He posts links to science abstracts and papers. They have nothing to do with whatever point he is trying and failing to make and often instead contradict it. He doesn't have enough background to actually understand what he is linking to. Which is what he did above with the Cheng paper.
Wait wait wait--the author of the paper in Complexity that MSG linked to is Atheistoclast. I'm not identifying MSG.

harold · 15 January 2011

MSG - For some strange reason, you skipped my question about WHEN the designer designed. Could you please answer that question?
I believe the designer is YHWH, God of the Bible and Father of Jesus Christ.
However, many people are Christian, and believe that the Christian God intended, gives ultimate meaning to, or initially created the universe, without denying the theory of evolution.
However, ID is compatible with almost any sort of designer and it has no inherent religious implications.
ID claims that a supernatural or superpowerful entity or entities not only deliberately created the first cellular life on earth, but that ongoing magical miraculous intervention by this entity or entities is necessary to explain the subsequent radiation of life into the diverse biosphere of the present. It is a stretch to say that this is not a "religious implication". However, we can partially agree. The true point of ID was political - to "court proof" evolution denial in public schools. (Note that simply because an idea has a religious implication does not, in and of itself, make the idea wrong. I am not claiming that its religious implications are an independent argument against ID, but rather, merely correcting your assertion that it has none.)
In short, everything.
I see you are a very strong opponent of William Dembski. He claims to have developed a "design filter" which differentiates designed from not-designed. Clearly, his filter is as worthless as a broken clock, if everything is designed.
We have good evidence to suggest that the designer was responsible for the origin of life.
What is that evidence? Not denial of current hypotheses of abiogenesis, nor argument from incredulity, but actual positive evidence?
The designer likely has intervened several other times in life’s history. As Michael Behe has aptly demonstrated, a design event seems to have been necessary in order to form the first prokaryotic (and later eukaryotic) cells.
I don't agree that Michael Behe has done this, but I'll be fair. Can you summarize in detail how Michael Behe has demonstrated this? Please address all aspects of endosymbiotic theory http://en.wikipedia.org/wiki/Endosymbiotic_theory in detail and explain why the explanation that you assert Behe has produced is better.
The fossil record also points to a design event during the Cambrian.
You seem to be repeating a common creationist misunderstanding. In fact, it does not.
I suspect further research may uncover additional instances of design.
What "further"? You have not described any ID/creationist research. But I think doing research to support your ideas is a good idea. Why don't you just design a thought experiment that you could use to hypothetically demonstrate the presence of magic design in a biological system?
The designer’s mechanism is not currently known, but we shouldn’t let this distract us. Remember when Alfred Wegener first proposed the theory of continental drift, he was unable to describe the exact mechanism that caused the continents to move. Like the initial theory of continental drift, ID has significant explanatory power, and it should not be dismissed because it currently lacks a precise mechanism.
But Wegener did not propose a magical mechanism, nor did he refuse to make testable predictions, nor did he rely heavily or entirely on logically flawed arguments.
Now let’s get back to gene duplication. You all are touting the recent research by Cheng et al. as some massive victory over ID. (Strange how Darwinists take so much delight in “defeating” a theory which is supposed to be so largely irrelevant. But anyway…) Even though we MAY have found evidence for gene duplication leading to new functionality, the larger body of evidence still points to the process being insufficient overall. This point is made nicely in the following peer-reviewed paper:
Unfortunately, the author of this paper uses language in the abstract which demonstrates a profound ignorance of the theory of evolution...quoting from the abstract at the link that you provided...
"The totality of the evidence reveals that, although duplication can and does facilitate important adaptations by tinkering with existing compounds, molecular evolution is nonetheless constrained in each and every case."
This is a case of weasel wording in the extreme. Of course, everyone agrees that molecular evolution is highly constrained in many ways. However, the author seems to be implying that an accumulation of sequential small, individually constrained steps can't lead to large divergence. That's just logically and mathematically false. No-one has ever implied that gene duplication is the sole source of genetic variability for evolution, either.
"Therefore, although the process of gene duplication and subsequent random mutation has certainly contributed to the size and diversity of the genome, it is alone insufficient in explaining the origination of the highly complex information pertinent to the essential functioning of living organisms."
The author creates a straw man right in the abstract of his own paper. Like you, this author seems to be a bit panicked by the strong role of gene duplication in evolution. After all, although I have no problem with Christianity or religion broadly defined, it is clear that any religion based on demonstrably false ideas is false. No doubt this author is understandably distressed by the scientific evidence against his particular religious claims. To accept the simple scientific evidence would be to force a re-thinking of his religious claims. While this might not be so bad in isolation, he could hypothetically be an obsessively compliant member of a social and political ideology that is supposed justified by his religion. In this case, any open adjustment of his religious beliefs to fit reality would put him at great risk for severe social consequences from his current peers.

raven · 15 January 2011

RBH: Wait wait wait–the author of the paper in Complexity that MSG linked to is Atheistoclast. I’m not identifying MSG.
Wiley publishing: Effective with the 2011 volume, this journal (Complexity) will be published in an online-only format. Complexity is a bi-monthly, cross-disciplinary journal focusing on the rapidly expanding science of complex adaptive systems. The purpose of the journal is to advance the science of complexity. Articles may deal with such methodological themes as chaos, genetic algorithms, cellular automata, neural networks, and evolutionary game theory. Papers treating applications in any area of natural science or human endeavor are welcome, and especially encouraged are papers integrating conceptual themes and applications that cross traditional disciplinary boundaries. Complexity is not meant to serve as a forum for speculation and vague analogies between words like "chaos," "self-organization," and "emergence" that are often used in completely different ways in science and in daily life.
Complexity is an obscure online journal that Wiley lists under Mathematics. The publisher description doesn't indicate if it is even peer reviewed.

raven · 15 January 2011

Is gene duplication a viable explanation for the origination of biological information and complexity? Joseph Esfandiar Hannon Bozorgmehr Article first published online: 22 DEC 2010 Complexity Author Information 39 Princedom Street, Manchester M9 4GQ, United Kingdom Email: Joseph Esfandiar Hannon Bozorgmehr (bozorgmehr@hotmail.co.uk) Abstract All life depends on the biological information encoded in DNA with which to synthesize and regulate various peptide sequences required by an organism's cells. Hence, an evolutionary model accounting for the diversity of life needs to demonstrate how novel exonic regions that code for distinctly different functions can emerge. Natural selection tends to conserve the basic functionality, sequence, and size of genes and, although beneficial and adaptive changes are possible, these serve only to improve or adjust the existing type. However, gene duplication allows for a respite in selection and so can provide a molecular substrate for the development of biochemical innovation. Reference is made here to several well-known examples of gene duplication, and the major means of resulting evolutionary divergence, to examine the plausibility of this assumption. The totality of the evidence reveals that, although duplication can and does facilitate important adaptations by tinkering with existing compounds, molecular evolution is nonetheless constrained in each and every case. Therefore, although the process of gene duplication and subsequent random mutation has certainly contributed to the size and diversity of the genome, it is alone insufficient in explaining the origination of the highly complex information pertinent to the essential functioning of living organisms. © 2010 Wiley Periodicals, Inc. Complexity, 2011
Joseph Esfandiar Hannon Bozorgmehr is one guy with 4 names. MSG uses the same style as atheistoclast who is apparently JEH Bozorgmehr. Get the facts wrong, move the goalposts frequently, and assert, assert, assert continually without ever providing any data or proof. A good example is the abstract to the paper in Complexity. It is simply assertions without proof listed sequentially. Proves nothing, what can be asserted without proof can be dismissed without proof. The paper itself requires payment to read and I'm not wasting the time or pennies to read crackpot material.

Jose Fly · 15 January 2011

Don't know if the Pandas Thumb denizens saw this, but I thought it was amazing... http://www.nature.com/nature/journal/v469/n7328/abs/nature09649.html
Rapid evolutionary innovation during an Archaean genetic expansion The natural history of Precambrian life is still unknown because of the rarity of microbial fossils and biomarkers1, 2. However, the composition of modern-day genomes may bear imprints of ancient biogeochemical events3, 4, 5, 6. Here we use an explicit model of macroevolution including gene birth, transfer, duplication and loss events to map the evolutionary history of 3,983 gene families across the three domains of life onto a geological timeline. Surprisingly, we find that a brief period of genetic innovation during the Archaean eon, which coincides with a rapid diversification of bacterial lineages, gave rise to 27% of major modern gene families. A functional analysis of genes born during this Archaean expansion reveals that they are likely to be involved in electron-transport and respiratory pathways. Genes arising after this expansion show increasing use of molecular oxygen (P = 3.4 × 10−8) and redox-sensitive transition metals and compounds, which is consistent with an increasingly oxygenating biosphere.
The evolutionary history of almost 4,000 gene families figured out, and it just happens to independently confirm a major event in the history of the earth. Wow. Remind me again what structures or systems ID creationists have clearly identified as "designed" and given detailed accounts of how they were designed? Oh that's right.....

Gary Hurd · 15 January 2011

MSG said: Let me know when you guys can find an example of DNA forming spontaneously from random arrangements of chemicals...
Start with RNA, start reading here: Ekland, EH, JW Szostak, and DP Bartel 1995 "Structurally complex and highly active RNA ligases derived from random RNA sequences" Science 21 July 1995: Vol. 269:5222, pp 364-370 Reader, J. S. and G. F. Joyce 2002 "A ribozyme composed of only two different nucleotides." Nature vol 420, pp 841-844 Dworkin JP, Lazcano A, Miller SL 2003 "The roads to and from the RNA world" J Theor Biol. 2003 May 7;222(1):127-34 Saladino R, Crestini C, Ciambecchini U, Ciciriello F, Costanzo G, Di Mauro E. 2004 "Synthesis and degradation of nucleobases and nucleic acids by formamide in the presence of montmorillonites" Chembiochem. Nov 5:5(11)pp 1558-66 Ferris, J. P. 2005 “Mineral Catalysis and Prebiotic Synthesis: Montmorillonite-Catalyzed Formation of RNA” Elements v. 1:3, pp 145-149, DOI: 10.2113/gselements.1.3.145 Lincoln et al. 2009 "Self-Sustained Replication of an RNA Enzyme." Science, DOI:10.1126/science.1167856

Gary Hurd · 15 January 2011

MSG said: Have you read Signature in the Cell?
Yep, it is a piece of shit. My Amazon review has recently been voted off the front page by creationists, but they cannot actually make a reply.

Mike Elzinga · 15 January 2011

Gary Hurd said: My Amazon review has recently been voted off the front page by creationists, but they cannot actually make a reply.
Ah yes; "science" by political action.

Sylvilagus · 15 January 2011

Jose Fly said: Don't know if the Pandas Thumb denizens saw this, but I thought it was amazing... http://www.nature.com/nature/journal/v469/n7328/abs/nature09649.html
Rapid evolutionary innovation during an Archaean genetic expansion The natural history of Precambrian life is still unknown because of the rarity of microbial fossils and biomarkers1, 2. However, the composition of modern-day genomes may bear imprints of ancient biogeochemical events3, 4, 5, 6. Here we use an explicit model of macroevolution including gene birth, transfer, duplication and loss events to map the evolutionary history of 3,983 gene families across the three domains of life onto a geological timeline. Surprisingly, we find that a brief period of genetic innovation during the Archaean eon, which coincides with a rapid diversification of bacterial lineages, gave rise to 27% of major modern gene families. A functional analysis of genes born during this Archaean expansion reveals that they are likely to be involved in electron-transport and respiratory pathways. Genes arising after this expansion show increasing use of molecular oxygen (P = 3.4 × 10−8) and redox-sensitive transition metals and compounds, which is consistent with an increasingly oxygenating biosphere.
The evolutionary history of almost 4,000 gene families figured out, and it just happens to independently confirm a major event in the history of the earth. Wow. Remind me again what structures or systems ID creationists have clearly identified as "designed" and given detailed accounts of how they were designed? Oh that's right.....
This sounds amazing! Would one of the scientists here post an overview of these findings for us laymen?

mrg · 15 January 2011

Sylvilagus said: This sounds amazing! Would one of the scientists here post an overview of these findings for us laymen?
There was a popsci article on it in PHYSORG: http://www.physorg.com/news/2010-12-scientists-decipher-billion-year-old-genomic-fossils.html Includes obligatory bickering between creobots and science geeks in the comment section.

Doc Bill · 15 January 2011

I have no idea who this YHWH guy is.

The Designer is most definitely YMCA. There's even a song.

Gary Hurd · 15 January 2011

Mike Elzinga said:
Gary Hurd said: My Amazon review has recently been voted off the front page by creationists, but they cannot actually make a reply.
Ah yes; "science" by political action.
It makes sense, after a fashion. The most likely person to be looking at that book is a creationist. They cannot actually follow the argument, but they can vent their objection to science by voting critical reviews "off the island." But, it does cause a restriction of information, and it can have political consequences. There was an editorial piece in some right-wing rag I looked at recently that encouraged its readers to use these "approval/disapproval" buttons at news sites, or any other venue to block out opposing liberal, or scientific pro-evolution opinions.

mrg · 15 January 2011

Gary Hurd said: It makes sense, after a fashion. The most likely person to be looking at that book is a creationist. They cannot actually follow the argument, but they can vent their objection to science by voting critical reviews "off the island."
Actually, I was astounded that you had a majority of positive votes, about two-to-one. I would have expected it to have been lucky to get two-to-one AGAINST. For any controversial book on Amazon, the voting clusters strongly in the "five star" and "one star" category, with the target audience dominating and loading the "five star" category ... because people outside the target audience don't generally want to read the book. Since I find it amusing to ding creobots posting diss reviews on evosci books -- "Thumbs up? Ah, that ISN'T a thumb!" -- I have to judge this process as entirely fair. Incidentally, GH, you did get another vote out of me. No doubt I'm not the only Panda who rang the bell after following up the link ... hmm, obviously an evil plan to stack the deck.

Gary Hurd · 15 January 2011

mrg said: No doubt I'm not the only Panda who rang the bell after following up the link ... hmm, obviously an evil plan to stack the deck.
Ah... You have discovered my plot, but it is too late to stop me. By pushing this button, I can destroy the universe. But first, ...

Frank J · 15 January 2011

For some strange reason, you skipped my question about WHEN the designer designed. Could you please answer that question?

— harold
Keep asking, and ask lots of specific "when" questions. e.g. when life first appeared on Earth, when our lineage split from that of chimps, etc. Make sure you mention that Behe admitted many times that the lineages did indeed split, and did not originate independently. And that no other major ID promoter ever challenged him directly.

mrg · 15 January 2011

Frank J said: Keep asking, and ask lots of specific "when" questions. e.g. when life first appeared on Earth, when our lineage split from that of chimps, etc.
I got a kick out of him saying, in response to identifying something as not designed:
Sure. One example would be a plausible naturalistic explanation for the origin of life.
"Well duh." If we can demonstrate a natural system for the origin of life, then how can we rule out that the natural system is Designed? Teleology is a perverse argument -- but the perversity cuts both ways.

Terenzio the Troll · 15 January 2011

harold said: Why don’t you just design a thought experiment that you could use to hypothetically demonstrate the presence of magic design in a biological system?
My take at it. I would love to see a sequence of non-coding DNA strongly conserved throughout life on Earth where, if you match appropriate base sequences to the lower half of the ASCII table, you can read Gen.1 in 30 languages. (Yes: I stole this one from Sagan).

mrg · 15 January 2011

Terenzio the Troll said: (Yes: I stole this one from Sagan).
Or, extrapolating to math, Sagan's cute idea that if we took PI out to sufficient decimal places, the numeric sequence would start generating the graphical coordinates of circles.

SWT · 15 January 2011

raven said: Complexity is an obscure online journal that Wiley lists under Mathematics. The publisher description doesn't indicate if it is even peer reviewed.
The instructions to the authors ask that those submitting manuscripts also recommend five possible reviewers, so I think it probably is peer-reviewed. The article took about four months to go from online submission to appearance on line.

Gabriel Hanna · 15 January 2011

In my professional work I studied fluid phases and I am always impressed by how the local order in a fluid somehow manages to blow up to include the entire bulk during the transition to solid. It's amazing that you can get a single crystal at all, when you think about the huge numbers of atoms that have to be involved. It can't all be due to random motions, can't it?

So I've been lobbying for my theory of intelligent crystalization. The atoms in a crystal are painstakingly arranged by the souls of departed grad students passing through Purgatory.

Mike Elzinga · 16 January 2011

Gabriel Hanna said: In my professional work I studied fluid phases and I am always impressed by how the local order in a fluid somehow manages to blow up to include the entire bulk during the transition to solid. It's amazing that you can get a single crystal at all, when you think about the huge numbers of atoms that have to be involved. It can't all be due to random motions, can't it?
Depending on the atoms or molecules and the rate at which energy is carried away, you can form anything from amorphous solids to polycrystals to pure crystals having long range order. But then annealing near the melting point can often produce what rapid cooling cannot. Much of what happens depends on inclusions, dislocations, and the presence of other elements, the atomic and molecular structure of the vessel in which the condensing matter is contained, and the stresses produced within the condensing material if bond angles between atoms or molecules are not quite commensurate with the emerging crystalline lattice structure. It is extremely difficult to make a pure substance that doesn’t have trace amounts of other elements in it. And tiny amounts of trace elements on the order of one part in 109 can have enormous effects on the properties of the host element when it condenses. In fact, that is what the semiconductor industry is all about.

So I've been lobbying for my theory of intelligent crystallization. The atoms in a crystal are painstakingly arranged by the souls of departed grad students passing through Purgatory.

Having their souls annealed?

SWT · 16 January 2011

Mike Elzinga said:

So I've been lobbying for my theory of intelligent crystallization. The atoms in a crystal are painstakingly arranged by the souls of departed grad students passing through Purgatory.

Having their souls annealed?
Given the purported nature of purgatory, wouldn't zone refining be more apt?

Gabriel Hanna · 16 January 2011

Mike Elzinga said:
Gabriel Hanna said: In my professional work I studied fluid phases and I am always impressed by how the local order in a fluid somehow manages to blow up to include the entire bulk during the transition to solid. It's amazing that you can get a single crystal at all, when you think about the huge numbers of atoms that have to be involved. It can't all be due to random motions, can't it?
Depending on the atoms or molecules and the rate at which energy is carried away, you can form anything from amorphous solids to polycrystals to pure crystals having long range order. But then annealing near the melting point can often produce what rapid cooling cannot. Much of what happens depends on inclusions, dislocations, and the presence of other elements, the atomic and molecular structure of the vessel in which the condensing matter is contained, and the stresses produced within the condensing material if bond angles between atoms or molecules are not quite commensurate with the emerging crystalline lattice structure. It is extremely difficult to make a pure substance that doesn’t have trace amounts of other elements in it. And tiny amounts of trace elements on the order of one part in 109 can have enormous effects on the properties of the host element when it condenses. In fact, that is what the semiconductor industry is all about.
Thank you for bringing me up to speed, Mike, but I did actually learn those things in the course of my Ph.D. work. :) Snowflakes are my favorite examples of the spontaneous creation of order, especially for arguing with creationists. I did have the good fortune once to take a biophysics course as an elective, and there were many good examples there of cellular machinery making use of basic physical principles. The course I took in statistical mechanics emphasized basic models, like the Einstein crystal; and these are important to know, but they don't help you appreciate what statistical mechanics is capable of. The biophysics course takes a lot of the mystery out of how living organisms work.

mrg · 16 January 2011

Gabriel Hanna said: Snowflakes are my favorite examples of the spontaneous creation of order, especially for arguing with creationists.
"But but but ... there's no INFORMATION in the snowflake!" I might be more patient with creobots if they weren't so predictable. One can have some fun with this one: "OK, I write a computer program to draw snowflakes -- it's a cheesy old computer demo, uses a fractal sorta procedure ... are you saying there's no information in the computer program? That it just wrote itself?" Sadly this is futile -- the argument being nonsense in the first place, it leads to nothing more than repeated exchanges of nonsense.

Gabriel Hanna · 16 January 2011

It's funny that a DRAWING of a snowflake is full of "information" and obviously intelligently designed, but an ACTUAL snowflake, too complicated to be drawn, is totally DEVOID of "information".

mrg · 16 January 2011

Gabriel Hanna said: It's funny that a DRAWING of a snowflake is full of "information" and obviously intelligently designed, but an ACTUAL snowflake, too complicated to be drawn, is totally DEVOID of "information".
Heh! "That's a SILLY argument!" "Ya don't say?"

Mike Elzinga · 16 January 2011

SWT said:
Mike Elzinga said:

So I've been lobbying for my theory of intelligent crystallization. The atoms in a crystal are painstakingly arranged by the souls of departed grad students passing through Purgatory.

Having their souls annealed?
Given the purported nature of purgatory, wouldn't zone refining be more apt?
Now there’s an interesting picture; all the “bad” stuff gets migrated to one end, and then that end gets lopped off and the soul proceeds onward to heaven.

Atheistoclast · 16 January 2011

In my paper "is gene duplication a viable explanation for the origination of biological information and complexity", I make it clear that gene duplication can indeed facilitate adaptation, but it is of a very limited nature - usually just the tweaking or tinkering of an existing function. Natural selection has the ability to optimize and elaborate on a function but not to create it from scratch.

I believe I debunked the farcical hogwash of the speculative conversion of a trypsinogen-like enzyme into an antifreeze protein in their 1997 paper where they also claimed a "completely new function" had evolved.

In this latest pathetic attempt of theirs, they claim the subfunctionalization of a bifunctional gene (read the paper) is some great example of biological innovation. It is not.

Mike Elzinga · 16 January 2011

Gabriel Hanna said: Snowflakes are my favorite examples of the spontaneous creation of order, especially for arguing with creationists.
Snowflakes are a really nice example, and ID/creationists have absolutely no clue about just how relevant the physics is to evolution. AiG gives the typical response by ID/creationists. So if water is “doing what comes naturally,” where along the chain of chemistry and physics does matter start behaving “unnaturally?” Where do physics and chemistry no longer apply, and what is the mechanism that turns off natural laws and turns on “supernatural” intervention? Where does a “program” to do this get injected into the processes of physics and chemistry? As the AiG response illustrates, mrg is quite correct about ID/creationist inability to understand what is being shown here at one of the most fundamental levels. It is a clear example of the fact that ID/creationists have no conceptual understanding whatsoever of real science or of their own pseudo-science. If water doesn’t do this, then no atoms or molecules would do anything interesting either. Nature abhors the vacuum of ID/creationism.

mrg · 16 January 2011

Atheistoclast said: In this latest pathetic attempt of theirs, they claim the subfunctionalization of a bifunctional gene (read the paper) is some great example of biological innovation. It is not.
"Is so!" "Is not!" "Is so!" "Is not!" Bored now.

Mike Elzinga · 16 January 2011

Atheistoclast said: I believe I debunked the farcical hogwash ...
Wow! And no doubt the Nobel Committee already has all your paperwork for your application for the Nobel Prize; all filled out before you completed your "debunking."

Atheistoclast · 16 January 2011

I wish the Darwinists on this site would actually care to read the papers they claim champion their ideology.

"The capacity to code for a functional signal peptide (SP), in fact, existed in the precursor sequence in LdSAS-B, because we found comparable levels of AFPIII-exporting activity by the SP precursor-mature AFPIII construct and the native pre-AFPIII cDNA."

"Thus, the incipient ice activity of the ancestral SAS molecule or its detached C-terminal peptide would be quite sufficient in inhibiting ice-crystal expansion
in the fish body fluids."

"A clear example of EAC-compelled duplication of a bifunctional ancestral gene and additionally, acceleration of conflict resolution through intragenic domain deletion in one duplicate and its neofunctionalization into a protein of distinctive function."

None of these observations show how any new functionality has been created - only that it has been optimized and elaborated. None of this, therefore, detracts from the conclusions in my own paper.

*Atheistoclast*

Stanton · 16 January 2011

Atheistoclast, can you show us the data you got from your lab work? What sort of experiments did you perform to debunk every single example of gene duplication?

SteveF · 16 January 2011

BTW, what's particularly amusing about a'clasts paper is that he has basically cobbled together a few of his Talk Rational posts, submitted it to a journal and they've published it. He even talks about "kinds". Along with his recent magnum opus in the Journal of Bioeconomics, it's arguably the best example of journals (albeit crap ones) being trolled since Sokal put pen to paper. It's really quite hilarious.

What with blabbering on about holocaust denial, conspiracies involving the "British establishment" or threatening to sue the editor of Journal of Bioeconomics, it's a wonder he has time to troll journals.

Atheistoclast · 16 January 2011

Stanton said: Atheistoclast, can you show us the data you got from your lab work? What sort of experiments did you perform to debunk every single example of gene duplication?
I didn't perform any lab experiments. I simply downloaded the relevant data from the NCBI website and analyzed it using a number of tools such as BLAST. The paper is a *review* of previous research, including Christina's 1997 paper on antifreeze glycoproteins. If you cannot access the paper using your library system or do not wish to pay for it, send me an email and I will provide a private copy: bozorgmehr@hotmail.co.uk

DS · 16 January 2011

Atheistoclast said: In my paper "is gene duplication a viable explanation for the origination of biological information and complexity", I make it clear that gene duplication can indeed facilitate adaptation, but it is of a very limited nature - usually just the tweaking or tinkering of an existing function. Natural selection has the ability to optimize and elaborate on a function but not to create it from scratch. I believe I debunked the farcical hogwash of the speculative conversion of a trypsinogen-like enzyme into an antifreeze protein in their 1997 paper where they also claimed a "completely new function" had evolved. In this latest pathetic attempt of theirs, they claim the subfunctionalization of a bifunctional gene (read the paper) is some great example of biological innovation. It is not.
Well all you have to do is give us a copy of the paper where you did this. You know, the peer reviewed journal article. What...? It wasn't a real journal? Well why not? Now exactly what is the limit of what gene duplication followed by divergence can do? If the new copy is removed from functional constraint, exactly what is going to stop it from mutating into any sequence at all? Are you going to use a "conservation of information" argument? There is no such thing you know. Exactly how do you explain the evidence that gene duplication by many different mechanisms has in fact been a major source of new genes and new functions? Exactly what alternative are you proposing for the origin of new genes and new functions? How do you account for the fact that no real biologists or geneticists agree with your conclusions? Is it all one big conspiracy against you?

Stanton · 16 January 2011

Atheistoclast said:
Stanton said: Atheistoclast, can you show us the data you got from your lab work? What sort of experiments did you perform to debunk every single example of gene duplication?
I didn't perform any lab experiments. I simply downloaded the relevant data from the NCBI website and analyzed it using a number of tools such as BLAST. The paper is a *review* of previous research, including Christina's 1997 paper on antifreeze glycoproteins. If you cannot access the paper using your library system or do not wish to pay for it, send me an email and I will provide a private copy: bozorgmehr@hotmail.co.uk
Thank you for your generous offer: I will consider it. I just want to give you some advice, in that, you would gain and carry much more authoritative weight if you were to verify your conclusions with labwork and experimentation, and not just reviewing other scientists' work. I'm sorry to say, but, you're not going to impress anyone by just going "This can not be" in a bad review, while flinging the term "Darwinist" around like a racist epitaph.

Stanton · 16 January 2011

DS said: Well all (Atheistoclast has) to do is give us a copy of the paper where you did this.
He's offering to do that here, actually

James F · 16 January 2011

I give Mr. Bozorgmehr credit for submitting something to a journal for peer review, even if the paper is a review - this is something the professionals at the Discovery Institute and the Biologic Institute rarely do themselves.

The problem is, it still counts as a PR victory in creationist circles, something else for the likes of Casey Luskin to talk about. Papers that the ID crowd manage to get published (typically reviews, with the Meyer paper being an archetype) have had no impact whatsoever upon the actual study of evolutionary biology. ID is all PR, religion, and politics, presenting no refutation of evolution or - most tellingly - alternative mechanisms to evolution in peer-reviewed scientific research papers.

DS · 16 January 2011

Stanton said: Thank you for your generous offer: I will consider it. I just want to give you some advice, in that, you would gain and carry much more authoritative weight if you were to verify your conclusions with labwork and experimentation, and not just reviewing other scientists' work. I'm sorry to say, but, you're not going to impress anyone by just going "This can not be" in a bad review, while flinging the term "Darwinist" around like a racist epitaph.
I would like to second this sentiment. Why would anyone think that the opinion of someone who hasn't actually done any real research be given more consideration than the thousands of scientists who actually did the work and collected the data? Why should the opinion of one person, who wrote one review paper somewhere, be considered as important as the thousands of papers where the authors reached exactly the opposite conclusion? Of course, the thousands could conceivably be wrong, but in that case the one would have to provide extraordinary evidence to support his claims. Just reanalyzing data that everyone already had access to probably would not do the trick, especially if the analysis was fundamentally flawed in some way or depended on flawed assumptions.

Mike Elzinga · 16 January 2011

DS said: I would like to second this sentiment. Why would anyone think that the opinion of someone who hasn't actually done any real research be given more consideration than the thousands of scientists who actually did the work and collected the data? Why should the opinion of one person, who wrote one review paper somewhere, be considered as important as the thousands of papers where the authors reached exactly the opposite conclusion?
Review papers tend to be in major journals, and they are typically written by people who are well-known experts in the field who have been communicating for years with other researchers and know the issues and status of the fields of research on which they report. Rogue “reviews,” like this one, are usually written by scientist wannabes attempting to make themselves look impressive to an audience of non-experts. These are not people who have established themselves as having a broad overview of the subjects being reviewed and who are doing a service to the research community by providing summary updates usually on request.

mrg · 16 January 2011

DS said: I would like to second this sentiment. Why would anyone think that the opinion of someone who hasn't actually done any real research be given more consideration than the thousands of scientists who actually did the work and collected the data? Why should the opinion of one person, who wrote one review paper somewhere, be considered as important as the thousands of papers where the authors reached exactly the opposite conclusion?
There's also a simpler consideration: Do I want to waste my time on a bore? I'm under no obligation to listen to anyone other than the Law. There's a tsunami of material out there, clamoring for my attention. I'll pay attention to what attracts my interest; if an author can't convince me up front he's got some mojo, I'll move on to more interesting things. I must say that Dawkins, if not always the most relaxed person on the planet, understands this perfectly well: the author serves the reader, not the other way around.

Atheistoclast · 16 January 2011

Stanton said:
DS said: Well all (Atheistoclast has) to do is give us a copy of the paper where you did this.
He's offering to do that here, actually
Well, I don't have my own lab and, for the purpose of the research I conducted, I didn't need one. Many papers on evolutionary biology simply make use of NCBI material as their primary source of data Btw, "Darwinist" is a term that refers to those evolutionists who regard natural selection as the principal mechanism behind biological change. It was invented by Darwin's disciples.

Atheistoclast · 16 January 2011

Why should the opinion of one person, who wrote one review paper somewhere, be considered as important as the thousands of papers where the authors reached exactly the opposite conclusion?
You are making a flawed argument from authority. Science isn't based on votes. I could be right and the entire scientific community could be wrong. If you can't be bothered to read the paper, let alone consider its conclusions, then you are not interested in gaining any knowledge. Darwin himself had to oppose conventional thinking in his day when he published his magnum opus.

mrg · 16 January 2011

Atheistoclast said: You are making a flawed argument from authority. Science isn't based on votes. I could be right and the entire scientific community could be wrong. If you can't be bothered to read the paper, let alone consider its conclusions, then you are not interested in gaining any knowledge. Darwin himself had to oppose conventional thinking in his day when he published his magnum opus.
You cited the wrong guy. I was the one who said I had no obligation to listen to anyone unless they could convince me they had some mojo. And you, sir, have no mojo.

Atheistoclast · 16 January 2011

Well all you have to do is give us a copy of the paper where you did this. You know, the peer reviewed journal article. What...? It wasn't a real journal? Well why not?
Complexity is a peer-reviewed journal published by Wiley-Blackwell.It is cross-discipline and intended for all scientists. The subject of the paper was too broad for just a bog standard biology/genetics journal. I have 3 more papers under review at mainstream journals and am writing up one more. This is just the beginning of the end of the Darwinian paradigm.

DS · 16 January 2011

Atheistoclast said:
Why should the opinion of one person, who wrote one review paper somewhere, be considered as important as the thousands of papers where the authors reached exactly the opposite conclusion?
You are making a flawed argument from authority. Science isn't based on votes. I could be right and the entire scientific community could be wrong. If you can't be bothered to read the paper, let alone consider its conclusions, then you are not interested in gaining any knowledge. Darwin himself had to oppose conventional thinking in his day when he published his magnum opus.
No I'm not. I am simply saying that the people who actually did the research and submitted the papers for peer review in real journals have all reached a different conclusion than you have. You must prove them all wrong to be taken seriously. So far, you haven't even done any real research so you haven't earned the right to review anything. You have no new evidence, you just have your own conclusion. Science is based on evidence not authority. You have neither.

DS · 16 January 2011

Atheistoclast said:
Well all you have to do is give us a copy of the paper where you did this. You know, the peer reviewed journal article. What...? It wasn't a real journal? Well why not?
Complexity is a peer-reviewed journal published by Wiley-Blackwell.It is cross-discipline and intended for all scientists. The subject of the paper was too broad for just a bog standard biology/genetics journal. I have 3 more papers under review at mainstream journals and am writing up one more. This is just the beginning of the end of the Darwinian paradigm.
When you get those papers in real journals, I and everyone else will have a look at them. Assuming you can get them past the peer review process of course. End of evolution eh. Now where have I heard that before?

mrg · 16 January 2011

DS said: End of evolution eh. Now where have I heard that before?
"The windmills are weakening!"

DS · 16 January 2011

mrg said:
DS said: End of evolution eh. Now where have I heard that before?
"The windmills are weakening!"
"Stand still while I braineth thee."

mrg · 16 January 2011

DS said: "Stand still while I braineth thee."
I can't figure out if that's Month Python, Bugs Bunny, the Three Stooges -- or if it matters which.

DS · 16 January 2011

The thing is that in order to overthrow "Darwinism" you have to propose some alternative. That alternative has to explain all of the evidence. It has to have more predictive and explanatory power than the original theory. Now so far all you have got is lots of "I don't think that could happen". What alternative are you proposing? What journal are you proposing it in?

See, the thing is, that even if it could be conclusively proven that gene duplication could not be a mechanism of evolution, it would not mean the end of evolutionary theory. Darwin didn't know anything about genes let alone duplication. The theory does not rest on that mechanism. Are you going to destroy common descent, random mutation and natural selection as well? What journal will that be in again?

DS · 16 January 2011

mrg said:
DS said: "Stand still while I braineth thee."
I can't figure out if that's Month Python, Bugs Bunny, the Three Stooges -- or if it matters which.
It's Jim Carey in The Cable Guy. The scene in the restaurant with the knights and the swords and such. He can't catch the guy to hit him with the sword, so he demands that he stand still and take it like a man. A really stupid man, but whatever. I guess it is kind of like asking one of the stooges to pick a finger to get pocked with, now that you mention it.

mrg · 16 January 2011

DS said: It's Jim Carey in The Cable Guy.
Ah, that explains it, I'm not a Carey fan. Become even less of one since he became an antivaxer. Does fit Bugs, too -- RABBIT HOOD from 1949: SHERIFF: [bows] BUGS: “Arise, Sir Loin of Beef!” BASH! “Arise, Oil [Earl] of Cloves!” BASH! “Arise, Duke of Brittingham!” BASH! “Arise, Baron of Münchhausen!” BASH! “Arise, Essence of Myrrh!” BASH! “Milk of Magnesia!” BASH! "Quarter of Ten!” BASH! SHERIFF [dazed] “You are ... too kind, your ... majesty.” BUGS [to audience]: “Got lots of stamina, doesn't he?”

Atheistoclast · 16 January 2011

DS said: When you get those papers in real journals, I and everyone else will have a look at them. Assuming you can get them past the peer review process of course.
Please tell me why Complexity is not a "real journal"? Maybe you would like to email its editors, two leading scientists in their fields, Hubbler and Schuster, and tell them that they are wasting their time. I have already published another piece in Bioeconomics. http://www.springerlink.com/content/q767h613177m34r1/ All you have to offer is an argument from authority. You defer to the interpretations of others. And then people have the gall to wonder why Darwinism is called a religion? I oppose "hierocracy" within science.

James F · 16 January 2011

For those playing at home, Complexity has an impact factor of 0.948. It's a real journal with a really low impact factor.

Mike Elzinga · 16 January 2011

Atheistoclast said: I oppose "hierocracy" within science.
Yes indeed; you would. All pseudo-scientists and scientist wannabes – which, by the way, include all ID/creationist leaders – hate the fact that they can’t cut it as scientists. Real scientists have the guts and stamina to do real research day in and day out for decades. That's how respect is earned in science; not by constantly carping from the sidelines.

Scott F · 16 January 2011

Atheistoclast said: Btw, "Darwinist" is a term that refers to those evolutionists who regard natural selection as the principal mechanism behind biological change. It was invented by Darwin's disciples.
"I do not think it means what you think it means." Disciple appears to have a religious context. Whether you intended it in its religious context is immaterial. Darwin had some great insights, but they were incomplete, and he got several things wrong. There are no more "disciples" of Darwin than there are "disciples" of Newton railing against "disciples" of Einstein. There is no one here that I have seen who can be described as a "disciple" of Darwin, "spreading the teachings of another". Science doesn't work that way. 150 years later, science has moved on from Darwin. Perhaps you hadn't noticed? So, I'll bite. By your comments, I presume you are not of the "Darwinist" sect of the "evolutionist" movement. What then would you consider to be "the principal [sic] mechanism behind biological change"?

Scott F. · 16 January 2011

Scott F said: "the principal [sic] mechanism behind biological change"?
Dang. My bad. I keep getting "principle" and "principal" confused. I thought I had it right this time. Sorry about that. Regardless, the question remains: What would you consider to be "the principal mechanism behind biological change"?

DS · 16 January 2011

Atheistoclast said:
DS said: When you get those papers in real journals, I and everyone else will have a look at them. Assuming you can get them past the peer review process of course.
Please tell me why Complexity is not a "real journal"? Maybe you would like to email its editors, two leading scientists in their fields, Hubbler and Schuster, and tell them that they are wasting their time. I have already published another piece in Bioeconomics. http://www.springerlink.com/content/q767h613177m34r1/ All you have to offer is an argument from authority. You defer to the interpretations of others. And then people have the gall to wonder why Darwinism is called a religion? I oppose "hierocracy" within science.
Well lad, you ain't gonna overthrow modern evolutionary theory by publishing in Bioeconomics. And claiming that selection cannot produce innovation is either just plain ignorant or just plain wrong. You seem to have forgotten the other part of the evolutionary equation there dude. Complexity has ruined its own reputation, if it ever had one, by publishing unsubstantiated review articles such as the one you linked to. You will have to do better than that if you want to overthrow "Darwinism" dude. If you want to claim that requiring research to be published in peer reviewed journals is an argument form authority, so be it. You still ain't got none. And you still have provided no alternative, now why is that?

Atheistoclast · 16 January 2011

If you want to claim that requiring research to be published in peer reviewed journals is an argument form authority, so be it. You still ain't got none. And you still have provided no alternative, now why is that?
Good science sometimes means going over old ground. Evidently, you are not aware of this habit. If you actually read the paper, you will see that there is lots of new perspectives on the best examples of gene duplication. There are also new sequence alignments that have never been presented before. It really is pathetic to dismiss a paper you refuse to read: What are you afraid of, Darwinist? You scared you might find something you don't like?? Awww.....

Mike Elzinga · 16 January 2011

Atheistoclast said: It really is pathetic to dismiss a paper you refuse to read: What are you afraid of, Darwinist? You scared you might find something you don't like?? Awww.....
This is called taunting. It goes all the way back to Henry Morris and Duane Gish, neither of whom ever corrected any of the misconceptions and misrepresentations of science that they used to taunt scientists into debating them. And, like them, you don’t have the knowledge to publish your “reviews” in any real journal. And, for the record; many of us here have read just about everything that ID/creationists have written. It’s wrong; all of it, from the ground up. Once we spot the misconceptions and misrepresentations in any ID/creationist writing, we already know what the rest of it will conclude; and the ID/creationist conclusions will still be wrong.

Stanton · 16 January 2011

Atheistoclast said: Btw, "Darwinist" is a term that refers to those evolutionists who regard natural selection as the principal mechanism behind biological change. It was invented by Darwin's disciples.
What modern evolutionary biologist refers to him or herself as a "Darwinist"? The only people who use the term "Darwinist" are historians of science, and Creationists, the latter of whom use the term as a racial slur to slander actual biologists, other scientists they hate and despise, as well as atheists, as being members of an evil pagan cult, "Darwinism" And if you are extremely hesitant to roll your sleeves up to do lab and field work to verify your conclusions, as did the people whose work you reviewed, and whom you slander as being evil pagan cultists, there is no reason for anyone to respect you.

Stanton · 16 January 2011

Atheistoclast said:
If you want to claim that requiring research to be published in peer reviewed journals is an argument form authority, so be it. You still ain't got none. And you still have provided no alternative, now why is that?
Good science sometimes means going over old ground. Evidently, you are not aware of this habit. If you actually read the paper, you will see that there is lots of new perspectives on the best examples of gene duplication. There are also new sequence alignments that have never been presented before. It really is pathetic to dismiss a paper you refuse to read: What are you afraid of, Darwinist? You scared you might find something you don't like?? Awww.....
If you want us to respect you, then how come you taunt us while using the term "Darwinist" in the exact same manner many Christian Antisemites use the term "Christ-Killer" to refer to Jews? Explain to us why taunting us, while slandering us as evil cultists is supposed to convince us to read your paper? Furthermore, why are you so insistent that your work overturns everything in Biology, yet, you are extremely quick to find excuses not to do any experiments or fieldwork that would provide evidence to support your claims?

Dale Husband · 16 January 2011

Atheistoclast said: In my paper "is gene duplication a viable explanation for the origination of biological information and complexity", I make it clear that gene duplication can indeed facilitate adaptation, but it is of a very limited nature - usually just the tweaking or tinkering of an existing function. Natural selection has the ability to optimize and elaborate on a function but not to create it from scratch. I believe I debunked the farcical hogwash of the speculative conversion of a trypsinogen-like enzyme into an antifreeze protein in their 1997 paper where they also claimed a "completely new function" had evolved. In this latest pathetic attempt of theirs, they claim the subfunctionalization of a bifunctional gene (read the paper) is some great example of biological innovation. It is not.
It's amazing how often arrogance and ignorance (and/or dishonesty) go together.
I wish the Darwinists on this site would actually care to read the papers they claim champion their ideology. "The capacity to code for a functional signal peptide (SP), in fact, existed in the precursor sequence in LdSAS-B, because we found comparable levels of AFPIII-exporting activity by the SP precursor-mature AFPIII construct and the native pre-AFPIII cDNA." "Thus, the incipient ice activity of the ancestral SAS molecule or its detached C-terminal peptide would be quite sufficient in inhibiting ice-crystal expansion in the fish body fluids." "A clear example of EAC-compelled duplication of a bifunctional ancestral gene and additionally, acceleration of conflict resolution through intragenic domain deletion in one duplicate and its neofunctionalization into a protein of distinctive function." None of these observations show how any new functionality has been created - only that it has been optimized and elaborated. None of this, therefore, detracts from the conclusions in my own paper. *Atheistoclast*
Anyone who uses the bigoted slur "Darwinist" in reference to modern biologists is fit only to be laughed at. And your attitude is a denialist one, which is opposed to any real scientific progress.
I didn't perform any lab experiments. I simply downloaded the relevant data from the NCBI website and analyzed it using a number of tools such as BLAST. The paper is a *review* of previous research, including Christina's 1997 paper on antifreeze glycoproteins. If you cannot access the paper using your library system or do not wish to pay for it, send me an email and I will provide a private copy: bozorgmehr@hotmail.co.uk
Nitpicking others' work, while doing none of your own, will not lead to us taking you seriously at all. You are clearly a pseudoscientific parasite, by your own admission.
Good science sometimes means going over old ground. Evidently, you are not aware of this habit. If you actually read the paper, you will see that there is lots of new perspectives on the best examples of gene duplication. There are also new sequence alignments that have never been presented before. It really is pathetic to dismiss a paper you refuse to read: What are you afraid of, Darwinist? You scared you might find something you don't like?? Awww.....
How old are you? Last time I checked, this wasn't a grade school playground.

DS · 16 January 2011

Atheistoclast said:
If you want to claim that requiring research to be published in peer reviewed journals is an argument form authority, so be it. You still ain't got none. And you still have provided no alternative, now why is that?
Good science sometimes means going over old ground. Evidently, you are not aware of this habit. If you actually read the paper, you will see that there is lots of new perspectives on the best examples of gene duplication. There are also new sequence alignments that have never been presented before. It really is pathetic to dismiss a paper you refuse to read: What are you afraid of, Darwinist? You scared you might find something you don't like?? Awww.....
Well dude, if you think that you have new evidence that will destroy Darwinism, why don't you publish it in a reputable journal? I'm sure that Nature or Science would be glad to have it. As for your paper, I read the abstract. I was not impressed. I decided not to read the rest. "New perspectives" do not destroy well studied and well documented mechanisms. Only new evidence can do that. You don't have any. Now, one last time, just to be fair. What is your alternative? Don't have one you are willing to admit to do you? Thought not.

DS · 16 January 2011

Well if Atheistoclast is so keen on reading papers, perhaps he will want to read this one posted by Joe Fly on this very thread:

http://www.nature.com/nature/journa[…]re09649.html

It documents the importance of gene duplication in evolutionary time. Now when he can explain this actual data, published in the most respected scientific journal in the world, then maybe someone will want to read his paper. Until then, it seems rather pointless.

Thanks to Joe for the link.

DS · 16 January 2011

That should be Jose Fly. Sorry Jose.

DS · 16 January 2011

If anyone is interested in a real review of some of the evidence for the importance of gene duplications as a mechanism of evolution in a journal specializing in reviews in this field, here is a good article:

Zhang (2003) Evolution by gene duplication: an update. Trends in Ecology and Evolution 18(6):292-298.

It has 78 references, all of which disagree with atheistoclast. But then I'm sure he is well aware of this evidence, since he wrote a review paper of his own on the subject. If he hasn't read it, I'm sure he will. I'm sure he will not be afraid to read it. I'm sure he is not scared that he will find something he overlooked, or something he won't like.

James F · 16 January 2011

This reminds of a segment on This American Life, recommended for all.

http://www.thisamericanlife.org/radio-archives/episode/293/a-little-bit-of-knowledge

ACT THREE. SUCKER MC-SQUARED.
Bob Berenz had a good job as an electrician. But he wanted to do something bigger. He came up with an idea for an invention. But as he studied physics texts to see if his invention could work, he happened upon the biggest idea of his life: A revelation about physics that would disprove Einstein, and Newton. That is, if Bob's right. Bob's friend, Robert Andrew Powell, reports the story. He's a sports writer and the author of We Own This Game, about youth football. (16 minutes)

Mike Elzinga · 16 January 2011

James F said: This reminds of a segment on This American Life, recommended for all. http://www.thisamericanlife.org/radio-archives/episode/293/a-little-bit-of-knowledge ACT THREE. SUCKER MC-SQUARED. Bob Berenz had a good job as an electrician. But he wanted to do something bigger. He came up with an idea for an invention. But as he studied physics texts to see if his invention could work, he happened upon the biggest idea of his life: A revelation about physics that would disprove Einstein, and Newton. That is, if Bob's right. Bob's friend, Robert Andrew Powell, reports the story. He's a sports writer and the author of We Own This Game, about youth football. (16 minutes)
I suspect most working physicists have encountered some character who “knows” more than any physicist. About 16 years ago I encountered a couple of guys that had glommed onto a couple of my students and convinced them of some weird “science” involving Tesla coils (I think everybody has heard the story of Tesla). These characters had also been working on some franchise connected with Joe Newman, and also wanted someone to invest in a motor that put out more energy than it took in. They claimed to have proven the “science,” and they just needed a physicist to offer a testimonial. They hounded me for weeks; and I had a hard time getting away from them. Trying to convince them they were wrong just made them more persistent. Ignoring them finally worked.

raven · 17 January 2011

atheistoclast: All you have to offer is an argument from authority.
All you, atheistoclast, have is outright lies and insults.Starting with this thread which references a lot of data on gene duplication and exaptation, data being the opposite of appeal to authority. Being a kook proves nothing but that you have personality problems. It also has zero to do with science, and a lot to do with being a crackpot. I can't read anything but the Complexity abstract which is just a series of assertions without proof. It is behind a paywall and I refuse on moral grounds to pay for crackpot reading material.

raven · 17 January 2011

and also wanted someone to invest in a motor that put out more energy than it took in.
There are always a lot of perpetual motion machines floating around and free energy devices. Just like the creationists, they have their own journals too. I believe the leader in the field is Infinite Energy. Unlike the creationists, they are mostly harmless in the overall scheme of things.

Elizabeth Liddle · 17 January 2011

To be fair on atheistoclast, I see no problem in analysing publicly available data and calling it "research". But that isn't what a review is, and Bozorgmehr's paper is not a "review".

It's an attempt to make an argument from data, which is a perfectly worthy exercise, in principle.

It's also one of the worst pieces of work I've ever seen get past peer-review.

Atheistoclast · 17 January 2011

raven said: All you, atheistoclast, have is outright lies and insults.Starting with this thread which references a lot of data on gene duplication and exaptation, data being the opposite of appeal to authority. I can't read anything but the Complexity abstract which is just a series of assertions without proof. It is behind a paywall and I refuse on moral grounds to pay for crackpot reading material.
Did you actually read the paper by Cheng? Reading abstracts alone will hardly get you anywhere. If you want to read my paper, I can send you a private copy which backs up all of the claims made in the abstract: bozorgmehr@hotmail.co.uk. If you don't want to learn anything, that is your problem. It really is pathetic how you want to diss a paper you haven't even bothered to read.

Atheistoclast · 17 January 2011

DS said: Well dude, if you think that you have new evidence that will destroy Darwinism, why don't you publish it in a reputable journal? I'm sure that Nature or Science would be glad to have it. As for your paper, I read the abstract. I was not impressed. I decided not to read the rest. "New perspectives" do not destroy well studied and well documented mechanisms. Only new evidence can do that. You don't have any. Now, one last time, just to be fair. What is your alternative? Don't have one you are willing to admit to do you? Thought not.
Nature don't publish review articles that are not solicited. The same goes for PNAS or Science. Also, you have to suppose that the editors of these champions of naturalism and evolutionism are prepared to shoot themselves in the foot by publishing a paper that exposes all the deceit and extrapolation regarding gene duplication and neofunctionalization. I don't think so. Anyway, like I say, more papers are on the way - these are all original research papers. The levees that buttress Darwinism can only be expected to hold out for so long. The game is up.

Atheistoclast · 17 January 2011

Atheistoclast said: It's also one of the worst pieces of work I've ever seen get past peer-review.
And yet it did get past peer review and ...so far.. nobody has been able to refute or even dispute anything in it.Does anyone here have anything actually constructive to say or is this site just a Darwinist-feel-good forum?

SWT · 17 January 2011

raven said: I can't read anything but the Complexity abstract which is just a series of assertions without proof. It is behind a paywall and I refuse on moral grounds to pay for crackpot reading material.
If you'd like a copy, drop me an email at swt.onpt at yahoo.com ... I think sending a single copy to someone as part of a discussion of the content is probably within the bounds of fair use.

Atheistoclast · 17 January 2011

For those of you who can't get access to the Cheng paper you can access it on her site.

http://www.life.illinois.edu/ccheng/Deng%20et%20al%20PNAS2010_online.pdf

It does help to read the paper *before* you rant on about how it supports evolution by exaptation.

raven · 17 January 2011

AC: It really is pathetic how you want to diss a paper you haven’t even bothered to read.
Not as pathetic as a crazy crackpot who rejects 200 years of modern science without understanding or reading it. That's you, for the sarcasm challenged. Thanks for the offer of an email of your paper, but no thanks. For safety reasons my email has and will be private. If it is worth reading, even to dismiss, enough shows up on line sooner or later.

RBH · 17 January 2011

Let's bear in mind that "published in a peer-reviewed journal" is not synonymous" with "admitted to the canon." The vast majority of published papers in peer reviewed journals sink beneath the waves, never to be cited or heard about again.

Passing peer review, however shakily, means only that a couple of reviewers and an editor thought it was worth putting out there to see if it might fly. My bet is that in this case, it won't.

DS · 17 January 2011

Atheistoclast said: Nature don't publish review articles that are not solicited. The same goes for PNAS or Science. Also, you have to suppose that the editors of these champions of naturalism and evolutionism are prepared to shoot themselves in the foot by publishing a paper that exposes all the deceit and extrapolation regarding gene duplication and neofunctionalization. I don't think so. Anyway, like I say, more papers are on the way - these are all original research papers. The levees that buttress Darwinism can only be expected to hold out for so long. The game is up.
Well that didn't take long. The old "it's all one big conspiracy against poor little old me" routine. Dude, I'm telling you, if you really had anything, anything at all that actually did challenge "Darwinism" real journals would be falling all over themselves to publish it. But claiming that natural selection cannot produce innovation is like claiming that betting cannot produce new hands in poker. It might be true, but it is completely irrelevant and has nothing whatsoever to do with reality. Attacking straw man arguments about your misconceptions of evolution isn't going to get you anywhere. And by the way, claiming that gene duplication isn't important for evolution is like claiming that doubling down isn't important in black jack. Even if it were true, which it ain't, you could still play black jack. Thanks for admitting that you have no alternative. So even if you do manage to destroy all of the levees, you have absolutely nothing to replace them with. You do know that that won't work out well for anyone living in the area, right? If I were you I would be working more on a replacement than on tearing down things. You are capable of innovation aren't you?

DS · 17 January 2011

Atheistoclast said:
raven said: All you, atheistoclast, have is outright lies and insults.Starting with this thread which references a lot of data on gene duplication and exaptation, data being the opposite of appeal to authority. I can't read anything but the Complexity abstract which is just a series of assertions without proof. It is behind a paywall and I refuse on moral grounds to pay for crackpot reading material.
Did you actually read the paper by Cheng? Reading abstracts alone will hardly get you anywhere. If you want to read my paper, I can send you a private copy which backs up all of the claims made in the abstract: bozorgmehr@hotmail.co.uk. If you don't want to learn anything, that is your problem. It really is pathetic how you want to diss a paper you haven't even bothered to read.
Yea, right. Speaking of which, have you read those papers I provided links to yet? Hope so, because you did publish stuff claiming that they were not correct. You did read them, right? You're not just another hypocrite grinding his own axe to slaughter the "Darwinists" with, right?

raven · 17 January 2011

Atheistoclast lying: nobody has been able to refute or even dispute anything in it.
Never takes long for the crackpots to start lying. Few to no one can even get your paper. This is a drawback to publishing in obscure, off topic journals like Complexity. I never heard of it before this thread, It is a Mathematics themed journal of no interest to biologists. IT IS BEHIND A PAYWALL. As explained before, on moral and ethical grounds, I refuse to pay for crackpot material. The abstract was long ago posted on this thread, all that is available. It is a standard set of creationist lies, assertions without proof. As Hitchens points out, assertions without proof can be dismissed without proof. If all you have are lies, insults, and rants and raves (quite likely as a crackpot), well lie and insult away. Many of us won't even know. Crackpots are boring, life span is finite, and the world is a huge interesting place.

raven · 17 January 2011

swt: If you’d like a copy, drop me an email at swt.onpt at yahoo.com … I think sending a single copy to someone as part of a discussion of the content is probably within the bounds of fair use.
Thanks. For safety reasons, I can't use my real email addresses on line. There are some workarounds but they are clumsy, slow, and take too much time right now. Anything worthwhile shows up eventually somewhere, and I do have access to a university library.

SteveF · 17 January 2011

RBH said: Let's bear in mind that "published in a peer-reviewed journal" is not synonymous" with "admitted to the canon." The vast majority of published papers in peer reviewed journals sink beneath the waves, never to be cited or heard about again. Passing peer review, however shakily, means only that a couple of reviewers and an editor thought it was worth putting out there to see if it might fly. My bet is that in this case, it won't.
Part of a'clasts trolling M.O. (along with many trolls obviously) is to write absurd stuff that he almost certainly doesn't believe, in order to get a response from people. His holocaust denial is probably an example of this, but in the evolution fora at TR more concrete instances are pretending to take the Noachian story literally, saying things about genesis that he clearly doesn't take seriously and other related stuff. I find it all fairly amusing, though it winds some people up enormously. Hence he's successful in his trolling and I imagine sits at home with a fairly big grin on his face. Anyway, one fairly regular example of deliberately saying stupid things to troll people is his frequent mentions of "kinds". He intersperses this (and the other deliberately dumb stuff mentioned above) in amongst the stuff that has the more sophisticated scientific veneer (e.g. BLAST based analyses). It makes for a nicely varied trolling exercise. What's particularly hilarious is that he has adopted this approach, with very little tinkering, in his paper. So we the BLAST analyses and we have mention of "kinds". And this got accepted. It's really quite remarkable. It's barely an exaggeration to say that he has taken some of his Talk Rational posts, tidied them up a bit, submitted them and had success. Peer review at Biocomplexity is evidently a joke. They've been trolled.

raven · 17 January 2011

Peer review at Biocomplexity is evidently a joke. They’ve been trolled.
It's possible that this obscure mathematics journal is edited by creationists. We are all familiar with the phenomena of engineers and computer programmers who are creationists. Wouldn't be the first time this has happened. Proteonomics editor published some trash that was part plagiarized and was retracted and as far as I can tell, he is a creationist. Peer review and scientific journals are changing rapidly and no longer mean what they once did. It is so easy to set up a journal these days, especially if they are online only. In medicine, there has been an explosion of quack and crackpot alternative medicine journals. One can now read all about how mercury in vaccines (which was taken out years ago in the USA) causes autism in the Journal of Heavy Metal and Autism Research and who knows how many homeopathy journals there are now. A lot of these get picked up and indexed by pubmed and show up next to PNAS, NEJM, or Science. As mentioned above, the perpetual motion machine and free energy people have their own journal.
Infinite Energy (magazine) - Wikipedia, Infinite Energy is a bi-monthly magazine published in New Hampshire that details theories and experiments concerning alternative energy. ... en.wikipedia.org/wiki/Infinite_Energy_(magazine) - Cached - Similar

SteveF · 17 January 2011

Peer review at Biocomplexity is evidently a joke. They've been trolled.
Whoops. Meant Complexity, not Biocomplexity (where peer review probably is a joke, but that's not the journal we're talking about here).

Atheistoclast · 17 January 2011

SteveF said:
Peer review at Biocomplexity is evidently a joke. They've been trolled.
Whoops. Meant Complexity, not Biocomplexity (where peer review probably is a joke, but that's not the journal we're talking about here).
Yes...you really do have your knickers in a twisst. Complexity is a mainstream journal that has been around for two decades. For the record: "Kinds" or "Types" of gene/protein do exist. http://en.wikipedia.org/wiki/List_of_types_of_proteins As for holocaust denial....I am a revisionist not a denialist. The account of the holocaust has changed since Nuremberg with the death toll at Auschwitz-Birkenau going down from 9 millon to less than 1 million - and it keeps falling as new research is done. My belief is not to believe anything unless it can be demonstrated. Darwinism is a *belief* desperate for evidence.

SteveF · 17 January 2011

Yes...you really do have your knickers in a twisst. Complexity is a mainstream journal that has been around for two decades.
Even more impressive that it's still got an abysmal impact factor.
For the record: "Kinds" or "Types" of gene/protein do exist. http://en.wikipedia.org/wiki/List_of_types_of_proteins
Nice list. Well done. Personally, I think it's hilarious that you manage to talk about "kinds" in a vaguely mainstream journal. YECs have been blabbering on about them for years without any success in an actual journal, then you turn up and a few months later you manage to squeeze it in. I'm just surprised you didn't start talking about the fall, like you did in a few TR threads. Maybe that will be in your next paper. Clasty, you seem to think I'm criticising you here. I'm not. I'm paying fulsome tribute to your remarkable trolling abilities. I think that trolling an actual, albeit shit, journal is a fantasic achievement. I congratulate you. Seriously.
As for holocaust denial....I am a revisionist not a denialist. The account of the holocaust has changed since Nuremberg with the death toll at Auschwitz-Birkenau going down from 9 millon to less than 1 million - and it keeps falling as new research is done.
Clast, you forget it's me you're talking to. SteveF. Your good TR buddy. If you're going to do the holocaust denial thing, you need to pick a different target. I've seen you do this before.

SteveF · 17 January 2011

BTW, while Complexity deserve a fair bit of criticism for being trolled, worse still is the Journal of Bioeconomics. They published atheistoclasts first paper and, if anything, it's even worse.

http://www.springerlink.com/content/q767h613177m34r1/

DS · 17 January 2011

Atheistoclast said: My belief is not to believe anything unless it can be demonstrated. Darwinism is a *belief* desperate for evidence.
Unfortunately for you, gene duplication has been conclusively demonstrated to be a major mechanism for evolution. Even if it had some limitations, which you have failed to demonstrate, evolution would still be true and you would still be wrong. So all you have to do is ignore all of the evidence and then you can believe anything you want. Did you learn that trick from Behe, or did you come up with that all on your own. Now let's see, ignores all evidence, performs no research, offers no alternative. Now where have we seen such tactics before?

Atheistoclast · 17 January 2011

I never included anything about a "mighty creator"....I was tempted to include an "intelligent artificer" but did not do so.

It seems like ,unless I publish in Nature, it doesn't count for you lot...tell that to all those millions of scientists who don't get the opportunity to get their work published in the top journals.

If you know the editor, you have a good chance. If the editor hates you, as do most evolutionist editors, then the chance of even being sent for review are zero.

Sean Carrol over at PNAS hates my guts.

SteveF · 17 January 2011

I never included anything about a "mighty creator"....I was tempted to include an "intelligent artificer" but did not do so.
That's a shame, a real missed opportunity. Since no one actually seems to have properly read the paper during the review process, you could have probably slipped pretty much anything in there.

Atheistoclast · 17 January 2011

DS said:
Atheistoclast said: My belief is not to believe anything unless it can be demonstrated. Darwinism is a *belief* desperate for evidence.
Unfortunately for you, gene duplication has been conclusively demonstrated to be a major mechanism for evolution. Even if it had some limitations, which you have failed to demonstrate, evolution would still be true and you would still be wrong. So all you have to do is ignore all of the evidence and then you can believe anything you want. Did you learn that trick from Behe, or did you come up with that all on your own. Now let's see, ignores all evidence, performs no research, offers no alternative. Now where have we seen such tactics before?
If you actually bothered to read my paper, I don't dispute that gene duplication has shaped the genome. Up to 80% of your genes are paralogous. You cannot say I fail to demonstrate the limits of gene duplication and evolution IF YOU DON'T FRIGGIN READ THE PAPER!!!!!!! What the heck is ***wrong*** with you???!!!!

Dave Wisker · 17 January 2011

Here are some notes on Atheistoclast/Bozorgmehr's paper (all quotes are from it, and all emphasis in them is mine):
Indeed, the place and extent of natural selection as a force for change in molecular biology have been questioned in recent years [8].
Reference 8 does not say this. Instead it says the reliability of two specific statistical tests in detecting positive selection may be questionable. Inflating claims and citing references that do not actually support the argument is a hallmark of ID scholarship.
Population genetics methods typically involve measuring levels of heterogeneity and polymorphism at sites including and in proximity to the one under investigation [36]. It can lead to confusing results because the effects of Darwinian selection are often the same as those of background selection—the purging of neutral alleles due to their spatial proximity to deleterious ones [37]
He takes this notion and attempts to apply it to the Sdic gene:
Further evidence for the role of selection in the development of Sdic includes a possible sweep found in the low levels of polymorphism across neighboring loci and a skewed frequency distribution of allelic variation. However, it is noted that a reduced level of heterozygosity in a region of low recombination, such as at the base of the X-chromosome where Sdic is located, is also consistent with background selection because of the effect of deleterious mutations [49].
The problem here is, while a reduced level of heterozygosity in an area of reduced recombination is indicative of background selection, another hallmark is that of greatly reduced codon usage bias. In fact, the authors of reference 49 point this out, then remark that the area containing Sdic shows greatly increased codon usage bias. Atheistoclast cherry-picked the information from that reference, and ignored that which contradicted his thesis. In other words, his carefully chosen example in fact directly contradicts his thesis. Again, this is fairly typical of much of ID scholarship (including Behe's): it's superficial and extremely brittle, falling apart once one actually assesses the references used to support the argument. Here's another howler:
In any case, as a mechanism for the creation of novel motifs and protein domains, de novo recruitment of noncoding DNA would seem extremely improbable and implausible.
Atheistoclast doesn’t actually back this assertion up, but here’s a paper directly contradictiing his assertion: Zhou Q, G Zhang, Y Zhang, S Xu, R Zhao, Z Zhan, X Li, Y Ding, SYang & WWang (2008). On the origin of new genes in Drosophila. Genome Research gr.076588.108. From the paper (my emphasis):
[D]e novo gene origination from non-coding sequences plays an unexpectedly important role during the origin of new genes, and is responsible for 11.9% of the new genes
That’s a pretty big percentage for such an improbable and implausible mechanism. Yet another example of the execrable quality of typical ID scholarship.

Dave Wisker · 17 January 2011

Here are some notes on Atheistoclast/Bozorgmehr's paper (all quotes are from it, and all emphasis in them is mine):
Indeed, the place and extent of natural selection as a force for change in molecular biology have been questioned in recent years [8].
Reference 8 does not say this. Instead it says the reliability of two specific statistical tests in detecting positive selection may be questionable. Inflating claims and citing references that do not actually support the argument is a hallmark of ID scholarship.
Population genetics methods typically involve measuring levels of heterogeneity and polymorphism at sites including and in proximity to the one under investigation [36]. It can lead to confusing results because the effects of Darwinian selection are often the same as those of background selection—the purging of neutral alleles due to their spatial proximity to deleterious ones [37]
He takes this notion and attempts to apply it to the Sdic gene:
Further evidence for the role of selection in the development of Sdic includes a possible sweep found in the low levels of polymorphism across neighboring loci and a skewed frequency distribution of allelic variation. However, it is noted that a reduced level of heterozygosity in a region of low recombination, such as at the base of the X-chromosome where Sdic is located, is also consistent with background selection because of the effect of deleterious mutations [49].
The problem here is, while a reduced level of heterozygosity in an area of reduced recombination is indicative of background selection, another hallmark is that of greatly reduced codon usage bias. In fact, the authors of reference 49 point this out, then remark that the area containing Sdic shows greatly increased codon usage bias. Atheistoclast cherry-picked the information from that reference, and ignored that which contradicted his thesis. In other words, his carefully chosen example in fact directly contradicts his thesis. Again, this is fairly typical of much of ID scholarship (including Behe's): it's superficial and extremely brittle, falling apart once one actually assesses the references used to support the argument. Here'a another howler:

SWT · 17 January 2011

A couple of points about the Complexity paper. 1) I took a quick look at the editors, Alfred Hubler and Peter Schuster. Both are very much involved in the study of complexity, evolution, and self-organization, and both have an affiliation with the Santa Fe Institute. I strongly doubt that either of them could be remotely classified as creationists, any more than Stuart Kaufmann could be considered a creationist. 2) I've looked over the Complexity paper, and I would be surprised if any mainstream evolutionary biologists were involved in the review. A key sentence from the Complexity paper:

A key problem associated with the Darwinian mechanism of evolution is that many of the putative incipient and intermediate stages in the development of a biological trait may not be useful themselves and may even be harmful.

Perhaps the biologists here would care to take a moment to critique this assertion. 3) Look carefully at Bozorgmehr's conclusion:

Therefore, although the process of gene duplication and subsequent random mutation has certainly contributed to the size and diversity of the genome, it is alone insufficient in explaining the origination of the highly complex information pertinent to the essential functioning of living organisms.

This strikes me as a straw man, since I don't know of anyone who understands evolutionary theory who asserts that gene duplication and random mutation are alone sufficient to explain the observed diversity of life on earth. 4) Several have criticized the paper for (a) being a reanalysis of previously published results and (b) not providing an alternative explanation. Reanalyses are not necessarily bad, so I don't consider this to be a significant flaw in the paper. An alternative explanation is also not mandatory, although the paper is quite unsatisfying from that standpoint. If I'm studying equations of state for gases, there's no problem with me using literature PVT data rather than generating my own, and there's nothing wrong with me trying to publish a paper that argues that, for example, the Peng-Robinson model doesn't work well or that improvement is possible in the mixing rules. However, my paper would be a lot more useful (and more widely cited) if I then present the development of a better, fundamentally-based PVT model. 5) You should also be aware that Bozorgmehr has redefined information for his own purposes:

Therefore, I have decided to define any gain in exonic information as: "The qualitative increase in operational capability and functional specificity with no resultant uncertainty of outcome."

6) Making judgments about impact factor is somewhat discipline-dependent. A lot of my work goes to journals with impact factors of 2 or less because they're the right place for the work to appear. I don't know enough about the complexity literature to make a judgment about the impact factor of Complexity.

Stanton · 17 January 2011

Atheistoclast said: As for holocaust denial....I am a revisionist not a denialist. The account of the holocaust has changed since Nuremberg with the death toll at Auschwitz-Birkenau going down from 9 millon to less than 1 million - and it keeps falling as new research is done.
Tell us again why we should trust whatever you say when you've demonstrated yourself to be a pathological liar who makes up excuses to avoid doing any actual research?
My belief is not to believe anything unless it can be demonstrated. Darwinism is a *belief* desperate for evidence.
Evolution has been demonstrated repeatedly, and you've demonstrated that you are addicted to using the term "Darwinism" as a racist slur on top of being a petty bully and a liar.

Dave Wisker · 17 January 2011

Sorry about the double post.

Stanton · 17 January 2011

Atheistoclast said: It seems like ,unless I publish in Nature, it doesn't count for you lot...tell that to all those millions of scientists who don't get the opportunity to get their work published in the top journals.
Perhaps if you did actual research, rather than just nitpick and naysay other people's research because they conflict with your religious bigotries, and refrained from using the terms "Darwinist" and "Darwinism" in the way Creationists use the terms, i.e., taunting, slurring synonyms for "Atheist" and "Devil Worship," people would be less hostile to you here. But, since you do not appear to be willing to do so...
If you know the editor, you have a good chance. If the editor hates you, as do most evolutionist editors, then the chance of even being sent for review are zero. Sean Carrol over at PNAS hates my guts.
So, tell us why an editor wouldn't hate you if your normal behavior is to taunt people who do not nod their heads in time to whatever you say? You whine about wanting respect from us, yet, constantly make up excuses and taunts about why you have no desire to earn it from us here or anywhere else.

DS · 17 January 2011

"A key problem associated with the Darwinian mechanism of evolution is that many of the putative incipient and intermediate stages in the development of a biological trait may not be useful themselves and may even be harmful."

Exactly. That's why gene duplication is such an important mechanism. By removing sequences form functional constraint, it provides the opportunity for exploring the adaptive topology.

"Therefore, although the process of gene duplication and subsequent random mutation has certainly contributed to the size and diversity of the genome, it is alone insufficient in explaining the origination of the highly complex information pertinent to the essential functioning of living organisms."

And there it is in black and white, the old conservation of information argument. And not just any information, but "highly complex information" at that. So gene duplication has been a major factor in shaping the genome, but it can't in any way make any new genes, even though they could be produced from non coding sequences. No wonder this guy can't get published in any real biology journals.

Thanks to Dave for the reference. I'm sure that anyone who has written a review would already be familiar with it.

DS · 17 January 2011

Atheistoclast said: I never included anything about a "mighty creator"....I was tempted to include an "intelligent artificer" but did not do so. It seems like ,unless I publish in Nature, it doesn't count for you lot...tell that to all those millions of scientists who don't get the opportunity to get their work published in the top journals. If you know the editor, you have a good chance. If the editor hates you, as do most evolutionist editors, then the chance of even being sent for review are zero. Sean Carrol over at PNAS hates my guts.
Wrong again. The point is not that you have to get published in any particular journal. The point is that in order to claim that everything in every major journal is wrong, you have to do more than publish opinions in minor journals with dubious connections to the actual subject matter. Extraordinary claims require extraordinary evidence. You got nothin. If you think that there is a limit to what evolution can do, just say what it is and why you think that. If you can't, just go away. If you can, propose a viable alternative. Now I wonder why Sean has such a low opinion of you? Could it be that he sees right through your bullshit? Could it be that he wants to protect science form nut jobs who proclaim the end of the most tested and successful theory in all of science based on nothing but their own ignorance and incredulity? Could that have anything to do with it? You know Sean has actually done real experiments, right? You know he has earned the right to write review articles, right?

Stanton · 17 January 2011

DS said: Now I wonder why Sean has such a low opinion of you? Could it be that he sees right through your bullshit? Could it be that he wants to protect science form nut jobs who proclaim the end of the most tested and successful theory in all of science based on nothing but their own ignorance and incredulity? Could that have anything to do with it? You know Sean has actually done real experiments, right? You know he has earned the right to write review articles, right?
If Atheistoclast allowed himself to be aware of these facts concerning Sean Carrol, do you honestly think that Atheistoclast would be here, wasting everyone's time by trolling and taunting, and whining about his Galileo Martyr Complex?

Malchus · 17 January 2011

Atheioclast, do you consider your paper in Complexity to be original research?

Mike Elzinga · 17 January 2011

RBH said: Let's bear in mind that "published in a peer-reviewed journal" is not synonymous" with "admitted to the canon." The vast majority of published papers in peer reviewed journals sink beneath the waves, never to be cited or heard about again. Passing peer review, however shakily, means only that a couple of reviewers and an editor thought it was worth putting out there to see if it might fly. My bet is that in this case, it won't.
One of my “famous” papers is three blank pages in the Journal of Vacuum Science and Technology. In March 1990 the military swooped in and stopped the presses just as the journal was going to print. It’s still classified.

DS · 17 January 2011

So in one paper he argues that selection alone cannot produce any new information. In another paper he argues that gene duplication and mutation alone cannot produce new information. Sound familiar?

This is probably what got the Japanese in trouble in WWII. They figured that the US had boats, but they could not attack from the air and the US had planes but they could not fly far enough to attack. Therefore, it was impossible for any US planes to attack any targets in the Pacific! Perfect logic.

DS · 17 January 2011

Mike Elzinga said: One of my “famous” papers is three blank pages in the Journal of Vacuum Science and Technology.
And yet that paper still had more highly complex information than the paper in Complexity. Go figure.

Malchus · 17 January 2011

Atheioclast, precisely how much highly complex information is in the genome? How did you calculate it? Please be specific. Thanks.

mrg · 17 January 2011

DS said:
Mike Elzinga said: One of my “famous” papers is three blank pages in the Journal of Vacuum Science and Technology.
And yet that paper still had more highly complex information than the paper in Complexity. Go figure.
"If a tree falls in a forest, and if it's classified information, does it still make a sound?"

fnxtr · 17 January 2011

Mike Elzinga said: One of my “famous” papers is three blank pages in the Journal of Vacuum Science and Technology. In March 1990 the military swooped in and stopped the presses just as the journal was going to print. It’s still classified.
Supercavitation? No, wait don't tell me. I don't want you to have to kill me. I'll just wait for the Wikileak.

Atheistoclast · 17 January 2011

Atheistoclast doesn’t actually back this assertion up, but here’s a paper directly contradictiing his assertion: Zhou Q, G Zhang, Y Zhang, S Xu, R Zhao, Z Zhan, X Li, Y Ding, SYang & WWang (2008). On the origin of new genes in Drosophila. Genome Research gr.076588.108. From the paper (my emphasis):
[D]e novo gene origination from non-coding sequences plays an unexpectedly important role during the origin of new genes, and is responsible for 11.9% of the new genes
That’s a pretty big percentage for such an improbable and implausible mechanism. Yet another example of the execrable quality of typical ID scholarship.
Actually, I do back it up. In the case of CLLU1 - the "de novo" gene is more than likely a reactivated pseudogene (it was affected by a frameshift) and I explain why: the same is likely true for BSC4 in baker's yeast. Either that or the parallel deactivation in lineages was the responsible factor. Always look for the most parsimonious explanation. The research on fruit flies again only shows that in some lineages coding DNA has become non-coding. The dishonest evolutionists - notably Zhang et al - perverts this observation and claims that a sequence of non-coding DNA became coding. They fail to also describe what these "de novo" genes exactly do - *FAIL*. The idea that a random string of ncDNA can become exonized as a functional domain is derisory. The problem with evolution science is that it is more a matter of *interpretation* than anything objective and determinable. Sometimes people want to see what actually isn't there.

Mike Elzinga · 17 January 2011

mrg said:
DS said:
Mike Elzinga said: One of my “famous” papers is three blank pages in the Journal of Vacuum Science and Technology.
And yet that paper still had more highly complex information than the paper in Complexity. Go figure.
"If a tree falls in a forest, and if it's classified information, does it still make a sound?"
Not if there is a mole around somewhere.

Mike Elzinga · 17 January 2011

Atheistoclast said: The problem with evolution science is that it is more a matter of *interpretation* than anything objective and determinable. Sometimes people want to see what actually isn't there.
Is it a matter of interpretation that atoms form molecules? Is it a matter of interpretation that atoms and molecules form liquids and solids? Is it a matter of interpretation that atoms and molecules form all sorts of organic compounds with extremely complicated properties? Is it a matter of interpretation that the laws of physics and chemistry stop working at some level of complexity and that some intelligently injected “information” takes over where chemistry and physics fear to tread? Of course you already know at exactly what point this all occurs. Why don’t you have a Nobel Prize; and why aren’t prestigious journals clamoring for your “research?” In nearly 50 years no ID/creationist has ever been able to explain why and at what level the laws of physics and chemistry are displaced by “information.” Neither can you. You don’t even know how “information” pushes atoms and molecules around.

Stanton · 17 January 2011

Atheistoclast said:
Atheistoclast doesn’t actually back this assertion up, but here’s a paper directly contradictiing his assertion: Zhou Q, G Zhang, Y Zhang, S Xu, R Zhao, Z Zhan, X Li, Y Ding, SYang & WWang (2008). On the origin of new genes in Drosophila. Genome Research gr.076588.108. From the paper (my emphasis):
[D]e novo gene origination from non-coding sequences plays an unexpectedly important role during the origin of new genes, and is responsible for 11.9% of the new genes
That’s a pretty big percentage for such an improbable and implausible mechanism. Yet another example of the execrable quality of typical ID scholarship.
Actually, I do back it up. In the case of CLLU1 - the "de novo" gene is more than likely a reactivated pseudogene (it was affected by a frameshift) and I explain why: the same is likely true for BSC4 in baker's yeast. Either that or the parallel deactivation in lineages was the responsible factor. Always look for the most parsimonious explanation. The research on fruit flies again only shows that in some lineages coding DNA has become non-coding. The dishonest evolutionists - notably Zhang et al - perverts this observation and claims that a sequence of non-coding DNA became coding. They fail to also describe what these "de novo" genes exactly do - *FAIL*. The idea that a random string of ncDNA can become exonized as a functional domain is derisory. The problem with evolution science is that it is more a matter of *interpretation* than anything objective and determinable. Sometimes people want to see what actually isn't there.
So why is a reactivated pseudogene not "new information" and why do you call these people dishonest if the only crime they've committed is to come to a conclusion different than what your religious bigotries permit?

mrg · 17 January 2011

Stanton said: So why is a reactivated pseudogene not "new information" ...
Because it wasn't magically poofed into existence de novo, silly. "Doncha know nuttin'?"

Atheistoclast · 17 January 2011

Stanton said: So why is a reactivated pseudogene not "new information" and why do you call these people dishonest if the only crime they've committed is to come to a conclusion different than what your religious bigotries permit?
In the case of CLLU1, one of two things happened: 1) A gene became pseuodogenized and then was reactivated in humans. It only took a single nucleotide indel. 2) A gene was psudogenized by parallel evolution in chimps and other primates but not in humans. Either way, no new information was created - it may only have been restored. It is *dishonest* to claim that a gene was created "de novo" when the more plausible explanations are given above. This is the latest *gimmick* of the Darwinists - namely that new genes and functionality can arise spontaneously and even miraculously. They tried as much with the frameshift mutation until I and others debunked this nonsense. They are running out of ideas....and time.

Malchus · 17 January 2011

Exactly how much information? How did you measure it?
Atheistoclast said:
Stanton said: So why is a reactivated pseudogene not "new information" and why do you call these people dishonest if the only crime they've committed is to come to a conclusion different than what your religious bigotries permit?
In the case of CLLU1, one of two things happened: 1) A gene became pseuodogenized and then was reactivated in humans. It only took a single nucleotide indel. 2) A gene was psudogenized by parallel evolution in chimps and other primates but not in humans. Either way, no new information was created - it may only have been restored. It is *dishonest* to claim that a gene was created "de novo" when the more plausible explanations are given above. This is the latest *gimmick* of the Darwinists - namely that new genes and functionality can arise spontaneously and even miraculously. They tried as much with the frameshift mutation until I and others debunked this nonsense. They are running out of ideas....and time.

Malchus · 17 January 2011

By the way, the correct term is "evolutionary biologist".
Atheistoclast said:
Stanton said: So why is a reactivated pseudogene not "new information" and why do you call these people dishonest if the only crime they've committed is to come to a conclusion different than what your religious bigotries permit?
In the case of CLLU1, one of two things happened: 1) A gene became pseuodogenized and then was reactivated in humans. It only took a single nucleotide indel. 2) A gene was psudogenized by parallel evolution in chimps and other primates but not in humans. Either way, no new information was created - it may only have been restored. It is *dishonest* to claim that a gene was created "de novo" when the more plausible explanations are given above. This is the latest *gimmick* of the Darwinists - namely that new genes and functionality can arise spontaneously and even miraculously. They tried as much with the frameshift mutation until I and others debunked this nonsense. They are running out of ideas....and time.

Stanton · 17 January 2011

Atheistoclast said:
Stanton said: So why is a reactivated pseudogene not "new information" and why do you call these people dishonest if the only crime they've committed is to come to a conclusion different than what your religious bigotries permit?
In the case of CLLU1, one of two things happened: 1) A gene became pseuodogenized and then was reactivated in humans. It only took a single nucleotide indel. 2) A gene was psudogenized by parallel evolution in chimps and other primates but not in humans. Either way, no new information was created - it may only have been restored. It is *dishonest* to claim that a gene was created "de novo" when the more plausible explanations are given above. This is the latest *gimmick* of the Darwinists - namely that new genes and functionality can arise spontaneously and even miraculously. They tried as much with the frameshift mutation until I and others debunked this nonsense. They are running out of ideas....and time.
Gimmick? Do you know what the original functions of the alleged pseudogenes are? Why do you insist on continuing using the slur "Darwinist," (sic) and alleging they're "running out of ideas....and time" if you have no desire or stomach to verify your claims with lab or field work?

Stanton · 17 January 2011

Malchus said: By the way, the correct term is "evolutionary biologist".
Atheistoclast incapable of stopping himself from using the slur "Darwinist," just as he is totally incapable of accusing everyone anyone who disagrees with him as being "liars"

Malchus · 17 January 2011

Atheioclast, you said that your forthcoming papers were original research. What lab did you use?

Do you consider your Complexity paper to be original research?

How much information is in the genome in question? How did you calculate it?

What prevents mutation from creating an exon from non-coding DNA?

Atheistoclast · 17 January 2011

Stanton said: Do you know what the original functions of the alleged pseudogenes are? Why do you insist on continuing using the slur "Darwinist," (sic) and alleging they're "running out of ideas....and time" if you have no desire or stomach to verify your claims with lab or field work?
Yes, it is a *gimmick*. They need "hopeful monsters" to explain phenomena: In the past, the frameshift mutation was one such option for them, now it is the turn of ncDNA. Evolutionism is a pseudo-religion as much in need of miracles as any faith-based cult. Btw, The "Darwinists" actually do call themselves as such: http://en.wikipedia.org/wiki/Neo-Darwinism They are proud of it!

SteveF · 17 January 2011

Why do you insist on continuing using the slur "Darwinist," (sic) and alleging they're "running out of ideas....and time" if you have no desire or stomach to verify your claims with lab or field work?
He's trolling. It's all about getting attention and getting a reaction from people. At the moment he's succeeding.

Stanton · 17 January 2011

Malchus said: Atheioclast, you said that your forthcoming papers were original research. What lab did you use? Do you consider your Complexity paper to be original research? How much information is in the genome in question? How did you calculate it? What prevents mutation from creating an exon from non-coding DNA?
Atheistoclast said that he has neither the funds nor the desire to use a lab to verify his work. It was all done using some computer program. As for his claims that mutation is prevented from creating exons from non-coding DNA, as far as I can tell, it's because a) he says so, and b) he does what Behe did, and twist definitions in knots until he comes to a suitable hypothetical roadblock.

mrg · 17 January 2011

SteveF said: He's trolling. It's all about getting attention and getting a reaction from people. At the moment he's succeeding.
It's a mutual amusement -- it's sort of like a two-way shooting gallery. Both sides claim they're yanking the other's chain, which is obviously true.

DS · 17 January 2011

Atheistoclast said:
Atheistoclast doesn’t actually back this assertion up, but here’s a paper directly contradictiing his assertion: Zhou Q, G Zhang, Y Zhang, S Xu, R Zhao, Z Zhan, X Li, Y Ding, SYang & WWang (2008). On the origin of new genes in Drosophila. Genome Research gr.076588.108. From the paper (my emphasis):
[D]e novo gene origination from non-coding sequences plays an unexpectedly important role during the origin of new genes, and is responsible for 11.9% of the new genes
That’s a pretty big percentage for such an improbable and implausible mechanism. Yet another example of the execrable quality of typical ID scholarship.
Actually, I do back it up. In the case of CLLU1 - the "de novo" gene is more than likely a reactivated pseudogene (it was affected by a frameshift) and I explain why: the same is likely true for BSC4 in baker's yeast. Either that or the parallel deactivation in lineages was the responsible factor. Always look for the most parsimonious explanation. The research on fruit flies again only shows that in some lineages coding DNA has become non-coding. The dishonest evolutionists - notably Zhang et al - perverts this observation and claims that a sequence of non-coding DNA became coding. They fail to also describe what these "de novo" genes exactly do - *FAIL*. The idea that a random string of ncDNA can become exonized as a functional domain is derisory. The problem with evolution science is that it is more a matter of *interpretation* than anything objective and determinable. Sometimes people want to see what actually isn't there.
So the authors concluded that 11.9% of genes were produced exactly the way you said they could not be. You disagree, but have failed to demonstrate why they were wrong. You may or may not have an explanation for one gene. You certainly have not proven that new genes can never arise. You also failed to publish a rebuttal paper. If you had any evidence that they were wrong, you should have done that. Claiming that it cannot happen is not the same as proving that it did not or could no happen. It is dishonest to claim that genes cannot be produced de novo without providing a more plausible alternative. The most parsimonious explanation is never GODDIDIT. It is more parsimonious to accept that, if pseudogenes can become reactivated, they can take on new functions before becoming reactivated. Why do you assume they cannot? What could possibly prevent this? What could possibly prevent duplicated genes from taking on new functions? So let's see, you know that too much information cannot be produced without intelligence, but you can't define information or say how much can and cannot be produced without intelligence. Sound familiar?

Mike Elzinga · 17 January 2011

SteveF said: He's trolling. It's all about getting attention and getting a reaction from people. At the moment he's succeeding.
Yeah. Some of these trolls are using a shtick that they have been practicing on several boards. Eventually they get to a point where their camouflage gets them quite a few responses. Apparently this one has done an "Alan Sokal" on a low-order journal. But this troll still hasn’t figured out the blatant misconceptions he has; and nobody should tell him.

Flint · 17 January 2011

It was all done using some computer program.

Which was hashed out over at TalkRational. As a programmer, I can assure everyone that his programming skills are at the very best no better than his biology skills. Furthermore, they have much in common, in that both start with foregone conclusions and get tweaked until those conclusions are produced. The programmers at TalkRat were in stitches for days over the code he was nice enough to post. "User input" that asks for any number, only allows values from 1 to 3, and crashes if it's not 3, etc. Indeed, one could use his code to teach an entire useful programming course in how to do everything wrong (but still occasionally get the program to run). On the other hand, code need not be non-trivial, nor be able to model observed reality, when one starts with the answers anyway. I suspect the only reason his code did no more than print "you are right as usual" is, that task might have taken too long to get to run.

Stanton · 17 January 2011

Atheistoclast said:
Stanton said: Do you know what the original functions of the alleged pseudogenes are? Why do you insist on continuing using the slur "Darwinist," (sic) and alleging they're "running out of ideas....and time" if you have no desire or stomach to verify your claims with lab or field work?
Yes, it is a *gimmick*. They need "hopeful monsters" to explain phenomena: In the past, the frameshift mutation was one such option for them, now it is the turn of ncDNA. Evolutionism is a pseudo-religion as much in need of miracles as any faith-based cult. Btw, The "Darwinists" actually do call themselves as such: http://en.wikipedia.org/wiki/Neo-Darwinism They are proud of it!
Where in the article does it state that "Neo-Darwinism" is a religion like you're falsely claiming? Where in the article does it state that the use of the term "Neo-Darwinism" permits Creationists and other science-hating bigots like yourself, to use the term "Darwinist" as a racist slur? If you really do have something new and revolutionary to say about Biology, then how come you've done nothing but rehash your own willful ignorance, and whine about being persecuted, while spitting slurs at us like a common Internet troll?

SteveF · 17 January 2011

Which was hashed out over at TalkRational. As a programmer, I can assure everyone that his programming skills are at the very best no better than his biology skills. Furthermore, they have much in common, in that both start with foregone conclusions and get tweaked until those conclusions are produced.
You are correct that clastie is an hilariously awful programmer, the computer program being referred to in this instance is BLAST: http://blast.ncbi.nlm.nih.gov/Blast.cgi

SteveF · 17 January 2011

above should read:

You are correct that clastie is an hilariously awful programmer, howeveer the computer program being referred to in this instance is BLAST:

SteveF · 17 January 2011

however even. jesus.

Dave Wisker · 17 January 2011

Atheistoclast writes:
Actually, I do back it up. In the case of CLLU1 - the “de novo” gene is more than likely a reactivated pseudogene (it was affected by a frameshift) and I explain why: the same is likely true for BSC4 in baker’s yeast. Either that or the parallel deactivation in lineages was the responsible factor. Always look for the most parsimonious explanation.
Let's take Atheistoclast's advice about parsimony. In the CLLU1 gene, a frameshift mutation (caused by a point deletion of an adenine) activates the sequence in humans, because in chimpanzees and macaques, the additional adenine nucleotide creates a premature stop codon. Atheistoclast would like us to think the more parsimonious explanation is this:
However, this inference may be incorrect. Rather than the deletion creating a new stretch of translated DNA, it is likely that a back mutation restored the original ORF that became essentially divided in two as a result of an insertion— a very common phenomenon observed in indelinduced frameshifts [92].
The problem with this is, Atheistoclast didn't read the paper describing the origin of the gene thoroughly. In the description for figure 2, the authors write (my emphasis):
The disabler [the additional adenine nuxcelotide-- DW] is also shared by gorilla and gibbon indicating it is ancestral
That is, the disabling nucleotide (the extra adenine) is present in chimpanzees, orangutans, gorillas, gibbons, and macaques. It is far more parsimonious to hypothesize a simple deletion of adenine in humans as the cause. The paper in question is: Knowles DG & A McLysaght (2009). Recent de novo origin of human protein-coding genes. Genome Research 19:1752–1759 Free pdf is here: http://www3.botany.ubc.ca/biol430/Knowles%20de%20novo%20human%20genes.pdf Down goes another example in the paper, reinforcing the verdict of typically shoddy ID scholarship.

mrg · 17 January 2011

Mike Elzinga said: But this troll still hasn’t figured out the blatant misconceptions he has; and nobody should tell him.
"Should"? You might as well try to give a clue to a concrete block.

Dave Wisker · 17 January 2011

Correction: the disabler is not present in orangutans. However, if you peruse the phylogenetic relationships of these species, it is present in the ancestral groups.

OgreMkV · 17 January 2011

Atheistoclast said: snip 1) A gene became pseuodogenized and then was reactivated in humans. It only took a single nucleotide indel. 2) A gene was psudogenized by parallel evolution in chimps and other primates but not in humans. Either way, no new information was created - it may only have been restored. snip
So in case 1, did the gene have or not have 'information'? Did you ever define that by the way, that's fairly important. So in case 2, did the gene have information before or after becoming 'pseduogenized'? In either case, does the gene retain all of its information (however you choose to define it) throughout the entire process of being a gene, being a pseudogene, and becoming a gene again? If your answer to any of those is 'NO', then new information, by your own definition, is created. If your answer to all of the above is yes, then, what actually happened was, by your definition, nothing.

Dave Wisker · 17 January 2011

If your answer to any of those is ‘NO’, then new information, by your own definition, is created. If your answer to all of the above is yes, then, what actually happened was, by your definition, nothing.
That's going to leave a mark.

DS · 17 January 2011

Here is another example of what atheistoclast says can't happen:

Arnegard et. al. (2010) Old gene duplication facilitates origin and diversification of an innovative communication system - twice. PNAS 107(51): 22172-22177.

It always amuses me what excuses creationists will make up for things they say can't happen when they are given examples of just that thing happening. They always find some ad hoc excuse for disqualifying the example. Of course no one is fooled by that. Oh well, there is always quote mining.

Mike Elzinga · 17 January 2011

mrg said:
Mike Elzinga said: But this troll still hasn’t figured out the blatant misconceptions he has; and nobody should tell him.
"Should"? You might as well try to give a clue to a concrete block.
The psychology of con artists is certainly peculiar. They put so much effort into feigning the appearance of being scientists or of understanding science, but they will never put that much effort into actually learning any science fundamentals. Apparently there must be some kind of reward they get for faking it. By playing to the rube market, they more quickly elevate themselves socially; and they don’t have to go through the discomfort of rigorous training. And who in the rube market is going to know who is “winning” when they watch these con artists in an argument with real scientists? I suppose one sleeps just as easily whether one has a clear conscience or no conscience, or is so deluded that one thinks he is a superhero.

mrg · 17 January 2011

Mike Elzinga said: The psychology of con artists is certainly peculiar.
Creotrolls are lowgrade con artists: they believe their own cons. Which, as Kent Hovind found out, is a very dangerous thing to do.

Dave Wisker · 17 January 2011

Mike Elzinga writes:
Apparently there must be some kind of reward they get for faking it. By playing to the rube market, they more quickly elevate themselves socially; and they don’t have to go through the discomfort of rigorous training.
' It's something peculiar to cranks. The true crank believes training in a subject blinds one to seeing the simple truth that the crank has discovered.

Dave Wisker · 17 January 2011

One IDer I've been dealing with tried to tell me the fitness of a stable population was zero. When I pointed out the basic incoherence of his argument and suggested a course in population genetics, you know, so that he could get his basic facts straight, he admitted having taken it, but complained that it was a "waste of time" because the concept of fitness was nonsensical since it was based on differential reproductive success. Thoughts on the staircase: I should have replied that it wasn't a waste of time, it was just wasted on him.

mrg · 17 January 2011

Dave Wisker said: It's something peculiar to cranks. The true crank believes training in a subject blinds one to seeing the simple truth that the crank has discovered.
This is usually expressed as: "They can't see the forest for the trees. We don't have the preconceptions they do and so we can see matters in an objective fashion." Which in reality ends up being more like the old joke: "Can you play the violin?" "I dunno, I haven't tried." In one sense, the "forest for the trees" observation is entirely correct. When an expert says: "This is obvious." -- the novice is better qualified than the expert to observe: "No, it is not."

Mike Elzinga · 17 January 2011

mrg said: In one sense, the "forest for the trees" observation is entirely correct. When an expert says: "This is obvious." -- the novice is better qualified than the expert to observe: "No, it is not."
My old, first edition copy of J.D. Jackson’s Classical Electrodynamics has several pages in it in which, as a grad student, I responded in frustration and wrote in pen “Damnit; this is not obvious!” Then the next day, it was obvious; and it has been obvious ever since. Sometimes our brains fry when we are dog tired while trying to study.

SWT · 17 January 2011

mrg said: When an expert says: "This is obvious." -- the novice is better qualified than the expert to observe: "No, it is not."
On the other hand, when you're grading undergraduate lab reports, "It is obvious that" typically precedes something that is not only not obvious, but usually wrong.

mrg · 17 January 2011

Mike Elzinga said: My old, first edition copy of J.D. Jackson’s Classical Electrodynamics has several pages in it in which, as a grad student, I responded in frustration and wrote in pen “Damnit; this is not obvious!”
Urg. Somehow visions of my old ENGINEERING ELECTROMAGNETICS text popped into my head ... Maxwell's equations, vector calculus (div! grad! curl!). What was I just saying about obvious? Vector calculus is really nothing particularly intimidating if somebody bothers to explain it simply. It just looks intimidating. Maybe I shouldn't have said that -- John Vanko accuses me of giving the creobots ideas. Well, if ID arguments start incorporating vector calculus, now you'll know who to blame.

Dave Wisker · 17 January 2011

Mike Elzinga writes:
My old, first edition copy of J.D. Jackson’s Classical Electrodynamics has several pages in it in which, as a grad student, I responded in frustration and wrote in pen “Damnit; this is not obvious!” Then the next day, it was obvious; and it has been obvious ever since. Sometimes our brains fry when we are dog tired while trying to study.
RA Fisher was one of those biologists who would casually toss off something as if it were obvious, and leave us mortals struggling to figure it out, then eventually kicking ourselves when it did become obvious.

Mike Elzinga · 17 January 2011

mrg said: Well, if ID arguments start incorporating vector calculus, now you'll know who to blame.
They’ll be talking about dirty teeth caused by some infectious agent.

Gabriel Hanna · 17 January 2011

Mike Elzinga said:
mrg said: In one sense, the "forest for the trees" observation is entirely correct. When an expert says: "This is obvious." -- the novice is better qualified than the expert to observe: "No, it is not."
My old, first edition copy of J.D. Jackson’s Classical Electrodynamics has several pages in it in which, as a grad student, I responded in frustration and wrote in pen “Damnit; this is not obvious!” Then the next day, it was obvious; and it has been obvious ever since. Sometimes our brains fry when we are dog tired while trying to study.
When I was an undergrad is was explained to me by an ancient professor: Physics 201 doesn't make any sense. When you study Griffiths, he doesn't make any sense but you now understand 201. When you study Jackson, he doesn't make any sense but now you understand Griffiths. When you die, if you go to heaven, you may then understand Jackson. I've also found that when the author of a journal article says "it is easy to show that..." he really means "it will take you three hours of nitpicking concentration to derive..."

mrg · 17 January 2011

"Obvious in hindsight" is, also not quite the same as "obvious".

Atheistoclast · 17 January 2011

DS said: Here is another example of what atheistoclast says can't happen: Arnegard et. al. (2010) Old gene duplication facilitates origin and diversification of an innovative communication system - twice. PNAS 107(51): 22172-22177. It always amuses me what excuses creationists will make up for things they say can't happen when they are given examples of just that thing happening. They always find some ad hoc excuse for disqualifying the example. Of course no one is fooled by that. Oh well, there is always quote mining.
It amuses me that people like yourself never actually these pro-Darwinist papers beyond the title and abstract. I actually read the paper on the sodium channel gene duplication and I can tell you that the authors were making an extraordinary extrapolation - just as Cheng and the Chinese team are exaggerating the "novelty" of the antifreeze gene. I wrote a letter to PNAS but it was rejected. I have written another one for the Cheng paper. As for CLLU1, what you are amazingly claiming is that a single nucleotide insertion created a brand new gene!! I am saying that the disabling mutation's presence in the African apes is the result of a parallel deactivation (as the authors considered but chose not to accept) or, to assume a common descent, that the disabler was already inherited in the hominid lineage. Come on, it is pretty obvious that an immune system gene can become disabled.

Atheistoclast · 17 January 2011

PNAS has become pure evolutionist propaganda in recent weeks. It is really sickening to see the editors determined to publish any garbage that supports their dying ideology.

Mike Elzinga · 17 January 2011

Dave Wisker said: RA Fisher was one of those biologists who would casually toss off something as if it were obvious, and leave us mortals struggling to figure it out, then eventually kicking ourselves when it did become obvious.
That also reminds me of when I was taking my graduate quantum mechanics courses and got bogged down trying to derive a bunch of commutation relations. I finally went to the instructor with pages and pages of calculations that ended up wrong. He asked to see my work and then broke into a smile and said, “Ah, I see! Let me show you something.” He then proceeded to show me how to use what are called the Levi-Civita density symbols; which I had learned earlier in a math class but hadn’t pick up on their significance and promptly forgot them. It was like suddenly being able to fly. I whipped out the calculations in about five minutes and then went back to my office and re-derived every vector identity used in E&M and QM in about 15 minutes. It took me back to my childhood when I had learned to ride a bike. After several frustrating days of no success, I had a dream in which I flew down the sidewalk on the bike. The very next day, the dream came true. The brain is very interesting.

Mike Elzinga · 17 January 2011

Gabriel Hanna said: When you die, if you go to heaven, you may then understand Jackson.
Hah; I knew it! I’m dead! Pauli gets to heaven and asks God to explain the universe to him. God does; and when he finishes, he asks Pauli, “Well, what do you think?” Pauli says, “That’s wrong!”

Stanton · 17 January 2011

Atheistoclast said: PNAS has become pure evolutionist propaganda in recent weeks. It is really sickening to see the editors determined to publish any garbage that supports their dying ideology.
So says the incompetent, bigoted programmer who is incapable of doing experiments or fieldwork to support his own claims. Do you, by any chance, refer to Jews as "Christ-Killers"? Furthermore, it seems odd you claim that Evolutionary Biology is a "dying ideology" even though there is no output of any research for Intelligent Design for the last 2 decades it was "launched" by the Discovery Institute, while the output for Evolutionary Biology remains several thousand papers each year. Oh, wait, you're lying in order to shore up your inflated ego.

mrg · 17 January 2011

I heard a story that the hospital room where Pauli died was Room 137.

Stanton · 17 January 2011

Atheistoclast said: PNAS has become pure evolutionist propaganda in recent weeks. It is really sickening to see the editors determined to publish any garbage that supports their dying ideology.
Tell us again why we should assume that you're an authority on Evolutionary Biology even though you've confessed that you have neither the funds, nor desire to do actual research? How come you refuse to spell out exactly how and why saying "DESIGNERDIDIT" is supposed to have greater explanatory power than assuming common descent?

Atheistoclast · 17 January 2011

In my forthcoming paper I question whether the really essential stuff in our genome - the encoded and conserved protein domains - could have been generated by a process of chance and selection. I think I may have a anti-evolutionist mathematical theorem to finally settle this issue once and for all. It is time that Darwinism collapses just as Marxism did. The Berlin wall moment is nigh!

The Soviet empire collapsed in 5 years...so shall Darwinism.

It is time for regime change.

Atheistoclast · 17 January 2011

Stanton said:
Atheistoclast said: PNAS has become pure evolutionist propaganda in recent weeks. It is really sickening to see the editors determined to publish any garbage that supports their dying ideology.
Tell us again why we should assume that you're an authority on Evolutionary Biology even though you've confessed that you have neither the funds, nor desire to do actual research? How come you refuse to spell out exactly how and why saying "DESIGNERDIDIT" is supposed to have greater explanatory power than assuming common descent?
No, I do do original research - just not with this particular paper which was a meta-analysis. I am a computational biologist and so don't need chemicals, freezers and a lab coat. I am convinced that Randy Schekman, editor of PNAS, has given orders to admit any paper that is seen as defending Darwinism whilst rejecting those papers that question it. He even told me to not email him any more he was so upset with me.

Stanton · 17 January 2011

Atheistoclast said:
Stanton said:
Atheistoclast said: PNAS has become pure evolutionist propaganda in recent weeks. It is really sickening to see the editors determined to publish any garbage that supports their dying ideology.
Tell us again why we should assume that you're an authority on Evolutionary Biology even though you've confessed that you have neither the funds, nor desire to do actual research? How come you refuse to spell out exactly how and why saying "DESIGNERDIDIT" is supposed to have greater explanatory power than assuming common descent?
No, I do do original research - just not with this particular paper which was a meta-analysis. I am a computational biologist and so don't need chemicals, freezers and a lab coat.
So, how does being a computational biologist make you smarter than all of the other biologists in the whole wide world?
I am convinced that Randy Schekman, editor of PNAS, has given orders to admit any paper that is seen as defending Darwinism whilst rejecting those papers that question it. He even told me to not email him any more he was so upset with me.
Given what I've seen of you here, it could be that the staff of PNAS refuse to accept any of your papers because a) they're nonsense written by a whiny, Galileo-wannabe with a martyr complex, and b) you act like a pompous asshole who slanders everyone who doesn't agree with you as being a lying, evil cultist.

SWT · 17 January 2011

Ah, good! We've entered the violent rhetoric stage of the discussion.

Will the revolution occur before or after Atheistoclast provides substantive responses to all the questions that have been posted here?

Atheistoclast · 17 January 2011

Stanton said: So, how does being a computational biologist make you smarter than all of the other biologists in the whole wide world?
I never claimed I was. I just don't indulge in any speculation and extrapolation to justify my research grant as the others do. Science, including evolutionary theory, is big business. Do you think the likes of Lenski, Miller and Carrol are just in it for the honor? Dawkins has made a small fortune selling Darwinism to the masses. Seriously, I would be an evolutionist if I was paid well enough. Give me $100,000 and I will write a paper praising the innovation resulting from gene duplication.

Stanton · 17 January 2011

Atheistoclast said: In my forthcoming paper I question whether the really essential stuff in our genome - the encoded and conserved protein domains - could have been generated by a process of chance and selection. I think I may have a anti-evolutionist mathematical theorem to finally settle this issue once and for all. It is time that Darwinism collapses just as Marxism did. The Berlin wall moment is nigh! The Soviet empire collapsed in 5 years...so shall Darwinism. It is time for regime change.
Tell you what, why not, in your next "paper," you try explaining how, using Intelligent Design, you can explain the diversity of, say, Osteostraci better than what Evolutionary Biology says about them? Then again, I doubt that you'd bother to accept this challenge, given as how you're too busy taunting people, accusing them of being evil cultists conspiring against you, and as well as being too full of bullshit to bother.

Atheistoclast · 17 January 2011

SWT said: Ah, good! We've entered the violent rhetoric stage of the discussion. Will the revolution occur before or after Atheistoclast provides substantive responses to all the questions that have been posted here?
I already have. At the end of the day, this boils down to a matter of interpretation. You are prepared to ignore all sense and believe that natural selection is essentially divine (the real creator god)...fine...but this is a *religious* belief.

OgreMkV · 17 January 2011

So Atheistoclast,

I would really like to know the answers to these questions. They have stumped you guys for decades. I can't wait for an answer.

1) What is the difference in complexity between a designed thing and a non-designed thing?

2) How (units and process) does one measure complexity?

3) What is the value of the above measure for a designed thing?

4) What is the value of the above measure for a non-designed thing?

5) Does ID only apply to a) the universe b) living things c)small parts of living things? Why?

6) In reference to '5' above, who is the designer. (I do hope you realize that the answer to '5' depends on the answer to '6' and that the wrong answer just means that it is logically impossible for the designer one envisions to exist.)

Thanks in advance.

Stanton · 17 January 2011

Atheistoclast said:
Stanton said: So, how does being a computational biologist make you smarter than all of the other biologists in the whole wide world?
I never claimed I was.
And yet, that's what you are claiming, what with you accusing the work of the people you're nitpicking as being nothing but "lies" and "gimmicks" of a "dying ideology." And if you aren't in this for the honor or the glory, then how come you're now ranting about how glorious the regime change will be upon the alleged fall of Communism "Darwinism" (sic)? Hypocrite, much?

Stanton · 17 January 2011

Atheistoclast said:
SWT said: Ah, good! We've entered the violent rhetoric stage of the discussion. Will the revolution occur before or after Atheistoclast provides substantive responses to all the questions that have been posted here?
I already have. At the end of the day, this boils down to a matter of interpretation. You are prepared to ignore all sense and believe that natural selection is essentially divine (the real creator god)...fine...but this is a *religious* belief.
And yet, at the end of the day, you still haven't explained or demonstrated to us exactly how and exactly why your interpretation, i.e., "GODDESIGNERDIDIT" is supposed to be the superior explanation/interpretation. I bet it's because you're too busy taunting us, and howling about how great it will be when Communism "Darwinism" (sic) falls.

Mike Elzinga · 17 January 2011

mrg said: I heard a story that the hospital room where Pauli died was Room 137.
Now that one I haven’t heard. So the room was inverted?

Dave Wisker · 17 January 2011

Atheistoclast writes:
No, I do do original research - just not with this particular paper which was a meta-analysis.
Choosing a few papers and extrapolating from them is not meta-analysis. Considering that you missed one important study on the Drosophila genome that didn't support your thesis tells us your search criteria for studies that should have been included in the meta-analysis are laughable. And if you think you made any kind of legitimate statistical analysis of your data, you are sadly mistaken. You are nothing but a poseur.

Mike Elzinga · 17 January 2011

SWT said: Ah, good! We've entered the violent rhetoric stage of the discussion. Will the revolution occur before or after Atheistoclast provides substantive responses to all the questions that have been posted here?
Yikes! Another Kris infestation.

Rog · 17 January 2011

So we have established you are a prostitute.
Atheistoclast said:
Stanton said: So, how does being a computational biologist make you smarter than all of the other biologists in the whole wide world?
I never claimed I was. I just don't indulge in any speculation and extrapolation to justify my research grant as the others do. Science, including evolutionary theory, is big business. Do you think the likes of Lenski, Miller and Carrol are just in it for the honor? Dawkins has made a small fortune selling Darwinism to the masses. Seriously, I would be an evolutionist if I was paid well enough. Give me $100,000 and I will write a paper praising the innovation resulting from gene duplication.

fnxtr · 17 January 2011

Atheistoclast said: In my forthcoming paper I question whether the really essential stuff in our genome - the encoded and conserved protein domains - could have been generated by a process of chance and selection.
Gee, I wonder what your answer to that question will be...
I think I may have a anti-evolutionist mathematical theorem to finally settle this issue once and for all.
You'll have to thumb-wrestle Dembski for that Nobel, old shoe.
It is time that Darwinism collapses just as Marxism did. The Berlin wall moment is nigh! The Soviet empire collapsed in 5 years...so shall Darwinism. It is time for regime change.
Heh. Yep. Right around the time we have cheap fusion power. Pretty soon now... This guy's like Mabus on 'ludes.

Dale Husband · 17 January 2011

Atheistoclast said: Yes, it is a *gimmick*. They need "hopeful monsters" to explain phenomena: In the past, the frameshift mutation was one such option for them, now it is the turn of ncDNA. Evolutionism is a pseudo-religion as much in need of miracles as any faith-based cult. Btw, The "Darwinists" actually do call themselves as such: http://en.wikipedia.org/wiki/Neo-Darwinism They are proud of it!
Gee, it seems that when Creationist trolls lie, they lie outright. Can't you be a bit more clever and tell half-truths?

Stanton · 17 January 2011

Dale Husband said:
Atheistoclast said: Yes, it is a *gimmick*. They need "hopeful monsters" to explain phenomena: In the past, the frameshift mutation was one such option for them, now it is the turn of ncDNA. Evolutionism is a pseudo-religion as much in need of miracles as any faith-based cult. Btw, The "Darwinists" actually do call themselves as such: http://en.wikipedia.org/wiki/Neo-Darwinism They are proud of it!
Gee, it seems that when Creationist trolls lie, they lie outright. Can't you be a bit more clever and tell half-truths?
You might as well ask for the Moon, then.

Mike Elzinga · 17 January 2011

Stanton said: You might as well ask for the Moon, then.
I think we’re being mooned.

mrg · 17 January 2011

Rog said: So we have established you are a prostitute.
"Now, we're just discussing the price."

Atheistoclast · 17 January 2011

Dave Wisker said: Atheistoclast writes:
No, I do do original research - just not with this particular paper which was a meta-analysis.
Choosing a few papers and extrapolating from them is not meta-analysis. Considering that you missed one important study on the Drosophila genome that didn't support your thesis tells us your search criteria for studies that should have been included in the meta-analysis are laughable. And if you think you made any kind of legitimate statistical analysis of your data, you are sadly mistaken. You are nothing but a poseur.
The paper was on gene duplication and not "de novo" creation. I mentioned the latter in passing because I focused on an example of alleged "de novo" recruitment in a case of gene duplication. The subject probably requires another paperand getting access to ncDNA data is tricky. I dealt with all of the major cases of gene duplication. I am especially proud of my debunking of frameshifts. I put a lot of effort into the alignment in Figure 2.

Atheistoclast · 17 January 2011

mrg said:
Rog said: So we have established you are a prostitute.
"Now, we're just discussing the price."
Evolutionists are the biggest attention whores...just remember this time last year with all the hype and sensationalism surrounding the discovery of Australopithecus sediba. And what about "Ida" - it was even called the "Holy Grail"....and the "Lost Ark"!!! http://www.timesonline.co.uk/tol/comment/columnists/guest_contributors/article6360606.ece Come one, everyone, just admit that Darwinism is a cult.

OgreMkV · 17 January 2011

I'm sure, you're diligently working on the questions.

Thanks

Stanton · 17 January 2011

Atheistoclast said: Come one, everyone, just admit that Darwinism is a cult.
Maybe the reason why no one intends to admit that "Darwinism is a cult" is because it's not true, and that you're too bigoted to admit that you're using "Darwinism" simply to slur people as being members of an evil pagan cult of Devil-worshipers? You scream about how you want respect, and yet, why do you behave like a schoolyard bully? And it's hypocritical that you accuse "evolutionists" (sic) of being attention whores when you, yourself, are screaming about how a "regime change" is imminent, and that you have magically disproven evolution with your shoddily made programs.

Stanton · 17 January 2011

OgreMkV said: I'm sure, you're diligently working on the questions. Thanks
Sure, he is. Probably as much effort as the Nobel Prize Committee.

Dale Husband · 17 January 2011

Hey, can anyone show that is essay I wrote years ago cannot be consistent with what we know? http://circleh.wordpress.com/2007/09/16/the-possible-role-of-nondisjunction-in-evolution/

A common objection to natural selection as the mechanism for evolution is that while it may act as an editor, it cannot be an author. That is, it may change genetic information through mutation, but it cannot cause genetic information to increase. And they are right, but genetic information can still increase across the generations of organisms through a process called nondisjunction. This occurs when an unequal amount of genetic material is passed on to two daughter cells after the process of a cell dividing. One cell will have slightly less genetic material, and the other will have slightly more. The most famous example of nondisjunction is the kind that causes Down’s Syndrome, when a human embryo receives three 21st chromosomes from its parents rather than the normal number of two. But nondisjunction can occur regarding any chromosome in any organism and may not even involve chromosomes at all, such as in the case of bacteria. Let us imagine that three billion years ago, a bacterial cell was dividing, but because of a chemical malfunction, slightly less genetic material ended up in one daughter cell, and slightly more in the other. The cell with less material will probably end up smaller, while the cell with more material may end up larger, because a greater amount of genetic material can produce a greater amount of proteins, the molecules that provide the structural basis for all organisms. Larger cells (assuming the reproductive potential of the different cells was the same) would have an advantage over smaller cells in the race to gain food, thus natural selection would favor larger cells. If this process was repeated many times, then it is possible that over a billion years a bacterial cell would have emerged that had hundreds of times more genetic material than the first primitive organisms that arose on Earth about four billion years ago. And that would have enabled the evolution of more complex organisms than bacteria…including us!

I didn't use the term "gene duplication", but I think it does fit. And this is just plain stupid!
Atheistoclast said: It amuses me that people like yourself never actually these pro-Darwinist papers beyond the title and abstract. I actually read the paper on the sodium channel gene duplication and I can tell you that the authors were making an extraordinary extrapolation - just as Cheng and the Chinese team are exaggerating the "novelty" of the antifreeze gene. I wrote a letter to PNAS but it was rejected. I have written another one for the Cheng paper. As for CLLU1, what you are amazingly claiming is that a single nucleotide insertion created a brand new gene!! I am saying that the disabling mutation's presence in the African apes is the result of a parallel deactivation (as the authors considered but chose not to accept) or, to assume a common descent, that the disabler was already inherited in the hominid lineage. Come on, it is pretty obvious that an immune system gene can become disabled.
Yes, a brand new gene is formed every time a single nucleotide changes, you idiot! How is that even controversial??? And no one denies that genes become disabled. What about all that "junk DNA" that is thought to result from disabled genes from millions of years ago? You are a classic example of a clueless person who overestimates himself.

Dale Husband · 17 January 2011

Atheistoclast said: Evolutionists are the biggest attention whores...just remember this time last year with all the hype and sensationalism surrounding the discovery of Australopithecus sediba. And what about "Ida" - it was even called the "Holy Grail"....and the "Lost Ark"!!! http://www.timesonline.co.uk/tol/comment/columnists/guest_contributors/article6360606.ece Come one, everyone, just admit that Darwinism is a cult.
You are lying yet again. The media blew those up, not scientists. Remember, assertions made without evidence can be dismissed without evidence. And you are full of them!

Stanton · 17 January 2011

Dale Husband said:
Atheistoclast said: Evolutionists are the biggest attention whores...just remember this time last year with all the hype and sensationalism surrounding the discovery of Australopithecus sediba. And what about "Ida" - it was even called the "Holy Grail"....and the "Lost Ark"!!! http://www.timesonline.co.uk/tol/comment/columnists/guest_contributors/article6360606.ece Come one, everyone, just admit that Darwinism is a cult.
You are lying yet again. The media blew those up, not scientists. Remember, assertions made without evidence can be dismissed without evidence. And you are full of them!
Atheistoclast hypocritically accuses scientists of being attention whores, even though he's the one, here, making post after taunting post about how he knows better than everyone, about how everyone who disagrees with him is an evil, lying pagan cultist, about how "Darwinism" is really a "dying ideology," then a "religion," and how he's going to be so happy with the "regime change," whenever that is supposed to happen. All while modestly pointing out how, through his magical anti-evolution program, he's been able to magically disprove gene duplication... Because he says so.

Atheistoclast · 17 January 2011

Yes, a brand new gene is formed every time a single nucleotide changes, you idiot! How is that even controversial??? And no one denies that genes become disabled. What about all that "junk DNA" that is thought to result from disabled genes from millions of years ago?
LOL. Never heard of a synonymous change before? Even non-synonymous changes don't lead to "brand new genes". ATP6 has been mutating in different lineages for billions of years and it is still...ATP6. CLLU1 ,and also BSC4, are examples of either parallel deactivation or a reactivation. Psueodgenes are technically part of ncDNA. Either way, the probability of creating a new gene by exonizing a random piece of ncDNA is ridculously small. Remember that a generic protein ,consisting of 300 residues, is one out of 20^300 possible combinations.
You are a classic example of a clueless person who overestimates himself.
I'm part of the peer-reviewed authorship and you are not! Deal with it. My panda's thumb to you.

Just Bob · 17 January 2011

Wait...didn't "darwinism" fall and the "regime change" with the release of Expelled? Or was it when the ID experts took the stand in Dover?

Dang, you need a scorecard to keep up with all the deaths of the TOE!

Dave Wisker · 17 January 2011

Atheistoclast writes:
The paper was on gene duplication and not “de novo” creation. I mentioned the latter in passing because I focused on an example of alleged “de novo” recruitment in a case of gene duplication. The subject probably requires another paperand getting access to ncDNA data is tricky.
And the Drosophila paper was not just about de novo gene origination. For example, the authors write (my emphasis):
We find that, 1) tandem gene duplication has generated about 80% of the nascent duplicates that are limited to single species (D. melanogaster or D. yakuba); 2) the most abundant new genes shared by multiple species (44.1%) are dispersed duplicates, and are more likely to be retained and be functional
Funny how you missed and failed to include such an important finding in your "meta-analysis", let alone address it. And I still don't see ANY statistical analysis of any data in the paper that you are trying to foist on us as a meta-analysis, Mr "Computational Biologist". As impersonations go, that's an Epic Fail, poseur.
I am especially proud of my debunking of frameshifts. I put a lot of effort into the alignment in Figure 2.
Typical ID internet poseur-- consistently confusing effort with results.

OgreMkV · 17 January 2011

-clast, I'm hurt, you haven't responded to my questions that actually blow whatever it is you are claiming out of the water.

Nevermind, hard questions never get answered from intellectual cowards.

Gary Hurd · 17 January 2011

Atheistoclast said: It is time that Darwinism collapses just as Marxism did. The Berlin wall moment is nigh! The Soviet empire collapsed in 5 years...so shall Darwinism. It is time for regime change.
"The Imminent Demise of Evolution: The Longest Running Falsehood in Creationism"

DS · 17 January 2011

OgreMkV said: -clast, I'm hurt, you haven't responded to my questions that actually blow whatever it is you are claiming out of the water. Nevermind, hard questions never get answered from intellectual cowards.
Don't feel bad. He hasn't read any of the papers I recommended or answered any of my questions either. I think he can be safely ignored at this point. Let him rave about the imminent demise of evolution for a few more pages, everyone finds that crap very amusing. It's like publishing something in Popular Mechanics claiming that all astronomers are wrong about the earth going around the sun.

Stuart Weinstein · 17 January 2011

Mike Elzinga said:
RBH said: Let's bear in mind that "published in a peer-reviewed journal" is not synonymous" with "admitted to the canon." The vast majority of published papers in peer reviewed journals sink beneath the waves, never to be cited or heard about again. Passing peer review, however shakily, means only that a couple of reviewers and an editor thought it was worth putting out there to see if it might fly. My bet is that in this case, it won't.
One of my “famous” papers is three blank pages in the Journal of Vacuum Science and Technology. In March 1990 the military swooped in and stopped the presses just as the journal was going to print. It’s still classified.
In other words, Mike could tell us more, but then he'd have to kill us.

Dale Husband · 17 January 2011

Atheistoclast said:
Yes, a brand new gene is formed every time a single nucleotide changes, you idiot! How is that even controversial??? And no one denies that genes become disabled. What about all that "junk DNA" that is thought to result from disabled genes from millions of years ago?
LOL. Never heard of a synonymous change before? Even non-synonymous changes don't lead to "brand new genes". ATP6 has been mutating in different lineages for billions of years and it is still...ATP6.
That's really about as stupid as saying dogs have been evolving for millions of years but are still dogs....because you say so. There is great diversity in dogs, just as there is great diversity in ATP6.
CLLU1 ,and also BSC4, are examples of either parallel deactivation or a reactivation. Psueodgenes are technically part of ncDNA. Either way, the probability of creating a new gene by exonizing a random piece of ncDNA is ridculously small.
Exactly, but on the rare occations it DOES happen, natural selection will act on that rare change, preserve it if that change is beneficial, and result in new genes....and even new forms of life.
Remember that a generic protein ,consisting of 300 residues, is one out of 20^300 possible combinations.
Oh, yeah, the "it's so improbable it must not have happened". You really are an idiot!
You are a classic example of a clueless person who overestimates himself.
I'm part of the peer-reviewed authorship and you are not! Deal with it. My panda's thumb to you.
You've given us nothing credible to deal with, so your "peer-reviewed" status is meaningless. You are a fraud and I am not.

Malcolm · 18 January 2011

Atheistoclast said: Seriously, I would be an evolutionist if I was paid well enough. Give me $100,000 and I will write a paper praising the innovation resulting from gene duplication.
I think that this shows how little the current troll understands science. Given its handle, it seems ironic that it doesn't realise that the best way to make it big in science is to be an iconoclast. Unfortunately for the troll, it also helps if you have a clue.

Mike Elzinga · 18 January 2011

Stuart Weinstein said:
Mike Elzinga said:
RBH said: Let's bear in mind that "published in a peer-reviewed journal" is not synonymous" with "admitted to the canon." The vast majority of published papers in peer reviewed journals sink beneath the waves, never to be cited or heard about again. Passing peer review, however shakily, means only that a couple of reviewers and an editor thought it was worth putting out there to see if it might fly. My bet is that in this case, it won't.
One of my “famous” papers is three blank pages in the Journal of Vacuum Science and Technology. In March 1990 the military swooped in and stopped the presses just as the journal was going to print. It’s still classified.
In other words, Mike could tell us more, but then he'd have to kill us.
Probably not the best way to keep friends around. :-) It came out of nowhere and was extremely annoying when it happened. They weren’t even very nice about it. It took some digging to find out why; but then I had to reluctantly agree and withdrew an accepted paper from another journal and never submitted two others in preparation. I just had a jarring reminder of all this last week as a result of an article that appeared recently in Physics Today. The technology is still classified and access to its use is severely restricted; even after this many years.

Dave Wisker · 18 January 2011

For Atheistoclast's attention: a new protein-coding gene in the maize mitochondrial genome, cobbled together from different segments of the genome that did not code for proteins before: TURF-13. PT contributor Art Hunt posted about it here:

http://pandasthumb.org/archives/2007/05/on-the-evolutio-1.html

DS · 18 January 2011

Dave Wisker said: For Atheistoclast's attention: a new protein-coding gene in the maize mitochondrial genome, cobbled together from different segments of the genome that did not code for proteins before: TURF-13. PT contributor Art Hunt posted about it here: http://pandasthumb.org/archives/2007/05/on-the-evolutio-1.html
That doesn't count because ... well give me a minute here. I didn't actually bother to read the paper, but I know it can't be a good enough example, because then everything I want to believe would be wrong and people would be justified in ignoring me. So there has to be some reason why I refuse to accept it. Let's see, it really is a new gene with a completely new function. And it really didn't just poof out of nowhere, they really do know where it came form. And it does have information, which I guess has to be new information, so I can't use that old ploy again. Well, it's just a plant right? that doesn't count because very everyone knows that plants aren't intelligent, so where did the new information come from? Yea, I'm going with that. See cause selection couldn't produce new information and mutation couldn't produce it, at least by some definition that I won't define. Now all I have to do is convince some editor in Landscape Digest Monthly to publish this wild speculation and everyone will be fooled. I'm sure I'll get the Nobel Prize or something just as good. This science stuff isn't so hard after all.

OgreMkV · 18 January 2011

DS said:
Dave Wisker said: For Atheistoclast's attention: a new protein-coding gene in the maize mitochondrial genome, cobbled together from different segments of the genome that did not code for proteins before: TURF-13. PT contributor Art Hunt posted about it here: http://pandasthumb.org/archives/2007/05/on-the-evolutio-1.html
That doesn't count because ... well give me a minute here. I didn't actually bother to read the paper, but I know it can't be a good enough example, because then everything I want to believe would be wrong and people would be justified in ignoring me. So there has to be some reason why I refuse to accept it. Let's see, it really is a new gene with a completely new function. And it really didn't just poof out of nowhere, they really do know where it came form. And it does have information, which I guess has to be new information, so I can't use that old ploy again. Well, it's just a plant right? that doesn't count because very everyone knows that plants aren't intelligent, so where did the new information come from? Yea, I'm going with that. See cause selection couldn't produce new information and mutation couldn't produce it, at least by some definition that I won't define. Now all I have to do is convince some editor in Landscape Digest Monthly to publish this wild speculation and everyone will be fooled. I'm sure I'll get the Nobel Prize or something just as good. This science stuff isn't so hard after all.
No no, it was done in a lab and therefore only shows that intelligent is needed to do something with it. Or observe it or something.

DS · 18 January 2011

What I don't understand is, if this guy is so keen on being one of those rich and famous scientists, why doesn't he actually do some research and find the real mechanisms of evolution? If mutation, selection, gene duplication, drift, etc. aren't enough, then what is? How does it really work? Where is the evidence for it? Now that would be a way to get rich and famous, finding a new molecular mechanism for evolutionary change. After all, it worked for Sean Carrol.

Now why do you suppose anyone would just whine and cry about how nobody else is right? Why would anyone refuse to do any research to demonstrate an alternative? It couldn't be because "poof" is really the answer could it? Well, that sure would explain a lot.

OgreMkV · 18 January 2011

DS said: What I don't understand is, if this guy is so keen on being one of those rich and famous scientists, why doesn't he actually do some research and find the real mechanisms of evolution? If mutation, selection, gene duplication, drift, etc. aren't enough, then what is? How does it really work? Where is the evidence for it? Now that would be a way to get rich and famous, finding a new molecular mechanism for evolutionary change. After all, it worked for Sean Carrol. Now why do you suppose anyone would just whine and cry about how nobody else is right? Why would anyone refuse to do any research to demonstrate an alternative? It couldn't be because "poof" is really the answer could it? Well, that sure would explain a lot.
"Becoming a scientist to get rich and famous is like becoming a Bishop to get girls." I forget who said that...

Atheistoclast · 18 January 2011

Dave Wisker said: For Atheistoclast's attention: a new protein-coding gene in the maize mitochondrial genome, cobbled together from different segments of the genome that did not code for proteins before: TURF-13. PT contributor Art Hunt posted about it here: http://pandasthumb.org/archives/2007/05/on-the-evolutio-1.html
Sorry, but is this an actual paper on a maize gene or just a thought experiment? I could not find any link? Just to point out. I debunk the following "new genes" and "evolutionary innovation" in my paper: 1) I debunked the bullshit on Sdic. 2) I debunked the bullshit on "nylonase" and frameshifts in general. 3) I debunked the bullshit on Kua-UEV. 4) I debunked the bullshit on "jingwei" 5) I debunked the bullshit on RNASE1B 6) I debunked the bullshit on the trypsingogen-AFGP conversion. 7) I debunked the bullshit on CLLU1. Perhaps I needed to go further but the paper was getting too long in any case. If you want me to write another paper on some other examples of "new genes" or on this latest antifreeze, I will do so. As I say, I have already sent a letter to the editor of PNAS. Just give me your list and I will do the research.

TomS · 18 January 2011

OgreMkV said: No no, it was done in a lab and therefore only shows that intelligent is needed to do something with it. Or observe it or something.
Or else it was not done in a lab, so can be ignored. You will find that all of those so-called evidences for evolution are either done in a lab our done outside of a lab.

Dave Wisker · 18 January 2011

Atheistoclast said:
Dave Wisker said: For Atheistoclast's attention: a new protein-coding gene in the maize mitochondrial genome, cobbled together from different segments of the genome that did not code for proteins before: TURF-13. PT contributor Art Hunt posted about it here: http://pandasthumb.org/archives/2007/05/on-the-evolutio-1.html
Sorry, but is this an actual paper on a maize gene or just a thought experiment? I could not find any link? Just to point out. I debunk the following "new genes" and "evolutionary innovation" in my paper: 1) I debunked the bullshit on Sdic. 2) I debunked the bullshit on "nylonase" and frameshifts in general. 3) I debunked the bullshit on Kua-UEV. 4) I debunked the bullshit on "jingwei" 5) I debunked the bullshit on RNASE1B 6) I debunked the bullshit on the trypsingogen-AFGP conversion. 7) I debunked the bullshit on CLLU1. Perhaps I needed to go further but the paper was getting too long in any case. If you want me to write another paper on some other examples of "new genes" or on this latest antifreeze, I will do so. As I say, I have already sent a letter to the editor of PNAS. Just give me your list and I will do the research.
Typical phony poseur scholarship. Now you want me to do your research for you. Frak off. By the way, Art Hunt included all the necessary references in that post. Or do you need to be spoon-fed?

Stanton · 18 January 2011

Dave Wisker said: Typical phony poseur scholarship. Now you want me to do your research for you. Frak off. By the way, Art Hunt included all the necessary references in that post. Or do you need to be spoon-fed?
As per your typical phony poseur scholar, Atheistoclast wants you to spoonfeed him specifically so he can have the pleasure of spitting everything back into your face.

DS · 18 January 2011

Debunked = made up excuses

Keep going genius, only 100,000 more examples to "debunk". When you're finished with that there will be a million more. In the end, all you will just have to admit that the things you denied are happening all the time whether you like it or not. It is logically impossible to disprove a mechanism by disproving individual examples.

Here is another paper for you to "debunk" (along with all of the references included therein):

Long M, Betran B, Thornton K, Wang W. 2003. The origin of new genes: Glimpses from the young and old. Nature Rev Genet. 4: 865-875.

Now, exactly what is your point in all of this hand waving? Are you trying to show that we don't know everything about how evolution works, therefore there is an excuse to believe in god? How do you know we don't already believe in god? How do you know if we need any excuses? You do know that there is definitive v=evidence that evolution actually occurred don't you? You do now that no matter what the mechanism was, it has no bearing on whether you have to believe in a god or not, right? You do know that god of the gaps arguments never work, right?

Atheistoclast · 18 January 2011

DS said: Debunked = made up excuses Keep going genius, only 100,000 more examples to "debunk". When you're finished with that there will be a million more. In the end, all you will just have to admit that the things you denied are happening all the time whether you like it or not. It is logically impossible to disprove a mechanism by disproving individual examples. Here is another paper for you to "debunk" (along with all of the references included therein): Long M, Betran B, Thornton K, Wang W. 2003. The origin of new genes: Glimpses from the young and old. Nature Rev Genet. 4: 865-875. Now, exactly what is your point in all of this hand waving? Are you trying to show that we don't know everything about how evolution works, therefore there is an excuse to believe in god? How do you know we don't already believe in god? How do you know if we need any excuses? You do know that there is definitive v=evidence that evolution actually occurred don't you? You do now that no matter what the mechanism was, it has no bearing on whether you have to believe in a god or not, right? You do know that god of the gaps arguments never work, right?
There are 100,000 examples now? Where did you get that figure from, may I ask? Could it be somewhere dark and where the sun don't shine? The Long, Thornton and Betran paper was actually the review I used to select the "juiciest" examples of new gene evolution. From their list of about 30 or so "new genes" the following are included in my paper: 1) Sdic 2) FUT3/6 3) AFGP genes 4) Kua-UEV 5) TRE 6) RNASE1B 7) Jingwei 8) Adh-twain/ Adh-finnegan All comprehensively debunked and exposed. I am tempted to write a rejoinder to the latest paper by Long et al. - and explain what has really happened - but it is going to take time. Darwinism is running out of ideas.

Atheistoclast · 18 January 2011

Btw, up to 80% of the genes in your genome are recongnizably paralogs of more basic genes.

They have not functionally diverged in any major way since most are redundant. You can knock one out and another will take over. Many duplicates have degenerated and you can see this when you align their sequences.

Gene duplication increases the size and versatility of the genome - especially in plants - but does not add to its information content and certainly not to organismic complexity.

The sooner you lot realize this the sooner we can kill off this satanic paradigm.

Dave Lovell · 18 January 2011

Atheistoclast said: Gene duplication increases the size and versatility of the genome - especially in plants - but does not add to its information content and certainly not to organismic complexity.
So organisms with a more versatile genome have no more of your "information" than those with a less versatile genome. If the more versatile organisms have higher reproductive success, is this not evolution without an increase in what you deem "information"?

eric · 18 January 2011

Atheistoclast said: The sooner you lot realize this the sooner we can kill off this satanic paradigm.
And there you have the real motivation, in a single, simple sentence. For these guys, its not about finding a better explanation for how species arise; its about removing a good explanation that is religiously threatening.

OgreMkV · 18 January 2011

Atheistoclast said: Btw, up to 80% of the genes in your genome are recongnizably paralogs of more basic genes. They have not functionally diverged in any major way since most are redundant. You can knock one out and another will take over. Many duplicates have degenerated and you can see this when you align their sequences.
Interesting, so which organism out of the following pairs are degenerate: Cow and human (share 80% similar DNA) http://www.sciencemag.org/content/324/5926/522.full Cat and human (90% homologous genes) cat and dog (82% homologous genes) cat and rat (69% homologous genes) http://genome.cshlp.org/content/17/11/1675.full hmmm?
Gene duplication increases the size and versatility of the genome - especially in plants - but does not add to its information content and certainly not to organismic complexity. The sooner you lot realize this the sooner we can kill off this satanic paradigm.
How do you measure complexity (values, units, and process for determination)? How do you measure information (values, units, and process for determination)? What's the difference in complexity between a designed thing and a non-designed thing of equal mass and makeup? What values of complexity indicate design? Why? What values of complexity indicate evolution? Why? And you do realize that by ignoring these questions again, you are admitted that all the things you've been peddling are BS.

Mike Elzinga · 18 January 2011

eric said:
Atheistoclast said: The sooner you lot realize this the sooner we can kill off this satanic paradigm.
And there you have the real motivation, in a single, simple sentence. For these guys, its not about finding a better explanation for how species arise; its about removing a good explanation that is religiously threatening.
And I’m sitting back here shaking my head and snorting in my tea. This athiestoclast character is a complete fake; he has no clue. Either he is just mooning everybody here and getting a big kick out of it, or he is so damned deluded that he stands naked before the entire world imagining himself dressed in the robes of a king. He couldn’t pass a middle school (key stage 2) science course.

mrg · 18 January 2011

Mike Elzinga said: Either he is just mooning everybody here and getting a big kick out of it, or he is so damned deluded that he stands naked before the entire world imagining himself dressed in the robes of a king.
I'm not so sure that the two notions are mutually exclusive when it comes to nutjobs. Certainly, on the receiver end the distinction is immaterial.

Malchus · 18 January 2011

Since you claimed that functionality WAS a measure of information, you've managed to flatly contradict yourself in the same thread. Also, it's clear that your claim to be a "computational biologist" is probably false. What lab or institution are you working for?
Atheistoclast said: Btw, up to 80% of the genes in your genome are recongnizably paralogs of more basic genes. They have not functionally diverged in any major way since most are redundant. You can knock one out and another will take over. Many duplicates have degenerated and you can see this when you align their sequences. Gene duplication increases the size and versatility of the genome - especially in plants - but does not add to its information content and certainly not to organismic complexity. The sooner you lot realize this the sooner we can kill off this satanic paradigm.

Stanton · 18 January 2011

Atheistoclast the attention whoresaid: The sooner you lot realize this the sooner we can kill off this satanic paradigm.
You want us to respect you, yet, you hypocritically accuse us of being Satanists? No wonder all the reputable journals have standing orders to reject your papers: they're idiotic bullshit written by a pompous attention whore with abominable social skills.

Malchus · 18 January 2011

Interestingly, I note that your claim to have "debunked" any of these is categorically false. Each "debunking" seems to consist of your claim that you simply don't believe it. But you provide no actual support for your opinion. Your understanding of genetics is, it appears, sadly superficial.
Atheistoclast said:
DS said: Debunked = made up excuses Keep going genius, only 100,000 more examples to "debunk". When you're finished with that there will be a million more. In the end, all you will just have to admit that the things you denied are happening all the time whether you like it or not. It is logically impossible to disprove a mechanism by disproving individual examples. Here is another paper for you to "debunk" (along with all of the references included therein): Long M, Betran B, Thornton K, Wang W. 2003. The origin of new genes: Glimpses from the young and old. Nature Rev Genet. 4: 865-875. Now, exactly what is your point in all of this hand waving? Are you trying to show that we don't know everything about how evolution works, therefore there is an excuse to believe in god? How do you know we don't already believe in god? How do you know if we need any excuses? You do know that there is definitive v=evidence that evolution actually occurred don't you? You do now that no matter what the mechanism was, it has no bearing on whether you have to believe in a god or not, right? You do know that god of the gaps arguments never work, right?
There are 100,000 examples now? Where did you get that figure from, may I ask? Could it be somewhere dark and where the sun don't shine? The Long, Thornton and Betran paper was actually the review I used to select the "juiciest" examples of new gene evolution. From their list of about 30 or so "new genes" the following are included in my paper: 1) Sdic 2) FUT3/6 3) AFGP genes 4) Kua-UEV 5) TRE 6) RNASE1B 7) Jingwei 8) Adh-twain/ Adh-finnegan All comprehensively debunked and exposed. I am tempted to write a rejoinder to the latest paper by Long et al. - and explain what has really happened - but it is going to take time. Darwinism is running out of ideas.

Malchus · 18 January 2011

I also note, in passing, that Bozorgmehr or Atheioclast, is not a computational biologist; is not affiliated with any labs or educational institutions; and is merely a failed businessman. This does not necessarily make him wrong; but it does seriously undermine his credibility when he lies about his profession.

Atheistoclast · 18 January 2011

Malchus said: Interestingly, I note that your claim to have "debunked" any of these is categorically false. Each "debunking" seems to consist of your claim that you simply don't believe it. But you provide no actual support for your opinion. Your understanding of genetics is, it appears, sadly superficial.
Atheistoclast said:
DS said: Debunked = made up excuses Keep going genius, only 100,000 more examples to "debunk". When you're finished with that there will be a million more. In the end, all you will just have to admit that the things you denied are happening all the time whether you like it or not. It is logically impossible to disprove a mechanism by disproving individual examples. Here is another paper for you to "debunk" (along with all of the references included therein): Long M, Betran B, Thornton K, Wang W. 2003. The origin of new genes: Glimpses from the young and old. Nature Rev Genet. 4: 865-875. Now, exactly what is your point in all of this hand waving? Are you trying to show that we don't know everything about how evolution works, therefore there is an excuse to believe in god? How do you know we don't already believe in god? How do you know if we need any excuses? You do know that there is definitive v=evidence that evolution actually occurred don't you? You do now that no matter what the mechanism was, it has no bearing on whether you have to believe in a god or not, right? You do know that god of the gaps arguments never work, right?
There are 100,000 examples now? Where did you get that figure from, may I ask? Could it be somewhere dark and where the sun don't shine? The Long, Thornton and Betran paper was actually the review I used to select the "juiciest" examples of new gene evolution. From their list of about 30 or so "new genes" the following are included in my paper: 1) Sdic 2) FUT3/6 3) AFGP genes 4) Kua-UEV 5) TRE 6) RNASE1B 7) Jingwei 8) Adh-twain/ Adh-finnegan All comprehensively debunked and exposed. I am tempted to write a rejoinder to the latest paper by Long et al. - and explain what has really happened - but it is going to take time. Darwinism is running out of ideas.
Malchus said: I also note, in passing, that Bozorgmehr or Atheioclast, is not a computational biologist; is not affiliated with any labs or educational institutions; and is merely a failed businessman. This does not necessarily make him wrong; but it does seriously undermine his credibility when he lies about his profession.
I never claimed I was affiliated with any institution. But computational biologist I am. I am an independent scientist. Anyway, my next papers are soon to be published causing more anguish and disappointment for the Panda folks here.

Malchus · 18 January 2011

Actually, you are a confirmed internet troll; your postings on Pharyngula established that you are unable to deal with discussion or argument, and that your understanding of genetics is highly limited.

You are not an independent scientist; you are a failed businessman with too much time on his hands. What science are you doing? What lab do you use in your work? What actual original research have you done?

You are the kind of person who gives Christians a bad name by continuing to bear false witness.

You are also remarkably poor at actual discussion; I am disappointed.

DS · 18 January 2011

Atheistoclast said: There are 100,000 examples now? Where did you get that figure from, may I ask? Could it be somewhere dark and where the sun don't shine? The Long, Thornton and Betran paper was actually the review I used to select the "juiciest" examples of new gene evolution. From their list of about 30 or so "new genes" the following are included in my paper: 1) Sdic 2) FUT3/6 3) AFGP genes 4) Kua-UEV 5) TRE 6) RNASE1B 7) Jingwei 8) Adh-twain/ Adh-finnegan All comprehensively debunked and exposed. I am tempted to write a rejoinder to the latest paper by Long et al. - and explain what has really happened - but it is going to take time. Darwinism is running out of ideas.
Great. Eight out of thirty. Now all you have to do is "debunk" the other twenty two. You do realize that if there is even one example that could possibly satisfy your arbitrary and shifting criteria that you still lose right? You do realize that absolutely no one has to accept your conclusions right? You do realize that even if you found one thousand examples of things that could not fly that still would not prove that nothing could ever fly, right? Now I'm really curious about something. Exactly how is it that you somehow seem to equate a well documented biological mechanism with satanist? Do you label everything that disagrees with your preconceived religious notions this way? You are the only one proposing supernatural causes as far as I can tell. Are you really a satan worshiper? Is that who the intelligent designer is?

Malchus · 18 January 2011

As additional evidence for your dishonesty, I note the pesudonym you used to author this paper: http://www.wepapers.com/Papers/52959/Report_on_the_Iranian_presidential_election_2009.

I also note that your business was shut down because you broke the law.

You have not established the credibility required for us to even take your opinions seriously.

Mike Elzinga · 18 January 2011

Malchus said: I also note, in passing, that Bozorgmehr or Atheioclast, is not a computational biologist; is not affiliated with any labs or educational institutions; and is merely a failed businessman. This does not necessarily make him wrong; but it does seriously undermine his credibility when he lies about his profession.
It isn’t being a failed businessman that makes him wrong; it’s being wrong that makes him wrong. But he takes it a step further in brashly passing himself off as someone who knows even as he fails to educate himself. Either he is a science-jilted jokester or someone who is completely deluded; or both.

Malchus · 18 January 2011

He posts under various aliases on the net; he has at least twenty-seven for Richard Dawkin's site because he keeps being banned for trolling.

He appears fundamentally dishonest and remarkable egocentric.

harold · 18 January 2011

Atheistoclast has apparently spent hundreds of obsessive hours trying to deny that straightforward examples of gene duplication and subsequent diversity of function are what they are. He wrote -
Btw, up to 80% of the genes in your genome are recongnizably paralogs of more basic genes.
Although this statement is littered with ill-defined terms and uses numbers without explaining where they came from, there is some truth to this. Yes, modern genes are evolved from earlier genes. This is precisely what the theory of evolution predicts, and what well documented examples of gene duplication (not the only mechanism of evolution) illustrate. His statement is an argument against his own creationism.
They have not functionally diverged in any major way since most are redundant.
1) Non-sequitur. 2) By no means universally true. If this were universally true, there would be no single gene defects.
You can knock one out and another will take over.
See above.
Many duplicates have degenerated and you can see this when you align their sequences.
The insistence on non-standard, poorly defined, anachronistic, and loaded language shows poor judgment, as it greatly impedes discussion. It is hard not wonder if this is a defense mechanism. Nevertheless, the statement again contains some element of truth. Many examples of duplicate genes that no longer have function exist. They are often called "pseudogenes". Their existence is evidence in favor of the theory of evolution, and evidence against creationism. Once again, where the author refers, however inarticulately, to fact, he brings up facts that undermine his own argument.
Gene duplication increases the size and versatility of the genome - especially in plants - but does not add to its information content and certainly not to organismic complexity.
1. This is an absurd non-sequitur. Although the theory of evolution need not be explained in terms of "information", by any accepted definition of information, gene duplication is an increase in information. http://en.wikipedia.org/wiki/Information_theory
The sooner you lot realize this the sooner we can kill off this satanic paradigm.
Clearly, atheistoclast understands neither the theory of evolution nor basic information theory.

Scott F · 18 January 2011

OgreMkV said: "Becoming a scientist to get rich and famous is like becoming a Bishop to get girls."
Odd. I thought one became a Bishop to get boys. :-)

harold · 18 January 2011

It isn’t being a failed businessman that makes him wrong; it’s being wrong that makes him wrong.
Thank you, Mike. It is true that when creationists lie, directly or through implication or exaggeration, about their credentials or their professional standing, that speaks volumes about their credibility. And such lies and exaggerations are common. Likewise, although being a well-regarded scientist at a mainstream research institution does add credibility, within the specific field of expertise, there are tragic examples of once-prestigious people veering off. However, in an informal venue like this, professional standing is relevant mainly when it is claimed. Bluntly most professional biomedical researchers have no time to dispute denialists of the basics, nor much desire to do so. I am not an active research scientist, either. I am a pathologist and was a clinical professor of pathology when I first became aware of political creationism. I stopped being an academic quite a few years ago. I could currently be described as a striving entrepreneurial businessman, although my main venture is, admittedly, related to a cutting edge aspect of pathology. Many of the most articulate people here are from the physical sciences, education, or other fields.

eric · 18 January 2011

Atheistoclast said: I never claimed I was affiliated with any institution. But computational biologist I am. I am an independent scientist.
Most people associate more with a professional title than just a limited attempt to do it. Posting here does not make me a journalist; writing applets for my personal use does not make me a programmer. Analyzing someone else's data does not necessarily make you a computational biologist. But, ultimately, this will be decided based on how your peers asses the quality of your work.
Anyway, my next papers are soon to be published causing more anguish and disappointment for the Panda folks here.
I would love for you to publish an explanation as to why, when discussing the Sdic gene, you referenced someones observation of reduced heterozygosity but not that same studie's observation of reduced codon usage bias. Other than the fact that the former supports the claim you are trying to make and the latter refutes it. Because that reason would mean you are doing data mining of the most unethical sort. I'd also love to hear why, after you've told us in multiple posts how neither deletions nor duplications increase information content, why information content matters at all for evolution. Why create a new definition of information when the genetic code can undergo radical changes without any change in information? *** As an aside, this guy's posts have provoked some great science-containing responses. Thanks for that to all, but especially Dave Whisker.

harold · 18 January 2011

eric said -
I’d also love to hear why, after you’ve told us in multiple posts how neither deletions nor duplications increase information content, why information content matters at all for evolution.
OgreMkV said -
How do you measure complexity (values, units, and process for determination)? How do you measure information (values, units, and process for determination)? What’s the difference in complexity between a designed thing and a non-designed thing of equal mass and makeup? What values of complexity indicate design? Why? What values of complexity indicate evolution? Why? And you do realize that by ignoring these questions again, you are admitted that all the things you’ve been peddling are BS.
I didn't see any answers to Ogre's excellent questions. Please, atheistoclast, don't respond to me without answering those questions. If fact, gene duplication or any other creation of a transcribed copy with more nucleotides than the original copy is an increase in information, period. There are plenty of examples of evolution in which loss of traits and more "simple" phenotype or smaller genotype is favored in a lineage as well. This whole mess of "information" babble is just a bluff. Atheistoclast doesn't understand the theory of evolution, or information theory.

Scott F · 18 January 2011

eric said: As an aside, this guy's posts have provoked some great science-containing responses. Thanks for that to all, but especially Dave Whisker.
Here, here. Though one sometimes has to wade through tedious arguments about who's got the better credentials, or who's journal is "better" (or who's high school is better :-), the science-containing responses are always interesting. Thanks. BTW, to those trolls out there... From a layman's point of view, if you have to start getting into a pissing contest about credentials, you've already lost. If you can't win on the merits and content of your ideas, you don't have a leg to stand on. The people who know what they are talking about are able to articulate those ideas to an educated layman like me. If I, as a layman, can tell after just a couple of posts that you're blowing smoke, you've already lost. Give it up. Having never published a thing (and my apologies to those who struggle to make a living at it), which publication you get your article in appears to be merely counting coup among real scientists. From what I can tell, the oft repeated taunt that IDiots and Creationists haven't published in peer reviewed journals is just red meat for the trolls to feed on. In the end it doesn't matter what journal you get published in. What matters are your ideas. If your ideas don't fly, even getting published in "Science" (once) won't do you a bit of good.

Rolf Aalberg · 18 January 2011

On the fly at this late hour over here, I feel just like pointing out that maybe your position

The sooner you lot realize this the sooner we can kill off this satanic paradigm.

maybe is not quite the best foundation for objective opinion on scientific matters.. Besides, it implies that millions of scientists are imbeciles. If what you have is so hot, hotter even than both Behe and Dembski combined (null + zero), what's preventing you from doing your own research and in due time pick up that Nobel prize you deserve?

Flint · 18 January 2011

From what I can tell, the oft repeated taunt that IDiots and Creationists haven’t published in peer reviewed journals is just red meat for the trolls to feed on. In the end it doesn’t matter what journal you get published in. What matters are your ideas.

It's been my impression that peer review exists for some good reason, and that even those scientists whose efforts don't get past peer review seem to agree it's a Good Thing. Something about improving the chances that your ideas ARE good ones, that your conclusions are supported by your data, that your data were obtained appropriately, stuff like that. While bad ideas deserve to be forgotten, good ideas are more likely to be noticed if they are not buried in mountains of chaff.

James F · 18 January 2011

Scott F said: Having never published a thing (and my apologies to those who struggle to make a living at it), which publication you get your article in appears to be merely counting coup among real scientists. From what I can tell, the oft repeated taunt that IDiots and Creationists haven't published in peer reviewed journals is just red meat for the trolls to feed on. In the end it doesn't matter what journal you get published in. What matters are your ideas. If your ideas don't fly, even getting published in "Science" (once) won't do you a bit of good.
It has to be phrased very carefully: cdesign proponentsists haven't presented evidence to support intelligent design or refute evolution in peer-reviewed scientific research papers. They've sneaked a few papers in, reviews in very low-impact journals being their favorite tactic, publishing uncontroversial papers with references to ID stripped out being a close second.

Dale Husband · 18 January 2011

Atheistoclast said: Just to point out. I debunk the following "new genes" and "evolutionary innovation" in my paper: 1) I debunked the bullshit on Sdic. 2) I debunked the bullshit on "nylonase" and frameshifts in general. 3) I debunked the bullshit on Kua-UEV. 4) I debunked the bullshit on "jingwei" 5) I debunked the bullshit on RNASE1B 6) I debunked the bullshit on the trypsingogen-AFGP conversion. 7) I debunked the bullshit on CLLU1. Perhaps I needed to go further but the paper was getting too long in any case. If you want me to write another paper on some other examples of "new genes" or on this latest antifreeze, I will do so. As I say, I have already sent a letter to the editor of PNAS. Just give me your list and I will do the research.
Yet the loon won't show his work where he did all that debunking. I cry fraud! Creationists have been claiming to debunk evolution for at least a century, and they always fail.

Mike Elzinga · 18 January 2011

Flint said: While bad ideas deserve to be forgotten, good ideas are more likely to be noticed if they are not buried in mountains of chaff.
I may have told this story before on PT. A number of years ago, at a meeting of the American Physical Society, I heard a talk given by Victor Weisskopf on the history of the Physical Review. He highlighted the exponential increase in the number of papers published in that journal, along with the unfortunate decrease in importance of many of the papers that were being published. Weisskopf then imagined the journals lined up on a long shelf, and he calculated the velocity of the right-hand end of the stack as a function of time. He then calculated the date in the future when that end of the stack would be traveling faster than the speed of light. Then he said, “But that’s ok, because there wouldn’t be any information in it anyway.”

DS · 18 January 2011

Dale Husband said: Yet the loon won't show his work where he did all that debunking. I cry fraud! Creationists have been claiming to debunk evolution for at least a century, and they always fail.
It's worse than that. No matter how many examples he claims are now good enough for him, his basic premise is that you can't create information without intelligence. He has not demonstrated any theoretical reason for supposing that this is the case, let alone any evidence that this is the case. On the other hand, he has admitted that lots of important things happen because of mutation and gene duplication, but I guess this doesn't count as highly specified and complexified information (whatever that might be).

Mike Elzinga · 18 January 2011

DS said: It's worse than that. No matter how many examples he claims are now good enough for him, his basic premise is that you can't create information without intelligence. He has not demonstrated any theoretical reason for supposing that this is the case, let alone any evidence that this is the case. On the other hand, he has admitted that lots of important things happen because of mutation and gene duplication, but I guess this doesn't count as highly specified and complexified information (whatever that might be).
In over 40 years, I don’t think I have ever seen an ID/creationist grasp the significance of the existence of solids, liquids, and chemical compounds; and how these differ from their underlying constituents. It’s like setting off a firecracker behind someone who doesn’t flinch; and you realize the person is stone deaf.

mrg · 18 January 2011

Mike Elzinga said: It’s like setting off a firecracker behind someone who doesn’t flinch; and you realize the person is stone deaf.
Well, just use a bigger firecracker. A LOT bigger firecracker.

Mike Elzinga · 18 January 2011

This “Code of Life” series is the latest example of a creationist chattering without understanding the significance of the examples she is using.

mrg · 18 January 2011

Mike Elzinga said: This “Code of Life” series is the latest example of a creationist chattering without understanding the significance of the examples she is using.
I like to time myself when listening to nutjob videos. I got about 15 seconds into this one. At moments she reminded me of Byers. Hand me one of the BIG firecrackers, will ya?

Mike Elzinga · 18 January 2011

mrg said:
Mike Elzinga said: This “Code of Life” series is the latest example of a creationist chattering without understanding the significance of the examples she is using.
I like to time myself when listening to nutjob videos. I got about 15 seconds into this one. At moments she reminded me of Byers. Hand me one of the BIG firecrackers, will ya?
:-)

Dave Wisker · 18 January 2011

Mike Elzinga said: This “Code of Life” series is the latest example of a creationist chattering without understanding the significance of the examples she is using.
I love how she makes the assumptions about increasing complexity = increased information = larger genomes, then when there are exceptions to it, it's all of a sudden a problem for the evolutionists.

Mike Elzinga · 18 January 2011

Dave Wisker said:
Mike Elzinga said: This “Code of Life” series is the latest example of a creationist chattering without understanding the significance of the examples she is using.
I love how she makes the assumptions about increasing complexity = increased information = larger genomes, then when there are exceptions to it, it's all of a sudden a problem for the evolutionists.
It is such a characteristic of creationists to just make up crap as they go. There are no exceptions. They do this right out in public where everyone can watch, and they don’t seem to care that experts can observe them making complete fools of themselves. It speaks volumes about the coercive subculture in which they live. It’s even scarier that they have such gullible audiences.

Dave Wisker · 18 January 2011

Mike Elzinga said:
Dave Wisker said:
Mike Elzinga said: This “Code of Life” series is the latest example of a creationist chattering without understanding the significance of the examples she is using.
I love how she makes the assumptions about increasing complexity = increased information = larger genomes, then when there are exceptions to it, it's all of a sudden a problem for the evolutionists.
It is such a characteristic of creationists to just make up crap as they go. There are no exceptions. They do this right out in public where everyone can watch, and they don’t seem to care that experts can observe them making complete fools of themselves. It speaks volumes about the coercive subculture in which they live. It’s even scarier that they have such gullible audiences.
What's truly infuriating is how they will tailor their responses to different audiences. Jonathan Wells, for example, will not say "Peppered moths do not rest on tree trunks" to a knowledgeable audience because they know this is false, but I have personally heard him say exactly that at an ID conference.

Mike Elzinga · 18 January 2011

Dave Wisker said: What's truly infuriating is how they will tailor their responses to different audiences. Jonathan Wells, for example, will not say "Peppered moths do not rest on tree trunks" to a knowledgeable audience because they know this is false, but I have personally heard him say exactly that at an ID conference.
I recognized a long time ago back in the 1970s that much of the outrageousness of creationists was taunting. Almost everyone felt the tug of wanting to set these people in their place, but realized that it was the coattails of scientists that these characters were seeking. It was hard to resist; but many of us did. And I think that this behavior has come to permeate the ID/creationist subculture partly because they continually hope to hitch a ride on some high-profile scientist’s reputation. They occasionally get a response on their website which they then turn into a big deal. They’ll even settle for public mocking if it gets them publicity because that becomes a springboard for debate; which they use to “prove” that there really is a controversy. But I still wonder about the internal pain of living a continual lie in public. Their projections of evilness onto others says more about them than it does others.

Scott F · 19 January 2011

Flint said:

From what I can tell, the oft repeated taunt that IDiots and Creationists haven’t published in peer reviewed journals is just red meat for the trolls to feed on. In the end it doesn’t matter what journal you get published in. What matters are your ideas.

It's been my impression that peer review exists for some good reason, and that even those scientists whose efforts don't get past peer review seem to agree it's a Good Thing. Something about improving the chances that your ideas ARE good ones, that your conclusions are supported by your data, that your data were obtained appropriately, stuff like that. While bad ideas deserve to be forgotten, good ideas are more likely to be noticed if they are not buried in mountains of chaff.
Granted. I'm sure that's true, and very important in the community of publishing scientists. But from a layman's perspective, while I'm aware that there is a difference, I really couldn't tell the difference between a high impact journal and a low one. (In fact, I just learned here that there is such a measure.) I just don't have the experience. What I care about is whether you can defend your ideas in rational, measured tones, without dropping to the level of school yard taunting like, "My CV is bigger than your CV." In my layman's experience, it becomes clear very quickly whether someone knows their stuff or not, especially in reading the give and take on blogs like this. All you published scientists here can tell right off the bat, I'm sure. I certainly can't follow all the details when you dive into the jargon, but really, it's just as obvious to those of us who aren't experts when someone is BS'ing. Now that I think about it, that's probably the same for judges like Jones. All you really have to do is listen carefully to the other side trying to defend their ideas to realize they are hollow.

Elizabeth Liddle · 19 January 2011

Impact factor isn't that good an indicator of quality IMO. In fact some of the top journals have some of the worst papers, I suspect because big names tend to be treated with too much respect, and because really cool findings are sought after by the biggest journals, and really cool findings that are also true are rarer than really cool findings that turn out to be flakey.

The most reliable findings are the replicated ones, and replications tend not to find their way into the coolest journals.

The only real way to tell a good paper from a bad one is to read it really thoroughly.

Not even peer-reviewers always do that.

Dave Wisker · 19 January 2011

I agree about the impact factor. I was looking at the impact factors of journals. The biggies like Nature, Science, and PNAS have huge numbers compared to the Royal Society Transactions. I haven't seen anybody looking down their noses at the Royal Society lately.

SWT · 19 January 2011

As I mentioned a few pages ago, making judgments about impact factor is to some extent discipline-dependent. In chemical engineering (my discipline), it's generally considered a good thing to be published in AIChE Journal and Chem. Eng. Science, both of which have impact factors around 2. My students are frequently pushing to submit manuscripts to "better" (higher impact factor) journals, when they're actually likely to get better citation results by getting their material in front of the eyes of the people who care most about their field of research. I also remind my students that the very best way to get good citation results is to do outstanding work and present it with great precision and clarity.

IBelieveInGod · 19 January 2011

DS said:
Atheistoclast said:
Why should the opinion of one person, who wrote one review paper somewhere, be considered as important as the thousands of papers where the authors reached exactly the opposite conclusion?
You are making a flawed argument from authority. Science isn't based on votes. I could be right and the entire scientific community could be wrong. If you can't be bothered to read the paper, let alone consider its conclusions, then you are not interested in gaining any knowledge. Darwin himself had to oppose conventional thinking in his day when he published his magnum opus.
No I'm not. I am simply saying that the people who actually did the research and submitted the papers for peer review in real journals have all reached a different conclusion than you have. You must prove them all wrong to be taken seriously. So far, you haven't even done any real research so you haven't earned the right to review anything. You have no new evidence, you just have your own conclusion. Science is based on evidence not authority. You have neither.
PROVE them wrong? It's funny how it's always a requirement for Creationists/IDers to prove something, but it is never a requirement for you to prove evolution, abiogenesis, etc..., science is not about proving anything, science only attempts to find a better explanation for observations. It's funny how there is such a double standard! You don't have to prove anything, yet Creationist/IDers must prove everything! Clearly this demonstrates the weakness of science when it comes to attempting to explain the origin of life, the universe, the physical laws, etc...

DS · 19 January 2011

If IBIG wants a response to his moronic bullshit, he can take it to the bathroom wall.

Stanton · 19 January 2011

It's always so amusing, in a sad, pathetic, struggling-fly-with-its-wings-pulled-off sort of way, to watch IBelieve demonstrate himself to be a colossal idiot with each and every post he makes.

Here he whines about having a double standard, and yet, he wants us to believe that Science is really an evil rival religion run by devil-worshipers, and he also wants us to abandon Science in favor of worshiping him as the Godhead.

Simply because he has "FAITH" (sic).

And he's also stupid enough to think that we've forgotten of all of the stupid gotcha games he's tried to pull on us where he makes inane rhetorical questions in order to lie about how we couldn't respond to him.

DS · 19 January 2011

AS for gene duplication, it is indeed a well documented mechanism of evolution. I really can't tell exactly what the problem is for the atheist guy, but he seem to desperately need to find some excuse why no example is good enough for him. Seems like the only requirements would b:

1) A gene duplication

2) A new gene derived from the duplicate copy

3) A new function (maybe a new name or new information or innovation or something)

Of course, somehow none of the well documented examples are good enough to fulfill this nebulous yet rigorous criteria. They are all important to evolution, but somehow not important enough. Well what about these examples:

1) Hemoglobin genes (Well they all have a somewhat related function so I guess they really shouldn't count for something or other, maybe they are just not innovative enough. Yea that's it. I won't define the term, or say how much would be enough, but I'm sure they don't count)

2) Ribosomal genes (Well they all have something to do with a ribosome, so I guess they must not really be innovative enough either. It really doesn't matter how different thy are or who different their functions really are, no one will notice if I just ignore all the messy little details.)

3) Hox genes (They all have something to do with development so they don't count because ... give me a minute ... well I really can't think of a reason why they can't count ,,, I'm sure I'll find some reason to ignore them anyway.)

Now where can I publish my magnum opus? I know, Mad magazine. If only the editor didn't hate me so much.

Stanton · 19 January 2011

DS said: AS for gene duplication, it is indeed a well documented mechanism of evolution. I really can't tell exactly what the problem is for the atheist guy, but he seem to desperately need to find some excuse why no example is good enough for him. ... (They all have something to do with development so they don't count because ... give me a minute ... well I really can't think of a reason why they can't count ,,, I'm sure I'll find some reason to ignore them anyway.)
The reasons I can see are that Atheistoclast simply uses his inane programs to camouflage typical debunked Creationist appeals to incredulity in pseudoscientific jargon in the futile hope that no one will see through them, and that Atheistoclast is, hypocritically, an attention whore desperate for any sort of attention, and desperate to mock anyone and everyone who does not bow down to worship him as the Jesus of Science.
Now where can I publish my magnum opus? I know, Mad magazine. If only the editor didn't hate me so much.
Please, even Mad Magazine has its standards for publication.

Dale Husband · 19 January 2011

IBelieveInGod said: PROVE them wrong? It's funny how it's always a requirement for Creationists/IDers to prove something, but it is never a requirement for you to prove evolution, abiogenesis, etc..., science is not about proving anything, science only attempts to find a better explanation for observations. It's funny how there is such a double standard! You don't have to prove anything, yet Creationist/IDers must prove everything! Clearly this demonstrates the weakness of science when it comes to attempting to explain the origin of life, the universe, the physical laws, etc...
You IGNORE all the evidence for evolution, and say there is "evidence" for Creationism and then give us none! So who has the double standard? YOU!

IBelieveInGod · 19 January 2011

Dale Husband said:
IBelieveInGod said: PROVE them wrong? It's funny how it's always a requirement for Creationists/IDers to prove something, but it is never a requirement for you to prove evolution, abiogenesis, etc..., science is not about proving anything, science only attempts to find a better explanation for observations. It's funny how there is such a double standard! You don't have to prove anything, yet Creationist/IDers must prove everything! Clearly this demonstrates the weakness of science when it comes to attempting to explain the origin of life, the universe, the physical laws, etc...
You IGNORE all the evidence for evolution, and say there is "evidence" for Creationism and then give us none! So who has the double standard? YOU!
It's all in the interpretation of the evidence as you should very well know. You interpret the evidence based on your presupposition that evolution by common descent is true, a Creationist/IDer interprets the same evidence very differently. You think that the evidence supports your opinion and the Creationist/Ider think the evidence supports their opinion. So, all we have are different OPINIONS of the same evidence. I prefer opinions rather then explanation, because that really all they are.

DS · 19 January 2011

Richard,

The IBIG fool has been banned. Please dump all his posts to the bathroom wall. There is still a special thread just for him at After the Bar Closes, that's where he belongs.

Everyone else,

Please don't respond to this raving lunatic on this thread. All he wants to do is derail the thread with his incessant whining about abiogenesis and other meaningless bullshit. I guess he just couldn't stand to see the atheist guy getting his ass handed to him.

OgreMkV · 19 January 2011

IBIG, you have thread at ATBC where you may spew. Until you have sufficient knowledge of the topic, I would encourage you to go there to babble.

We've all heard it. No one cares. No one here has to prove anything to you. No one here has to even address your concerns.

I have personally offered to teach you everything you would need to know about Biology, Chemistry, and how science works. I estimated that it would take about 9 months and some serious effort on your part. You have refused this at every opportunity.

Get thee to ATBC, IBIGgy.

eric · 19 January 2011

Scott F said: But from a layman's perspective, while I'm aware that there is a difference, I really couldn't tell the difference between a high impact journal and a low one. (In fact, I just learned here that there is such a measure.) I just don't have the experience. What I care about is whether you can defend your ideas in rational, measured tones, without dropping to the level of school yard taunting like, "My CV is bigger than your CV."
Impact is typically based on how many times research articles from that journal are referenced in other scientific work. If no one ever uses your journal (or your paper) to do any future science, you will have a low impact. If your discovery becomes a foundation for a whole sub-field, you are going to have a very high impact. When the system works right, it tells you where the most scientifically useful and widely applicable discoveries are being reported. Low impact means less useful or less widely applicable. But the system doesn't always work right, and there can be a vicious cycle effect where people don't read Journal X because of its low impact factor, so they miss good and important research article Y, so Journal X continues to have a low impact factor. This is not a new problem; Darwin and Mendel were contemporaries, but Darwin never read Mendel's work. Being a german monk = low impact factor journal. :) But having said that, there's two important points to take away. The first is that publication is only one metric by which we judge scientific value; scientists also try and measure how useful someone's research is to the process of scientific discovery and innovation. This is one area where creationists consistently fail; even when they've been able to get work published, it is useless. I would personally go further and say that, by ignoring the concept of utility, they fundamentally misunderstand science as a discipline. The second point is that, for all its faults, the system works reasonably well. Good work generally comes to light. Like Mendel, it might take longer if its published in an obscure place, but once a few people start using your work to do great work themselves, the citation and use of your article can snowball.

eric · 19 January 2011

IBelieveInGod said: It's all in the interpretation of the evidence as you should very well know. You interpret the evidence based on your presupposition that evolution by common descent is true, a Creationist/IDer interprets the same evidence very differently.
The difference is, our interpretation is useful for finding new fossils, finding oil, developing vaccines, predicting how an ecology will respond to some new phenomena, and generally adding to overall capabilities of the human species. Yours is not; it adds nothing. None of this makes creationism dishonest. Go do your own privately-funded research. Teach what you want in sunday school. We won't care. What makes creationism dishonest is that you want to falsly advertise it as science. Deep down inside, where you won't admit it, you recognize that usefullness is important. And so you've decided to co-opt science's reputation as a useful discipline in order to do your religious proselytization. THIS is dishonest. If you would just stop doing that and advertise creationism as a separate, non-scientific discipline, very few people would have a problem with it. Call it applied theology or something. Then teach whatever the heck you want in your applied theology classes - its biology classes we're asking you to stay away from.

SteveF · 19 January 2011

The reasons I can see are that Atheistoclast simply uses his inane programs to camouflage typical debunked Creationist appeals to incredulity in pseudoscientific jargon in the futile hope that no one will see through them, and that Atheistoclast is, hypocritically, an attention whore desperate for any sort of attention, and desperate to mock anyone and everyone who does not bow down to worship him as the Jesus of Science.
Atheistoclast has produced some inane programs of his own. See here for a humorous example: http://www.talkrational.org/showthread.php?t=15811 However, as I pointed out earlier, he isn't using an inane program in this instance. He's using BLAST. http://blast.ncbi.nlm.nih.gov/Blast.cgi

IBelieveInGod · 19 January 2011

DS said: Richard, The IBIG fool has been banned. Please dump all his posts to the bathroom wall. There is still a special thread just for him at After the Bar Closes, that's where he belongs. Everyone else, Please don't respond to this raving lunatic on this thread. All he wants to do is derail the thread with his incessant whining about abiogenesis and other meaningless bullshit. I guess he just couldn't stand to see the atheist guy getting his ass handed to him.
I have never been banned here. Please don't call me a raving lunatic! When you can't respond to a post your answer is to call someone a raving lunatic.

DS · 19 January 2011

Clean up on aisle 11.

OgreMkV · 19 January 2011

All your questions have been answered at ATBC IBIG. The fact that you cannot understand the answers and don't want to understand them is not our fault. That's a personal failing and one that you should work hard to overcome.

I'm still willing to teach you.

Karen S. · 19 January 2011

Well, just use a bigger firecracker. A LOT bigger firecracker.
Do you think even a nuke would make a difference?

mrg · 19 January 2011

Karen S. said: Do you think even a nuke would make a difference?
Well, what would you prefer? The Creation Museum, or a big smoking crater in the ground?

Stanton · 19 January 2011

IBelieveInGod lied: I have never been banned here. Please don't call me a raving lunatic! When you can't respond to a post your answer is to call someone a raving lunatic.
Actually, yes you have been banned before, because you constantly derail every thread you visit, demanding that we worship you as the Godhead of Science, that you have "FAITH" (sic). That's why you have been repeatedly told that your comments are to be confined to the Bathroom Wall. And if you don't want us pointing out how you are a raving lunatic, stop talking like one.

Stanton · 19 January 2011

mrg said:
Karen S. said: Do you think even a nuke would make a difference?
Well, what would you prefer? The Creation Museum, or a big smoking crater in the ground?
Aesthetically and theologically speaking, a big smoking crater makes a far more positive visual impact than Ken Ham's eyesore "museum" That, and the radioactivity couldn't be any worse than the toxic influence of Ken Ham's malicious stupidity, especially if you see its effects our creationist trolls.

Mike Elzinga · 19 January 2011

Elizabeth Liddle said: The only real way to tell a good paper from a bad one is to read it really thoroughly. Not even peer-reviewers always do that.
If I am remembering correctly about the talk by Victor Weisskopf that I mentioned earlier, this is one of the difficulties he pointed out. With the increasing flood of papers, many of which are getting more and more specialized, it becomes harder to find reviewers. And in particular, it gets harder to find reviewers who have enough time to really read a paper thoroughly. Everybody is harassed writing and submitting proposals.

Mike Elzinga · 19 January 2011

DS said: Now where can I publish my magnum opus? I know, Mad magazine. If only the editor didn't hate me so much.
These creationists know that reviewers and editors are extremely busy. So they do what most cheaters do, they sneak into the game when the doorman is busy taking tickets from paying customers.

Dave Wisker · 19 January 2011

Fortunately for us,any IDer papert that does slip by peer review will be praised to the skies by the Dishonesty Institute as the next toppler of Darwin's theory. That gives the rest of us a chance to go look at it and comment-- the only serious attention it most likely will ever get.

John Kwok · 19 January 2011

mrg said:
Karen S. said: Do you think even a nuke would make a difference?
Well, what would you prefer? The Creation Museum, or a big smoking crater in the ground?
Neither. I'd prefer seeing a Neutron Bomb tested on a facility containing the entire Dishonesty Institute, Answers in Genesis and Institute for Creation Research staffs. Then see what happens next.

John Kwok · 19 January 2011

Which is what they are doing already with Mikey Behe's latest example of risible mendacious intellectual porn:
Dave Wisker said: Fortunately for us,any IDer papert that does slip by peer review will be praised to the skies by the Dishonesty Institute as the next toppler of Darwin's theory. That gives the rest of us a chance to go look at it and comment-- the only serious attention it most likely will ever get.

SWT · 19 January 2011

Earlier in this thread I was critical of Atheistoclast for using violent rhetoric. Shouldn't we avoid that on our side, even in jest? Obliterate their arguments, attack their assumptions, but please don't joke about killing or harming anyone or physically destroying anything over this debate.

Just Bob · 19 January 2011

Yes, violent rhetoric and imagery, even used metaphorically and hyperbolicly, will inevitably be taken literally, or as some sort of coded message by the disturbed. You don't even have to be psycho to get what is implied by crosshairs on a map, "don't retreat, reload," "second amendment solutions," etc.

SWT · 19 January 2011

That and the fact that creationists often allege all sorts of perfidious and evil acts are committed by "Darwinists". Why add fuel to that fire?

Plus, we have the facts; we don't need the hyperbole.

John Kwok · 19 January 2011

SWT said: That and the fact that creationists often allege all sorts of perfidious and evil acts are committed by "Darwinists". Why add fuel to that fire? Plus, we have the facts; we don't need the hyperbole.
You're absolutely right, but I would love to scare Bill Dembski to death by having a crack team of loyal Klingon warriors - dressed appropriately in battle armor of course - escorting him each and every time he gives a public address on behalf of his favorite cretinious idea, Intelligent Design. I wouldn't lose sleep if his heart gave out on him and he was summoned immediately to spend the rest of eternity with his one true master Lucifer.

mrg · 19 January 2011

I must admit that escalating from firecrackers to tactical nukes was a bit of a jump. We should establish an arms-limitation treaty with the creobots to restrict both sides to Nerf(TM) munitions.

Mike Elzinga · 19 January 2011

Dave Wisker said: Fortunately for us,any IDer papert that does slip by peer review will be praised to the skies by the Dishonesty Institute as the next toppler of Darwin's theory. That gives the rest of us a chance to go look at it and comment-- the only serious attention it most likely will ever get.
In their clamoring for a ride on the coattails of high-profile scientists, one of the things that upset creationists the most was to be blindsided and taken down by a science nobody coming out of nowhere. Most of us scientific nobodies, with a little updating on ID/creationist dirty tricks, can easily demolish ID/creationist misconceptions and misrepresentations. The best way to do that is to discuss these issues with the public in a way that denies ID/creationists any chance to hitch a free ride on our coattails. And one doesn’t have to be a specialist in every area of science to do this. A careful deconstruction of ID/creationist junk science contrasted with the real science is usually sufficient. Then one can point out that these same deceptive misrepresentations are used by ID/creationists in every area in which they feign universal and simultaneous expertise.

IBelieveInGod · 19 January 2011

Stanton said:
IBelieveInGod lied: I have never been banned here. Please don't call me a raving lunatic! When you can't respond to a post your answer is to call someone a raving lunatic.
Actually, yes you have been banned before, because you constantly derail every thread you visit, demanding that we worship you as the Godhead of Science, that you have "FAITH" (sic). That's why you have been repeatedly told that your comments are to be confined to the Bathroom Wall. And if you don't want us pointing out how you are a raving lunatic, stop talking like one.
I've been banned before? Tell me when? I have never had a problem posting here, even though my email address is the same, I have always posted as IBelieveInGod. Are you saying that I was banned and then unbanned?

Mike Elzinga · 19 January 2011

Füttern das troll nichts.

John Vanko · 19 January 2011

Mike Elzinga said: Füttern das troll nichts.
(If I can remember my Grandmother's German) An das troll: Halt mals, sagt nicht!

Stanton · 19 January 2011

IBelieveInGod said:
Stanton said:
IBelieveInGod lied: I have never been banned here. Please don't call me a raving lunatic! When you can't respond to a post your answer is to call someone a raving lunatic.
Actually, yes you have been banned before, because you constantly derail every thread you visit, demanding that we worship you as the Godhead of Science, that you have "FAITH" (sic). That's why you have been repeatedly told that your comments are to be confined to the Bathroom Wall. And if you don't want us pointing out how you are a raving lunatic, stop talking like one.
I've been banned before? Tell me when? I have never had a problem posting here, even though my email address is the same, I have always posted as IBelieveInGod. Are you saying that I was banned and then unbanned?
Apparently, you are too stupid to remember the reason why you were originally restricted to the Bathroom Wall in the first place: that you continually pick fights on every thread, demanding that we give up Science in order to worship you, instead. Please stop posting your lies, inane anti-science screeds, and moronic lunacy.

DS · 19 January 2011

If IBIGOT the lying troll wants anyone to respond to him, he can take it to After the Bar Closes. He's still getting his ass kicked over there. If not, he can shove a digit up his favorite orifice and rotate on it. This jackass isn't even welcome on the Bathroom Wall anymore. It took ten men working in shifts to purge the bathroom of 400 pages of his filth last time. Does anyone want to go through that bullshit again?

The guy is a raving lunatic and a satan worshiper. For all I know he sacrifices young virgins to the new moon. Why respond to such a deluded fool? He never posts anything on topic anyway. What the hell does abiogenesis have to do with gene duplication? Absolutely nothin, say it again.

If Richard won't purge his crap, we should all ignore him completely. Maybe then he will get the message that he is not welcome here.

Dave Wisker · 19 January 2011

I hope people have not forgotten that Atheistoclast has not even tried to address my pointing out his misrepresentation of the reference he claimed supported his contention that the Sdic gene was explained by "background selection".

Stanton · 19 January 2011

SWT said: Earlier in this thread I was critical of Atheistoclast for using violent rhetoric. Shouldn't we avoid that on our side, even in jest? Obliterate their arguments, attack their assumptions, but please don't joke about killing or harming anyone or physically destroying anything over this debate.
Why should we neuter our hyperbole for the sake of creationist trolls? That we refuse to mindlessly accept their Lies for Jesus is the greatest, most unforgivable crime in the eyes of a creationist, surpassing even mass murder and genocide (which, to a creationist, are readily forgiven and made acceptable if one claims that they were done for Jesus' sake). There is literally nothing worse that we can say or do to offend a creationist, beyond rejecting their Lies for Jesus. I mean, why else do these trolls labor so much to speak so much evil of us whenever we refuse to bow down beneath their feet in worship?

mrg · 19 January 2011

Stanton said: Why should we neuter our hyperbole for the sake of creationist trolls?
That's right. Call in a Nerfstrike on the lowlives.

John Vanko · 19 January 2011

Stanton said: Apparently, you are too stupid to remember the reason why you were originally restricted to the Bathroom Wall in the first place:
At the risk of being boring, may I refresh your memories?
On Sept. 24th, 2010, IBIG said: "I read this on the ICR site and I really like it:) Since something exists (say, the universe), and since something cannot make itself (without violating the first principle of causality), then a cause outside that thing must exist (God)."
Let me fix that for you IBIG: "Since something exists (say, YHWH), and since something cannot make itself (without violating the first principle of causality), then a cause outside that thing must exist (the Sumerian God An, who existed 1,000 years before YHWH and therefore must have created YHWH). "
On Sept. 24th, 2010, OgreMkV said: "Well, we tried science… IBIG pretty much failed at that. We tried, logic… IBIG failed. We tried theology… fail. Now we’re back to witnessing… fail. And the cycle repeats… like a shirt that just isn’t getting clean.
Yes, the cycle repeats.
Dave Luckett said on Feb 8, 2010: Playing chess with pigeons.
Can you guess who he was referring to? Yep, IBIG.
IBelieveInGod said on Feb 9, 2010: “I believe that God created life through natural causes, “
You could have fooled me. So what, exactly, are you arguing?
IBelieveInGod said on Feb 9, 2010: “I keep making analogies to attempt to help you all understand, but it appears that you aren’t capable, or you just don’t want to understand.”
Or could it be that you don't understand. Nah!
IBelieveInGod said on Feb 9, 2010: “Why do you all think that God does everything supernaturally? “
Uh, maybe because he’s supernatural? Be forewarned Pandas, such is the mind of IBIG.

Dale Husband · 19 January 2011

IBelieveInGod said:
Dale Husband said: You IGNORE all the evidence for evolution, and say there is "evidence" for Creationism and then give us none! So who has the double standard? YOU!
It's all in the interpretation of the evidence as you should very well know. You interpret the evidence based on your presupposition that evolution by common descent is true, a Creationist/IDer interprets the same evidence very differently. You think that the evidence supports your opinion and the Creationist/Ider think the evidence supports their opinion. So, all we have are different OPINIONS of the same evidence. I prefer opinions rather then explanation, because that really all they are.
And that, IBIG, is exactly why you cannot do science. Sure, there are different ways of interpreting evidence, but only ONE way involves consistent rules of logic and empirical analysis. Even if the prosecution and the defense present their different interpretations to a jury, the jury still had to decide which one is more credible. The idea that you can have different interpretations of evidence and not judge which one is correct is one of the biggest lies Creationists are known to tell.

John Kwok · 19 January 2011

mrg said:
Stanton said: Why should we neuter our hyperbole for the sake of creationist trolls?
That's right. Call in a Nerfstrike on the lowlives.
You get a most enthusiastic second from me mrg!!!!

Atheistoclast · 19 January 2011

Dave Wisker said: I hope people have not forgotten that Atheistoclast has not even tried to address my pointing out his misrepresentation of the reference he claimed supported his contention that the Sdic gene was explained by "background selection".
Not my contention at all. Charlesworth & Charlesworth suggested that background selection can mimick the effect of positive selection in a region of low recombination - such as the X chromosome. http://www.nature.com/nature/journal/v400/n6744/full/400519b0.html I actually stated that both possibilities could be valid....but you failed to quote that line. Sdic is a perfect example of a loss of function mutation proving to have some adaptive benefit. The alignment in Figure 1 (of my paper) is a real beauty. Indeed, the AFP in this Cheng paper also lost its N-terminal domain in the same way Sdic did. However, there was evidence of positive selection further downstream at the C-terminus.

mrg · 19 January 2011

John Kwok said: You get a most enthusiastic second from me mrg!!!!
"I just love the smell of polyfoam in the morning."

Atheistoclast · 19 January 2011

I meant to say the ancestral SAS precursor of the AFP.

SWT · 19 January 2011

Stanton said:
SWT said: Earlier in this thread I was critical of Atheistoclast for using violent rhetoric. Shouldn't we avoid that on our side, even in jest? Obliterate their arguments, attack their assumptions, but please don't joke about killing or harming anyone or physically destroying anything over this debate.
Why should we neuter our hyperbole for the sake of creationist trolls?
I'm suggesting the change in tone for the sake of the creationists and the "both siders" who might still be convinced by the scientific evidence. Trolls are trolls and bad behavior is expected of them as long as they're fed. We can do better.

IBelieveInGod · 19 January 2011

Stanton said:
IBelieveInGod said:
Stanton said:
IBelieveInGod lied: I have never been banned here. Please don't call me a raving lunatic! When you can't respond to a post your answer is to call someone a raving lunatic.
Actually, yes you have been banned before, because you constantly derail every thread you visit, demanding that we worship you as the Godhead of Science, that you have "FAITH" (sic). That's why you have been repeatedly told that your comments are to be confined to the Bathroom Wall. And if you don't want us pointing out how you are a raving lunatic, stop talking like one.
I've been banned before? Tell me when? I have never had a problem posting here, even though my email address is the same, I have always posted as IBelieveInGod. Are you saying that I was banned and then unbanned?
Apparently, you are too stupid to remember the reason why you were originally restricted to the Bathroom Wall in the first place: that you continually pick fights on every thread, demanding that we give up Science in order to worship you, instead. Please stop posting your lies, inane anti-science screeds, and moronic lunacy.
I beg to differ, I was never restricted to the bathroom, I had several posts sent to the bathroom and then I chose to post there instead. I was never banned, so you lie again, tell me when will you quit your lying? I have never demanded that you give up science to worship me, again another blatant lie by you. You are LIAR!!!

Stanton · 19 January 2011

SWT said:
Stanton said:
SWT said: Earlier in this thread I was critical of Atheistoclast for using violent rhetoric. Shouldn't we avoid that on our side, even in jest? Obliterate their arguments, attack their assumptions, but please don't joke about killing or harming anyone or physically destroying anything over this debate.
Why should we neuter our hyperbole for the sake of creationist trolls?
I'm suggesting the change in tone for the sake of the creationists and the "both siders" who might still be convinced by the scientific evidence.
From my experience, the vast majority of such people don't care much about tone, short of direct attacks.
Trolls are trolls and bad behavior is expected of them as long as they're fed. We can do better.
I suppose so. Now if only the administrations could neuter IBelieve's ability to troll.

RBH · 19 January 2011

SWT said: Earlier in this thread I was critical of Atheistoclast for using violent rhetoric. Shouldn't we avoid that on our side, even in jest? Obliterate their arguments, attack their assumptions, but please don't joke about killing or harming anyone or physically destroying anything over this debate.
^^^This. Let's calm down, kids.

Stanton · 19 January 2011

IBelieveInGod said: I beg to differ, I was never restricted to the bathroom, I had several posts sent to the bathroom and then I chose to post there instead.
Your presence is not welcomed here, it never was welcomed here. We would greatly appreciate if you would stop posting here altogether.
I was never banned, so you lie again, tell me when will you quit your lying?
If I'm lying, then DS is really Pat Robertson, and the day I "quit lying" to you is the day DS also admits he's really Fred Phelps, which will also be the same day you admit to being the Pope.
I have never demanded that you give up science to worship me, again another blatant lie by you. You are LIAR!!!
Uh huh. And yet, why is it that you continue posting here, picking fights, conflating civility with groveling, and claiming how you know more about science than actual scientists, that Abiogenesis is really an atheistic recruitment mantra to turn children into God-hating zombies, or insisting that we're evil liars and God-hating atheists simply because we do not accept your Lies for Jesus? Give it up, IBelieve. No one here believes you, beyond the other Jesus trolls.

IBelieveInGod · 19 January 2011

Creationists believe that God created various kinds of life, and those various kinds of life have changed and adapted through the years. That change and adaptation is backed by the evidence (microevolution) These changes do not include the evolution of new novel morphological structures.

Evolutionists believe that all life evolved from an extremely simple organism or organisms. (macroevolution) Which would require the evolution of new novel morphological structures. Limbs with all the complexity of bones, cartilage, ligaments, tendons, muscles, nerves would have had to evolved, and that is just one example of a complex morphological structure that would have evolved.

There is evidence of microevolution, but macroevolution is nothing more then conjecture, and assumption based on ones belief that evolution from common descent happened.

IBelieveInGod · 19 January 2011

Stanton said:
IBelieveInGod said: I beg to differ, I was never restricted to the bathroom, I had several posts sent to the bathroom and then I chose to post there instead.
Your presence is not welcomed here, it never was welcomed here. We would greatly appreciate if you would stop posting here altogether.
I was never banned, so you lie again, tell me when will you quit your lying?
If I'm lying, then DS is really Pat Robertson, and the day I "quit lying" to you is the day DS also admits he's really Fred Phelps, which will also be the same day you admit to being the Pope.
I have never demanded that you give up science to worship me, again another blatant lie by you. You are LIAR!!!
Uh huh. And yet, why is it that you continue posting here, picking fights, conflating civility with groveling, and claiming how you know more about science than actual scientists, that Abiogenesis is really an atheistic recruitment mantra to turn children into God-hating zombies, or insisting that we're evil liars and God-hating atheists simply because we do not accept your Lies for Jesus? Give it up, IBelieve. No one here believes you, beyond the other Jesus trolls.
Is this a public forum? If it is a public forum, then I would think you would welcome opposing views, if you don't want opposing views, then maybe those in charge should make this a private forum, and only accept membership from those believe in evolution from common descent.

Stanton · 19 January 2011

IBelieveInGod said: Creationists believe that God created various kinds of life, and those various kinds of life have changed and adapted through the years. That change and adaptation is backed by the evidence (microevolution) These changes do not include the evolution of new novel morphological structures.
In other words, God magically poofed everything into existence using magic.
Evolutionists believe that all life evolved from an extremely simple organism or organisms. (macroevolution) Which would require the evolution of new novel morphological structures. Limbs with all the complexity of bones, cartilage, ligaments, tendons, muscles, nerves would have had to evolved, and that is just one example of a complex morphological structure that would have evolved.
In other words, you don't understand, therefore, it didn't happen, and everyone who does actually understand it are really evil liars and God-hating atheists.
There is evidence of microevolution, but macroevolution is nothing more then conjecture, and assumption based on ones belief that evolution from common descent happened.
And yet, you're claiming that I'm the liar. Hypocrite.

Stanton · 19 January 2011

IBelieveInGod said: Is this a public forum? If it is a public forum, then I would think you would welcome opposing views, if you don't want opposing views, then maybe those in charge should make this a private forum, and only accept membership from those believe in evolution from common descent.
It's typical of trolls like you to scream censorship when your constant lying, constant demands that we believe your Lies for Jesus, as well as your inability to behave civilly are pointed out.

Dave Wisker · 19 January 2011

Atheistoclast said:
Dave Wisker said: I hope people have not forgotten that Atheistoclast has not even tried to address my pointing out his misrepresentation of the reference he claimed supported his contention that the Sdic gene was explained by "background selection".
Not my contention at all. Charlesworth & Charlesworth suggested that background selection can mimick the effect of positive selection in a region of low recombination - such as the X chromosome. http://www.nature.com/nature/journal/v400/n6744/full/400519b0.html
You cited Numinsky and Hartl's reply, which clearly pointed out the opposite, as supporting the background selection idea, never mentioning their central point about increased codon usage bias. You never cited Charlesworth & Charlesworth in the paper-- I had to find and read it myself. Furthermore, your explanation does not take into account the sharply increased codon usage bias, it ignores it. Therefore, you cannot propose--as you flatly do in the paper-- that it is "more logical" to propose a relaxed selection regime, without first explaining why such increased codon usage bias exists and persisted under relaxed selection.

IBelieveInGod · 19 January 2011

Let me add that it is never okay to threaten anyone, even if it is jest. As I pointed out when Kris posted such despicable threats, that he shouldn't be just banned, but maybe even prosecuted. I have never posted anything of the sort. My posts have been opposing views, which it appears aren't welcome here. If opposing views aren't welcome here, why is that the case, could it be that many feel that evolution by common descent is threatened by such posts? Why should there even be a concern?

IBelieveInGod · 19 January 2011

Stanton said:
IBelieveInGod said: Creationists believe that God created various kinds of life, and those various kinds of life have changed and adapted through the years. That change and adaptation is backed by the evidence (microevolution) These changes do not include the evolution of new novel morphological structures.
In other words, God magically poofed everything into existence using magic.
Evolutionists believe that all life evolved from an extremely simple organism or organisms. (macroevolution) Which would require the evolution of new novel morphological structures. Limbs with all the complexity of bones, cartilage, ligaments, tendons, muscles, nerves would have had to evolved, and that is just one example of a complex morphological structure that would have evolved.
In other words, you don't understand, therefore, it didn't happen, and everyone who does actually understand it are really evil liars and God-hating atheists.
There is evidence of microevolution, but macroevolution is nothing more then conjecture, and assumption based on ones belief that evolution from common descent happened.
And yet, you're claiming that I'm the liar. Hypocrite.
I don't know the actual physical process that God used, but I believe that God is Spirit and is not controlled by, nor is He subject to the physical universe. If He created the physical universe, then He also would have control over it. Magic and Poofing are nothing more then words, that you use to attempt to discredit a Creator. Either the universe came from nothing by itself, or the universe came from nothing by a Creator. So, is it you belief that the universe poofed itself into existence by magic? You see no matter how you look at it, something had to come from nothing. So, tell me did the universe poof itself into existence by magic from nothing?

Stanton · 19 January 2011

IBelieveInGod said: Let me add that it is never okay to threaten anyone, even if it is jest. As I pointed out when Kris posted such despicable threats, that he shouldn't be just banned, but maybe even prosecuted. I have never posted anything of the sort. My posts have been opposing views, which it appears aren't welcome here. If opposing views aren't welcome here, why is that the case, could it be that many feel that evolution by common descent is threatened by such posts? Why should there even be a concern?
Bullshit, IBelieve. You constantly accuse us of being liars and evil atheists because we not only disagree with you, but also point out all of the bullshit in all of your posts. Like how you have quotemined and distorted sources, and how you then accuse us of lying when we point out your gross dishonesty. And then there is how you cough up some inane rhetorical question that lays bare your bigoted, willful stupidity just so you can deliberately ignore all the responses in order to then boast about how you stumped everyone... Except for a few responses that you distort in order to accuse the responder of being an idiot for not agreeing with your inane claim. And then there is how you vehemently, hypocritically deny any wrongdoing, accusing anyone who would doubt that you are nothing but some sweet, innocent, angelic denizen of a Norman Rockwell painting to be an evil, God-hating, atheist liar. And then there is how you always claim how Abiogenesis isn't about how life could have formed from self-replicating organic molecules, but really an evil atheist plot to turn children into God-hating zombies, or how you constantly, deliberately conflate Atheism with Science, Abiogenesis, Islam, Nazism, Abortion, and Religious Intolerance. In other words, IBelieve, you come across as an obnoxious, pompous boor of a religious bigot. You are annoying and you repeatedly demonstrate that you hate knowledge, hate truth, hate anything and everything that isn't screaming Josiahs to Jesus and you, and that your word is less than crap.

Dale Husband · 19 January 2011

IBelieveInGod said: I beg to differ, I was never restricted to the bathroom, I had several posts sent to the bathroom and then I chose to post there instead. I was never banned, so you lie again, tell me when will you quit your lying? I have never demanded that you give up science to worship me, again another blatant lie by you. You are LIAR!!!
There are two possibilities, IBIG; you are either a liar or an idiot. If you were never confined to the Bathroom Wall, why would you post there and only there for many months and waste all that time and space? That's what an idiot does. The Bathroom Wall is for convos that have NO PLACE elsewhere on the Panda's Thumb! So you just admitted to everyone that you are an idiot! I think Stanton actually means you expect us to worship the bogus image of God in your head, which would be the same as worshipping you, since man tends to create God in his own image, rather than the other way around as the Book of Genesis falsely claims.
IBelieveInGod said: Let me add that it is never okay to threaten anyone, even if it is jest. As I pointed out when Kris posted such despicable threats, that he shouldn't be just banned, but maybe even prosecuted. I have never posted anything of the sort. My posts have been opposing views, which it appears aren't welcome here. If opposing views aren't welcome here, why is that the case, could it be that many feel that evolution by common descent is threatened by such posts? Why should there even be a concern?
If you want to present a legitimate opposing view, it still has to be based on the established rules of science. You never have followed those rules. If I knew a chess player was a habitual cheater, I'd never allow him to play in an international chess tournament.

Stanton · 19 January 2011

IBelieveInGod said: I don't know the actual physical process that God used, but I believe that God is Spirit and is not controlled by, nor is He subject to the physical universe. If He created the physical universe, then He also would have control over it. Magic and Poofing are nothing more then words, that you use to attempt to discredit a Creator.
People are trying to study how the Universe formed. People whom you've repeatedly accused of being evil atheists out to turn children into God-hating zombies. You've also claimed how you know more than science, which you've claimed as being just another religion, simply because you have "FAITH"
Either the universe came from nothing by itself, or the universe came from nothing by a Creator. So, is it you belief that the universe poofed itself into existence by magic? You see no matter how you look at it, something had to come from nothing. So, tell me did the universe poof itself into existence by magic from nothing?
I asked you first. That you can only respond by vomiting meaningless New Age psychobabble, while evading my original questions suggests that you're just here to listen to yourself babble, and to whine and screech at us because we're pointing out your bullshit.

Dale Husband · 19 January 2011

IBelieveInGod said: I don't know the actual physical process that God used,
And just by admitting that, you completely disqualify any claim that Creationism can be scientific.
but I believe that God is Spirit and is not controlled by, nor is He subject to the physical universe.
This is actually reasonable. If God created the universe, he cannot be part of it.
If He created the physical universe, then He also would have control over it. Magic and Poofing are nothing more then words, that you use to attempt to discredit a Creator.
Why is it that you Creationists never show any evidence that God has any direct control over the physical universe? It is the lack of such evidence that led great thinkers to become Deists and then Atheists.
Either the universe came from nothing by itself, or the universe came from nothing by a Creator.
Assumption based on a false dichotomy. No one assumes that the universe came from nothing by itself. If the Big Bang had a cause, we don't know what it is, but to ASSUME that an intelligent being did it just because of what ancient religions taught is unscientific.

IBelieveInGod · 19 January 2011

Dale Husband said:
IBelieveInGod said: I beg to differ, I was never restricted to the bathroom, I had several posts sent to the bathroom and then I chose to post there instead. I was never banned, so you lie again, tell me when will you quit your lying? I have never demanded that you give up science to worship me, again another blatant lie by you. You are LIAR!!!
There are two possibilities, IBIG; you are either a liar or an idiot. If you were never confined to the Bathroom Wall, why would you post there and only there for many months and waste all that time and space? That's what an idiot does. The Bathroom Wall is for convos that have NO PLACE elsewhere on the Panda's Thumb! So you just admitted to everyone that you are an idiot! I think Stanton actually means you expect us to worship the bogus image of God in your head, which would be the same as worshipping you, since man tends to create God in his own image, rather than the other way around as the Book of Genesis falsely claims.
IBelieveInGod said: Let me add that it is never okay to threaten anyone, even if it is jest. As I pointed out when Kris posted such despicable threats, that he shouldn't be just banned, but maybe even prosecuted. I have never posted anything of the sort. My posts have been opposing views, which it appears aren't welcome here. If opposing views aren't welcome here, why is that the case, could it be that many feel that evolution by common descent is threatened by such posts? Why should there even be a concern?
If you want to present a legitimate opposing view, it still has to be based on the established rules of science. You never have followed those rules. If I knew a chess player was a habitual cheater, I'd never allow him to play in an international chess tournament.
Why don't you ask those in charge if I was banned? I posted there on purpose, and I am not an idiot. No view that opposes your view of evolution from common descent would be legitimate. According to many here any that don't agree that evolution from common descent is true are idiots, ignorant, insane, lunatics, etc... There is no tolerance of Creationists here, nor is there tolerance of intelligent design proponents here.

Stanton · 19 January 2011

IBelieveInGod said: Why don't you ask those in charge if I was banned? I posted there on purpose, and I am not an idiot.
Why don't you stop posting here altogether, then? That would end our hostility towards you, for certain.
No view that opposes your view of evolution from common descent would be legitimate. According to many here any that don't agree that evolution from common descent is true are idiots, ignorant, insane, lunatics, etc... There is no tolerance of Creationists here, nor is there tolerance of intelligent design proponents here.
The vast majority of Creationists and Intelligent Design proponents who come to this site have demonstrated themselves to be liars and arrogant idiots who are only here to Lie for Jesus, and to heap abuse on everyone who does not accept their Lies for Jesus. You are no different from the others. IBelieve, you have repeatedly demonstrated that you do not understand Science, that you hate Science, and that you conflate Science with Atheism, along with literally everything and everyone else you hate. You have repeatedly demonstrated that your word is worthless, too.

Dale Husband · 19 January 2011

IBelieveInGod said: Why don't you ask those in charge if I was banned? I posted there on purpose, and I am not an idiot.
Then what was your point of posting all that crap there? You could have spent all that time writing a novel of Christian fiction, publishing it, and making good money from the royalties. What makes someone an idiot if it's not acting like you?
No view that opposes your view of evolution from common descent would be legitimate. According to many here any that don't agree that evolution from common descent is true are idiots, ignorant, insane, lunatics, etc... There is no tolerance of Creationists here, nor is there tolerance of intelligent design proponents here.
We do not tolerate religious dogmas being cloaked in scientific terminology to decieve the scientifically illiterate, no. If Creationism were merely a religious teaching that was recognized even by all Christians as based solely on ancient myths and having no relevance to modern science, we wouldn't care. It is the SCAM of "scientific" Creationism and Intelligent Design we condemn, not merely Creationism itself. And common descent by evolution remains the only credible scientific explanation for how life forms came to be as they are today, because NO Creationist claim stands up to critical scrunity! If you expect us to take you and your claims seriously, do the work to support them empirically. We are just as critical of astrologers who argue just as stupidly as you do. It's not merely about attacking the Bible and Christianity. It about seeking and telling objective truth, period. You can take off that tinfoil hat now.

ben · 20 January 2011

There is no tolerance of Creationists here, nor is there tolerance of intelligent design proponents here
What there is no tolerance for, is people claiming that non-science (creationism) and anti-science (ID) are in fact legitimate science. Start following the established rules of science and you will find that people here will stop attacking you for falsely claiming that your moronic superstitions are scientific.

John Vanko · 20 January 2011

IBelieveInGod said to Stanton: I beg to differ, I was never restricted to the bathroom, ... You are LIAR!!!
IBIG said he never lies, intentionally. I beg to differ. In the PT forum ‘Primordial Soup’ Ousted from the Origin of Life?!? by Dave Thomas, initiated Feb. 3, 2010, IBIG was banished to the Bathroom Wall Feb. 8th after spamming, railroading, and then derailing (take your pick of metaphor) the thread, panel 6. It is in the Feb 2010 Archives and the BW, go see for yourself. (I still can't see the old BW because IBIG clogged it with his effluent.) So did IBIG intentionally lie, or unintentionally lie? You be the judge.

OgreMkV · 20 January 2011

Don't forget hypocrisy... hating science while using the tools that science has given him. BTW: There's a good question for you at ATBC. I bet you won't go answer it.

Atheistoclast · 20 January 2011

You never cited Charlesworth & Charlesworth in the paper-- I had to find and read it myself.
Fair point..I should have cited it, but I was more interested in Hartl's reply. He doesn't rule out background selection - it is a matter of interpretation since we cannot go back in time and observe what happened. Generally, background selection can imitate the effect of positive selection with respect to reduced heterogeneity at neighboring loci.
Furthermore, your explanation does not take into account the sharply increased codon usage bias, it ignores it. Therefore, you cannot propose--as you flatly do in the paper-- that it is "more logical" to propose a relaxed selection regime, without first explaining why such increased codon usage bias exists and persisted under relaxed selection.
You obviously never looked at the alignment. Sdic has LOST 100 codons at the N-terminus that are present in Cdic. This initial development would have been deleterious and so selected against. It was preserved because of a relaxation in selection or because of some population bottleneck. Codon usage bias may have several explanations, and these are not central to the argument about Sdic's creation. What is clear is that, of the 9 domains present in Cdic, 3 of them have either been deleted or disabled in Sdic.

Gabriel Hanna · 20 January 2011

SteveF said:
The reasons I can see are that Atheistoclast simply uses his inane programs to camouflage typical debunked Creationist appeals to incredulity in pseudoscientific jargon in the futile hope that no one will see through them, and that Atheistoclast is, hypocritically, an attention whore desperate for any sort of attention, and desperate to mock anyone and everyone who does not bow down to worship him as the Jesus of Science.
Atheistoclast has produced some inane programs of his own. See here for a humorous example: http://www.talkrational.org/showthread.php?t=15811 However, as I pointed out earlier, he isn't using an inane program in this instance. He's using BLAST. http://blast.ncbi.nlm.nih.gov/Blast.cgi
I went through some of those. Full of win. Atheistoclast offered to teach a seminar on writing code to Peter Seebach. Atheistoclast, did you ever email Peter Seebach's superiors at Wind River to inform them he doesn't know how to code, as you threatened to do? Pity if you didn't, he gave you all their email addresses and encouraged you to do so. Everyone should look at that thread and see the evidence for Atheistoclast's claim to be a "computational biologist".

Atheistoclast · 20 January 2011

ben said:
There is no tolerance of Creationists here, nor is there tolerance of intelligent design proponents here
What there is no tolerance for, is people claiming that non-science (creationism) and anti-science (ID) are in fact legitimate science. Start following the established rules of science and you will find that people here will stop attacking you for falsely claiming that your moronic superstitions are scientific.
Darwinism is destined to end up on the ash heap of failed pseudo-scientific ideologies. It is a case of when and not if. If it were so sound, it would not be in a constant battle to defend its contentions. The evidence would be overwhelming. However, hardly anything of the naturalistic argument makes any real sense.

Atheistoclast · 20 January 2011

Atheistoclast, did you ever email Peter Seebach's superiors at Wind River to inform them he doesn't know how to code, as you threatened to do? Pity if you didn't, he gave you all their email addresses and encouraged you to do so.
No. I didn't want Herr Seebach to lose his job with the company. His complete incomprehension of C++, along with confusion over dynamic memory allocation, would have been too embarrassing. I am just too nice of a guy.

Stanton · 20 January 2011

Atheistoclast said:
Atheistoclast, did you ever email Peter Seebach's superiors at Wind River to inform them he doesn't know how to code, as you threatened to do? Pity if you didn't, he gave you all their email addresses and encouraged you to do so.
No. I didn't want Herr Seebach to lose his job with the company. His complete incomprehension of C++, along with confusion over dynamic memory allocation, would have been too embarrassing. I am just too nice of a guy.
This comes off as gross hypocrisy compared to many of your previous statements. You don't want Dr Seebach out of a job, yet you clamor for the destruction of that "satanic paradigm," for it to be overthrown like Communism, which would ultimately have literally everyone thrown out of their jobs. You claim to be a "nice guy," yet, routinely accuse literally everyone who does not agree 190% with your own bigoted conclusions to be an evil liar and a devil worshiper.

Stanton · 20 January 2011

Atheistoclast said:
ben said:
There is no tolerance of Creationists here, nor is there tolerance of intelligent design proponents here
What there is no tolerance for, is people claiming that non-science (creationism) and anti-science (ID) are in fact legitimate science. Start following the established rules of science and you will find that people here will stop attacking you for falsely claiming that your moronic superstitions are scientific.
Darwinism is destined to end up on the ash heap of failed pseudo-scientific ideologies. It is a case of when and not if. If it were so sound, it would not be in a constant battle to defend its contentions. The evidence would be overwhelming. However, hardly anything of the naturalistic argument makes any real sense.
And yet, where is the evidence that all things can not evolve, where is the evidence that God is magically tinkering with everything under our noses? More importantly, how come there all of the Creationists and the Intelligent Design proponents refuse to look for any evidence to support their claims that Creationism or Intelligent Design is supposed to be a legitimate science? I also see that you are still addicted to using Darwinism as a racist slur.

Roger · 20 January 2011

John Vanko said:
IBelieveInGod said to Stanton: I beg to differ, I was never restricted to the bathroom, ... You are LIAR!!!
IBIG said he never lies, intentionally. I beg to differ. In the PT forum ‘Primordial Soup’ Ousted from the Origin of Life?!? by Dave Thomas, initiated Feb. 3, 2010, IBIG was banished to the Bathroom Wall Feb. 8th after spamming, railroading, and then derailing (take your pick of metaphor) the thread, panel 6. It is in the Feb 2010 Archives and the BW, go see for yourself. (I still can't see the old BW because IBIG clogged it with his effluent.) So did IBIG intentionally lie, or unintentionally lie? You be the judge.
Looks more like just a storm in a teacup to me. My understanding is IBIG's comments were banished to the BW but he has not been banned from PT The argument is mostly through misunderstanding and/or posturing so is just a waste of time here. @IBIG - I know this probably falls on deaf ears but if you want the kind of tolerance and respect you demand from the other posters, you really have to understand a couple of ground rules. The first is stay on topic. Try very very very hard to write something about gene duplication. Don't believe me? - then find a knitting blog and start arguing about abiogenesis in the comments for a random entry there and see what happens. The second thing - and I know you find this concept hard - science does not take the supernatural into account. This is a science blog. God is supernatural. This means whenever you invoke Him in your arguements these other guys roll their eyes and give you a hard time. Please, as a favour to all of us including yourself, stop it. I would have thought you should have worked this all out for yourself by now so whinging about how you're persecuted here by these nasty scientist will gain you no sympathy. If you didn't like it, you know now what you have to do. Now I'm going back to "lurker" mode.

DS · 20 January 2011

Atheistoclast said: Darwinism is destined to end up on the ash heap of failed pseudo-scientific ideologies. It is a case of when and not if. If it were so sound, it would not be in a constant battle to defend its contentions. The evidence would be overwhelming. However, hardly anything of the naturalistic argument makes any real sense.
Now you got it. No matter whether internet trolls and science wannabes refuse to accept evolution, there is overwhelming evidence that it actually occurred. You haven't even begun to address this evidence. You seem to be fixated on one single mechanism. Even if you demonstrated that there isn't even one example of that mechanism working, it still wouldn't mean that it could never work and it still wouldn't mean that evolution didn't happen. You can stand up on a soapbox and cry Waterloo until the cows come home and bite you on your sorry ass, but reality will still be there mocking you. The only way that "Darwinism" will ever be discarded is if a better scientific explanation for the diversity of life is discovered. You don't have one. You aren't even looking. You are doomed to ignominious failure. Get a clue. The only constant battle going on is with pathetic science wannabes and religious fanatics like you. Now how about explaining why hox gene duplications don't count as an example of evolution. I notice that you ignored those questions. MAybe you should be dumped on the ash heap.

Atheistoclast · 20 January 2011

And yet, where is the evidence that all things can not evolve, where is the evidence that God is magically tinkering with everything under our noses?
It is not that things cannot change - it is a question of the extent to which they can without the intervention of something beyond the natural and observed order.
More importantly, how come there all of the Creationists and the Intelligent Design proponents refuse to look for any evidence to support their claims that Creationism or Intelligent Design is supposed to be a legitimate science? I also see that you are still addicted to using Darwinism as a racist slur.
How is Darwinism a racist slur? Let me remind you that the Bulldog himself, namely Huxley, coined the term. It is used by scientists to distinguish this brand of evolutionism from others such as Lamarckism, Kimurism etc..

John Kwok · 20 January 2011

IBelieveInGod said: Creationists believe that God created various kinds of life, and those various kinds of life have changed and adapted through the years. That change and adaptation is backed by the evidence (microevolution) These changes do not include the evolution of new novel morphological structures.
Sorry IBelieveInNonsense, but the last time I checked, there are devout Christian scientists who accept that biological evolution is valid and is the means through which the Almighty has "created" life on earth: Francis Collins, Darrel Falk, Karl Giberson, Keith Miller, Ken Miller, Steve Matheson, Simon Conway Morris, and many, many others.
IBelieveInGod said: Evolutionists believe that all life evolved from an extremely simple organism or organisms. (macroevolution) Which would require the evolution of new novel morphological structures. Limbs with all the complexity of bones, cartilage, ligaments, tendons, muscles, nerves would have had to evolved, and that is just one example of a complex morphological structure that would have evolved. There is evidence of microevolution, but macroevolution is nothing more then conjecture, and assumption based on ones belief that evolution from common descent happened.
Typical creotard breathtaking inanity from you, IBelieveInNonsense, since your comments ignore the role of geneaology - or to be more precise, phylogeny - in helping to define the "paths" in which descent through modification - to use Darwin's original term for biological evolution - occurs through countless lineages of bacteria, fungi, protists, plants and animals, and has resulted in the present complexity and diversity of life on Planet Earth. The complexity that you speak of is due to accidents of history, not through Divine Intervention of any kind whatsoever, and moreover, as others have noted here, the very processes responsible for microevolution are also responsible for macroevolution (the creation of new species, or rather, in other words, lineage splitting).

DS · 20 January 2011

Atheistoclast said: It is not that things cannot change - it is a question of the extent to which they can without the intervention of something beyond the natural and observed order.
Exactly. There is ample evidence that all of life has evolved from a single common ancestor. You have presented no theoretical reason why this could not happen. You have presented no evidence that this could not or did not happen. All you have done is to claim that it cannot happen. You have been told that there is no such thing as conservation of information. What else you got?

Dave Wisker · 20 January 2011

Atheistoclast writes:
You obviously never looked at the alignment. Sdic has LOST 100 codons at the N-terminus that are present in Cdic. This initial development would have been deleterious and so selected against.
How do you know this? You don't cite any research demonstrating it. For example, is there any enzyme activity level data for the Cdic protein with such a deletion? Furthermore, if the Cdic gene was initially duplicated, and the copy underwent the deletion, what reason is there to expect negative selection to occur? This is where your argument—such as it is—goes off the rails. Let’s assume, for the moment, that the deletion in the Cdic gene was not negatively selected against (which is what you seem to be saying, though conventional evolutionary theory predicts this anyway, so you get no points for originality). You write:
The most likely scenario involves a population bottleneck, migration, or founder effect [51]. Any reduction in effective population size would also produce a further relaxation of selective constraints as (nearly) neutral drift would predominate
You are suggesting the likelihood of genetic drift as “the most likely” explanation, despite the fact that increased codon usage bias is not a pattern associated with it (in fact, it’s the reverse). That’s called special pleading. Moving on, you then write:
It appears that deletion in this instance was one of the necessary factors involved in gene fusion. As such, Sdic is shorter than Cdic, and this is true also for the hominoid oncogene, TRE2, which is 200 residues less than one of its parents, USP32 [52]. This presents a problem in terms of explaining any accretion of cistron size with reference to the most naturally applicableevolutionary process
Why must the Sdic gene be longer? Cistron length in this case doesn’t seem to have anything to do with your own definition of a gain in exonic information (my emphasis):
Therefore, I have decided to define any gain in exonic information as: ‘‘The qualitative increase in operational capability and functional specificity with no resultant uncertainty of outcome
The logic in your Sdic argument leads to this conclusion: any novel adaptive function or capability acquired by the duplicated gene must involve an increase in cistron length. That doesn’t make sense, even by your own definition. All that effort you put into the alignment, for which you are so proud, still doesn’t support your argument at all. You are consistently confusing effort with results.

Robin · 20 January 2011

Atheistoclast said: Darwinism is destined to end up on the ash heap of failed pseudo-scientific ideologies. It is a case of when and not if.
HAHAHAHAHAHAHAHAHAHA!!! I soooo love those boastful, empty prophesies! They tickle my funny bone every time! Say oclast...you wouldn't want to join Dr. Dr. Boastful in his failed prophesies about "Darwinism" would you? Nah...I didn't think so. (chuckle)
If it were so sound, it would not be in a constant battle to defend its contentions.
Uhhh...what 'constant battle'? Evolutionary Theory is in no battle scientifically. That you seem to think your political rhetoric regarding the shaky ground on which Evolutionary Theory stands is some kind of "battle" is quite flattering, but ultimately without validity. You can whine all you wish from the fringe, but really - not a single soul in science takes anything from your remote corner as anything more than an annoying gnat buzz.
The evidence would be overwhelming.
Well...umm...the evidence is overwhelming. That no one has come along with a better explanation for the evidence that offers any kind of predictability, never mind that contradicts evolutionary explanations that currently provide perfectly solid predictability and utility with the evidence means your claim is nothing but smoke. Don't cough too much!
However, hardly anything of the naturalistic argument makes any real sense.
This from a fringe wingnut? LOL! Can you say irony? Yeah...I knew you could.

ben · 20 January 2011

Atheistoclast said:
ben said:
There is no tolerance of Creationists here, nor is there tolerance of intelligent design proponents here
What there is no tolerance for, is people claiming that non-science (creationism) and anti-science (ID) are in fact legitimate science. Start following the established rules of science and you will find that people here will stop attacking you for falsely claiming that your moronic superstitions are scientific.
Darwinism is destined to end up on the ash heap of failed pseudo-scientific ideologies. It is a case of when and not if. If it were so sound, it would not be in a constant battle to defend its contentions. The evidence would be overwhelming. However, hardly anything of the naturalistic argument makes any real sense.
Your reply is a complete non sequitur and has nothing to do with my comment to you; I'm not sure why you quoted me.

phantomreader42 · 20 January 2011

IBelieveInBearingFalseWitness said:
DS said: Richard, The IBIG fool has been banned. Please dump all his posts to the bathroom wall. There is still a special thread just for him at After the Bar Closes, that's where he belongs. Everyone else, Please don't respond to this raving lunatic on this thread. All he wants to do is derail the thread with his incessant whining about abiogenesis and other meaningless bullshit. I guess he just couldn't stand to see the atheist guy getting his ass handed to him.
I have never been banned here. Please don't call me a raving lunatic! When you can't respond to a post your answer is to call someone a raving lunatic.
Yes, you have. Almost a year ago. This has been pointed out repeatedly. Are you physically capable of telling the truth? Does jeebus like it when you lie?

Atheistoclast · 20 January 2011

How do you know this? You don't cite any research demonstrating it. For example, is there any enzyme activity level data for the Cdic protein with such a deletion? Furthermore, if the Cdic gene was initially duplicated, and the copy underwent the deletion, what reason is there to expect negative selection to occur? This is where your argument—such as it is—goes off the rails. Let’s assume, for the moment, that the deletion in the Cdic gene was not negatively selected against (which is what you seem to be saying, though conventional evolutionary theory predicts this anyway, so you get no points for originality).
Er....yes I do know. For one, I made the alignment and ,secondly, the deletion at the amino end is also mentioned in a paper cited in the text. Ranz, J.M.; Ponce, A.R.; Hartl, D.L.; Nurminsky, D. (2003) .Origin and evolution of a new gene expressed in the Drosophila sperm axoneme Genetica, 118, 233–244. The loss of the N-terminus meant Sdic could not function as a cytoplasmic dynein because it was unable to interact with dynactin. This meant that it was axonemal almost by default. This would have represented a deleterious development - at least initially.
You are suggesting the likelihood of genetic drift as “the most likely” explanation, despite the fact that increased codon usage bias is not a pattern associated with it (in fact, it’s the reverse). That’s called special pleading.
Genetic drift is strongest in small populations and so deleterious changes have a better chance of surviving. Codon usage bias can be influenced, by among other things, background selection. That is what Nurminsky and Hartl report in their response to Charlesworth & Charlesworth.
Why must the Sdic gene be longer? Cistron length in this case doesn’t seem to have anything to do with your own definition of a gain in exonic information (my emphasis):
No it does not. However, I wanted to point out that gene fusion does not usually result in longer translated products as some might think can happen. This begs the question as to how really long proteins evolved from smaller ones. However, exon shuffling (ectopic recombination) is a possible solution.
The logic in your Sdic argument leads to this conclusion: any novel adaptive function or capability acquired by the duplicated gene must involve an increase in cistron length. That doesn’t make sense, even by your own definition.
Not at all. This was a side remark I was making. Just another broadside at the Darwinian paradigm.
All that effort you put into the alignment, for which you are so proud, still doesn’t support your argument at all. You are consistently confusing effort with results.
The alignment clearly shows the bulk deletion at the N-terminus and the disabling of the 4th domain from the 5' end by a frameshift mutation. It is a peach.

IBelieveInGod · 20 January 2011

John Kwok said:
IBelieveInGod said: Creationists believe that God created various kinds of life, and those various kinds of life have changed and adapted through the years. That change and adaptation is backed by the evidence (microevolution) These changes do not include the evolution of new novel morphological structures.
Sorry IBelieveInNonsense, but the last time I checked, there are devout Christian scientists who accept that biological evolution is valid and is the means through which the Almighty has "created" life on earth: Francis Collins, Darrel Falk, Karl Giberson, Keith Miller, Ken Miller, Steve Matheson, Simon Conway Morris, and many, many others.
IBelieveInGod said: Evolutionists believe that all life evolved from an extremely simple organism or organisms. (macroevolution) Which would require the evolution of new novel morphological structures. Limbs with all the complexity of bones, cartilage, ligaments, tendons, muscles, nerves would have had to evolved, and that is just one example of a complex morphological structure that would have evolved. There is evidence of microevolution, but macroevolution is nothing more then conjecture, and assumption based on ones belief that evolution from common descent happened.
Typical creotard breathtaking inanity from you, IBelieveInNonsense, since your comments ignore the role of geneaology - or to be more precise, phylogeny - in helping to define the "paths" in which descent through modification - to use Darwin's original term for biological evolution - occurs through countless lineages of bacteria, fungi, protists, plants and animals, and has resulted in the present complexity and diversity of life on Planet Earth. The complexity that you speak of is due to accidents of history, not through Divine Intervention of any kind whatsoever, and moreover, as others have noted here, the very processes responsible for microevolution are also responsible for macroevolution (the creation of new species, or rather, in other words, lineage splitting).
Biological evolution (very broad term)? or biological evolution from common descent? where is your evidence that the complexity of limbs is due to accidents of history? Microevolution does not create new novel morphological structures, it only changes structures that already exist. I've already stated in the past that natural selection does not select for the future fitness of a mutation, so how would so many accidents (mutations) ultimately form a fully functioning limb with all of it's complexity?

Atheistoclast · 20 January 2011

For those of you who want to know the mechanism behind IDvolution I am proposing that it is case of "directed hypermutation" and artificial selection.

I will be presenting this hypothesis in another paper.

IBelieveInGod · 20 January 2011

phantomreader42 said:
IBelieveInBearingFalseWitness said:
DS said: Richard, The IBIG fool has been banned. Please dump all his posts to the bathroom wall. There is still a special thread just for him at After the Bar Closes, that's where he belongs. Everyone else, Please don't respond to this raving lunatic on this thread. All he wants to do is derail the thread with his incessant whining about abiogenesis and other meaningless bullshit. I guess he just couldn't stand to see the atheist guy getting his ass handed to him.
I have never been banned here. Please don't call me a raving lunatic! When you can't respond to a post your answer is to call someone a raving lunatic.
Yes, you have. Almost a year ago. This has been pointed out repeatedly. Are you physically capable of telling the truth? Does jeebus like it when you lie?
No I was never banned, my posts were sent to the bathroom wall, and then I continued to post on the bathroom wall, if I had been banned I would not have been able to still post in the threads, which I was still able to do. Maybe you even have trouble comprehending what it means to be banned. Talk about ignorant!

phantomreader42 · 20 January 2011

Atheistoclast babbled:
And yet, where is the evidence that all things can not evolve, where is the evidence that God is magically tinkering with everything under our noses?
It is not that things cannot change - it is a question of the extent to which they can without the intervention of something beyond the natural and observed order.
So, at precisely what point does change become impossible without the assistance of your imaginary friend? How did you determine this point? How do you identify it? How do you measure such change? What magical barrier allows a change on one side of this point, but prevents one on the other side? What evidence do you have to support this claim? What changes, specifically, exceed this magic limit you claim exists, and thus must have been initiated by the invisible sky tyrant, and where is your evidence of this? Of course, we all know that, like every creationist in history who's been asked these questions, you'll babble, you'll whine, you'll bluster, you'll lie, you'll try to change the subject, threaten anyone who dares question you with hellfire, screech about imaginary persecution, flee in abject terror, but no force in all the universe will induce you to even attempt a full answer to these questions. Because you know you can't support your bullshit. There is no magical barrier that separates "macro" from "micro". That only exists in your delusions.

OgreMkV · 20 January 2011

Atheistoclast said: For those of you who want to know the mechanism behind IDvolution I am proposing that it is case of "directed hypermutation" and artificial selection. I will be presenting this hypothesis in another paper.
Please describe, in detail, the difference (results not process) between artifical selection and natural selection. i.e how can you tell if a structure, gene, protein, or organism was devevloped through artificial or natural selection?

phantomreader42 · 20 January 2011

IBelieveInBearingFalseWitness said:
phantomreader42 said:
IBelieveInBearingFalseWitness said:
DS said: Richard, The IBIG fool has been banned. Please dump all his posts to the bathroom wall. There is still a special thread just for him at After the Bar Closes, that's where he belongs. Everyone else, Please don't respond to this raving lunatic on this thread. All he wants to do is derail the thread with his incessant whining about abiogenesis and other meaningless bullshit. I guess he just couldn't stand to see the atheist guy getting his ass handed to him.
I have never been banned here. Please don't call me a raving lunatic! When you can't respond to a post your answer is to call someone a raving lunatic.
Yes, you have. Almost a year ago. This has been pointed out repeatedly. Are you physically capable of telling the truth? Does jeebus like it when you lie?
No I was never banned, my posts were sent to the bathroom wall, and then I continued to post on the bathroom wall, if I had been banned I would not have been able to still post in the threads, which I was still able to do. Maybe you even have trouble comprehending what it means to be banned. Talk about ignorant!
As usual, the very concept of telling the truth is utterly alien to you. Fuck off. Begone from this place, foul inhuman thing that speaks only lies, celebrates torture, and refuses to lift a finger to help those in need. Depart, ye that work iniquity.

DS · 20 January 2011

Atheistoclast said: For those of you who want to know the mechanism behind IDvolution I am proposing that it is case of "directed hypermutation" and artificial selection. I will be presenting this hypothesis in another paper.
Really? Would "hypermutation" include gene duplication? Exactly how would this proposed mechanism overthrow "Darwinism"? Is it a "naturalistic" explanation? Is there some "intelligence" required in order to produce the "information". How is it "directed"? For what reason is it "directed"? To what goal is it "directed"? Why would it need to be "directed" if random mutations would eventually produce the same thing anyway? At what journal will it be "directed"? Where can scathing rebuttals be "directed"? In what sense is the selection "artificial"? Why does the selection have to be "artificial"? Why couldn't natural selection accomplish the exact same thing? Is the journal you are submitting to "artificial" as well? Look dude, you obviously don't understand the concept of duplicated genes being removed from functional constraint. Go look it up and get back to Dave when you understand it. Or just look it up and get lost. You haven't got a broken leg to stand on. I predict the imminent demise of all forms of intelligent design. It's only a matter of time and not much at that. Dover = Waterloo! 111111111! Just another broadside at the insanity paradigm.

John Vanko · 20 January 2011

IBIG, like John Freshwater, can never admit he is wrong.

With Jesus in their hearts (and Jesus is without sin), they can do no wrong.

The Second Law of Creationist Dynamics: "The correctness of Creationists cannot decrease. It can only remain constant or increase." (And it can never go below zero.)

Could IBIG BE John Freshwater? Both seem to have had an awful lot of time on their hands last year!

Dave Wisker · 20 January 2011

Atheistoclas writes:
Er.…yes I do know. For one, I made the alignment and ,secondly, the deletion at the amino end is also mentioned in a paper cited in the text. Ranz, J.M.; Ponce, A.R.; Hartl, D.L.; Nurminsky, D. (2003) .Origin and evolution of a new gene expressed in the Drosophila sperm axoneme Genetica, 118, 233–244.
Not the deletion, the fact it would have been selected against.
The loss of the N-terminus meant Sdic could not function as a cytoplasmic dynein because it was unable to interact with dynactin. This meant that it was axonemal almost by default. This would have represented a deleterious development - at least initially.
Please show how, with a perfectly functional copy of a Cdic gene present performing the cytoplasmic dein function, that the deletion in the other copy would significantly reduce the fitness of the organism, if at all. You have not thought your argument through at all.
Codon usage bias can be influenced, by among other things, background selection. That is what Nurminsky and Hartl report in their response to Charlesworth & Charlesworth.
Yes, background selection reduces codon usage bias, which still leaves you with the task of trying to explain the sharply increased codon usage bias for Sdic.
The alignment clearly shows the bulk deletion at the N-terminus and the disabling of the 4th domain from the 5’ end by a frameshift mutation. It is a peach.
For which you have given no reason to expect was negatively selected against, considering the function was covered by the other copy.

Dave Wisker · 20 January 2011

DS said:
Look dude, you obviously don't understand the concept of duplicated genes being removed from functional constraint. Go look it up and get back to Dave when you understand it. Or just look it up and get lost. You haven't got a broken leg to stand on.
This is pathetic.

DS · 20 January 2011

Shoot, I forgot. ID = satanism. 111!

John Vanko · 20 January 2011

IBelieveInGod said to phantomreader42: "No I was never banned, my posts were sent to the bathroom wall, and then I continued to post on the bathroom wall, ... Maybe you even have trouble comprehending what it means to be banned. Talk about ignorant!"
IBelieveInGod said to Stanton: I beg to differ, I was never restricted to the bathroom, … You are LIAR!!!
The evidence clearly shows that IBIG's posts were indeed 'restricted' or 'banned', pick the word you like best, to the Bathroom Wall on Feb. 8th, 2010, from ‘Primordial Soup’ Ousted from the Origin of Life?!? initiated by Dave Thomas Feb. 3rd. Go look at panel 6. And if you are not as good as your words, then what good are you? Just like a Creationist.

John Kwok · 20 January 2011

DS said: Shoot, I forgot. ID = satanism. 111!
Absolutely. My "pal" Bill Dembski - who owes the Dover Area School District board a refund of $20,000, an apology to Eric Pianka for false accusation of him as a potential bioterrorist, and $10,000 in expensive Leica rangefinder camera equipment - thinks he is "Lying for Jesus", when his real master - judging from his past history of misconduct - truly is Lucifer (or rather, Satan).

John Kwok · 20 January 2011

A correction, sorry about this -
DS said: Shoot, I forgot. ID = satanism. 111!
Absolutely. My “pal” Bill Dembski - who owes the Dover Area School District board a refund of $20,000, an apology to Eric Pianka for false accusation of him as a potential bioterrorist, and $10,000 in expensive Leica rangefinder camera equipment to me (or the equivalent sum as a donation to my high school alma mater in support of its Intel Prize-winning Intel Science Talent Search student research - thinks he is “Lying for Jesus”, when his real master - judging from his past history of misconduct - truly is Lucifer (or rather, Satan).

John Kwok · 20 January 2011

IBelieveInGod said:
John Kwok said:
IBelieveInGod said: Creationists believe that God created various kinds of life, and those various kinds of life have changed and adapted through the years. That change and adaptation is backed by the evidence (microevolution) These changes do not include the evolution of new novel morphological structures.
Sorry IBelieveInNonsense, but the last time I checked, there are devout Christian scientists who accept that biological evolution is valid and is the means through which the Almighty has "created" life on earth: Francis Collins, Darrel Falk, Karl Giberson, Keith Miller, Ken Miller, Steve Matheson, Simon Conway Morris, and many, many others.
IBelieveInGod said: Evolutionists believe that all life evolved from an extremely simple organism or organisms. (macroevolution) Which would require the evolution of new novel morphological structures. Limbs with all the complexity of bones, cartilage, ligaments, tendons, muscles, nerves would have had to evolved, and that is just one example of a complex morphological structure that would have evolved. There is evidence of microevolution, but macroevolution is nothing more then conjecture, and assumption based on ones belief that evolution from common descent happened.
Typical creotard breathtaking inanity from you, IBelieveInNonsense, since your comments ignore the role of geneaology - or to be more precise, phylogeny - in helping to define the "paths" in which descent through modification - to use Darwin's original term for biological evolution - occurs through countless lineages of bacteria, fungi, protists, plants and animals, and has resulted in the present complexity and diversity of life on Planet Earth. The complexity that you speak of is due to accidents of history, not through Divine Intervention of any kind whatsoever, and moreover, as others have noted here, the very processes responsible for microevolution are also responsible for macroevolution (the creation of new species, or rather, in other words, lineage splitting).
Biological evolution (very broad term)? or biological evolution from common descent? where is your evidence that the complexity of limbs is due to accidents of history? Microevolution does not create new novel morphological structures, it only changes structures that already exist. I've already stated in the past that natural selection does not select for the future fitness of a mutation, so how would so many accidents (mutations) ultimately form a fully functioning limb with all of it's complexity?
Biological evolution IS common descent, or as Darwin termed it, "Descent With Modification". The rest of your latest breathtaking inanity merely demonstrates your woeful ignorance and poor understanding as to what are the processes that are responsible for biological evolution.

Mike Elzinga · 20 January 2011

John Kwok said: Biological evolution IS common descent, or as Darwin termed it, "Descent With Modification". The rest of your latest breathtaking inanity merely demonstrates your woeful ignorance and poor understanding as to what are the processes that are responsible for biological evolution.
One doesn’t have to go all the way to living organisms to see this.

IBelieveInGod · 20 January 2011

John Kwok said:
IBelieveInGod said:
John Kwok said:
IBelieveInGod said: Creationists believe that God created various kinds of life, and those various kinds of life have changed and adapted through the years. That change and adaptation is backed by the evidence (microevolution) These changes do not include the evolution of new novel morphological structures.
Sorry IBelieveInNonsense, but the last time I checked, there are devout Christian scientists who accept that biological evolution is valid and is the means through which the Almighty has "created" life on earth: Francis Collins, Darrel Falk, Karl Giberson, Keith Miller, Ken Miller, Steve Matheson, Simon Conway Morris, and many, many others.
IBelieveInGod said: Evolutionists believe that all life evolved from an extremely simple organism or organisms. (macroevolution) Which would require the evolution of new novel morphological structures. Limbs with all the complexity of bones, cartilage, ligaments, tendons, muscles, nerves would have had to evolved, and that is just one example of a complex morphological structure that would have evolved. There is evidence of microevolution, but macroevolution is nothing more then conjecture, and assumption based on ones belief that evolution from common descent happened.
Typical creotard breathtaking inanity from you, IBelieveInNonsense, since your comments ignore the role of geneaology - or to be more precise, phylogeny - in helping to define the "paths" in which descent through modification - to use Darwin's original term for biological evolution - occurs through countless lineages of bacteria, fungi, protists, plants and animals, and has resulted in the present complexity and diversity of life on Planet Earth. The complexity that you speak of is due to accidents of history, not through Divine Intervention of any kind whatsoever, and moreover, as others have noted here, the very processes responsible for microevolution are also responsible for macroevolution (the creation of new species, or rather, in other words, lineage splitting).
Biological evolution (very broad term)? or biological evolution from common descent? where is your evidence that the complexity of limbs is due to accidents of history? Microevolution does not create new novel morphological structures, it only changes structures that already exist. I've already stated in the past that natural selection does not select for the future fitness of a mutation, so how would so many accidents (mutations) ultimately form a fully functioning limb with all of it's complexity?
Biological evolution IS common descent, or as Darwin termed it, "Descent With Modification". The rest of your latest breathtaking inanity merely demonstrates your woeful ignorance and poor understanding as to what are the processes that are responsible for biological evolution.
When Charles Darwin published The Origin of Species in 1859, it was already known that existing species can change over time. This is the basis of artificial breeding, which had been practiced for thousands of years. Darwin and his contemporaries were also familiar enough with the fossil record to know that major changes in living things had occurred over geological time. Darwin's theory was that a process analogous to artificial breeding also occurs in nature; he called that process natural selection. Darwin's theory was also that changes in existing species due primarily to natural selection could, if given enough time, produce the major changes we see in the fossil record. After Darwin, the first phenomenon (changes within an existing species or gene pool) was named "microevolution." There is abundant evidence that changes can occur within existing species, both domestic and wild, so microevolution is uncontroversial. The second phenomenon (large-scale changes over geological time) was named "macroevolution," and Darwin's theory that the processes of the former can account for the latter was controversial right from the start. Many biologists during and after Darwin's lifetime have questioned whether the natural counterpart of domestic breeding could do what domestic breeding has never done -- namely, produce new species, organs, and body plans. In the first few decades of the twentieth century, skepticism over this aspect of evolution was so strong that Darwin's theory went into eclipse. (See Chapter 9 of Peter Bowler's Evolution: The History of an Idea, University of California Press, revised edition, 1989). In the 1930s, "neo-Darwinists" proposed that genetic mutations (of which Darwin was unaware) could solve the problem. Although the vast majority of mutations are harmful (and thus cannot be favored by natural selection), in rare instances one may benefit an organism. For example, genetic mutations account for some cases of antibiotic resistance in bacteria; if an organism is in the presence of the antibiotic, such a mutation is beneficial. All known beneficial mutations, however, affect only an organism's biochemistry; Darwinian evolution requires large-scale changes in morphology, or anatomy. Midway through the twentieth century, some Darwinian geneticists suggested that occasional "macromutations" might produce the large-scale morphological changes needed by Darwin's theory. Unfortunately, all known morphological mutations are harmful, and the larger their effects the more harmful they are. Scientific critics of macromutations took to calling this the "hopeful monster" hypothesis. (See Chapter 12 of Bowler's book.) The scientific controversy over whether processes observable within existing species and gene pools (microevolution) can account for large-scale changes over geological time (macroevolution) continues to this day. Here are a few examples of peer- reviewed scientific articles that have referred to it just in the last few years: • David L. Stern, "Perspective: Evolutionary Developmental Biology and the Problem of Variation," Evolution 54 (2000): 1079-1091. "One of the oldest problems in evolutionary biology remains largely unsolved... Historically, the neo-Darwinian synthesizers stressed the predominance of micromutations in evolution, whereas others noted the similarities between some dramatic mutations and evolutionary transitions to argue for macromutationism." • Robert L. Carroll, "Towards a new evolutionary synthesis," Trends in Ecology and Evolution, 15 (January, 2000): 27. "Large-scale evolutionary phenomena cannot be understood solely on the basis of extrapolation from processes observed at the level of modern populations and species.” • Andrew M. Simons, "The continuity of microevolution and macroevolution," Journal of Evolutionary Biology 15 (2002): 688-701. "A persistent debate in evolutionary biology is one over the continuity of microevolution and macroevolution -- whether macroevolutionary trends are governed by the principles of microevolution." It should be noted that all of the scientists quoted above are believers in Darwinian evolution, and that all of them think the controversy will eventually be resolved within the framework of that theory. Stern, for example, believes that new developmental studies of gene function will provide "the current missing link." (p. 1079) The important point here is that the controversy has not yet been resolved, precisely because the evidence needed to resolve it is still lacking. It is important for students to know what the evidence does or does not show -- not just what some scientists hope the evidence will eventually show. Since the controversy over microevolution and macroevolution is at the heart of Darwin's theory, and since evolutionary theory is so influential in modern biology, it is a disservice to students for biology curricula to ignore the controversy entirely. Furthermore, since the scientific evidence needed to settle the controversy is still lacking, it is inaccurate to give students the impression that the controversy has been resolved and that all scientists have reached a consensus on the issue. http://www.discovery.org/scripts/viewDB/filesDB-download.php?id=118

stevaroni · 20 January 2011

DS said: Shoot, I forgot. ID = satanism. 111!
Well... Logically, I guess that you could say that science doesn't really hold that there's much of a case for God or Satan (or Ra, Vishnu, Xenu or Cthulu, for that matter). And... since the only people who do fervently believe in Satan incarnate are Christians... And... since the ID movement is driven pretty exclusively by hard-core Christians who fervently cling to the literal Old Testament... Well, DS, you might just have a point. (By the way, why are so many Christians so hard-over on the Old testament? In the Bible I've got, Christ doesn't even show up till page 602. Shouldn't someone who puts so much emphasis on things that happened 2000 years before Jesus was born call properly himself a PreChristian, or something?)

eric · 20 January 2011

Atheistoclast said: For those of you who want to know the mechanism behind IDvolution I am proposing that it is case of "directed hypermutation" and artificial selection.
Selection cannot produce variation, only cull it. That's true regardless of whether it's natural or artificial (or sexual, or any other sort). So, even if you think we are a product of artificial selection, your methodolgy must accept that biochemical processes can produce all the variation we see. That means biochemical processes can produce different species. You also ultimately have to take a position on whether the intelligent directors/selectors in your explanation can break the laws of physics or not. If they cannot, then any genetic manipulation open to them can hypothetically also be done by natural means without them (just with lower probability). OTOH if they can break the laws of physics, then you aren't really proposing a scientific theory at all, you're proposing a religious one.

Dale Husband · 20 January 2011

Look at this: http://pandasthumb.org/archives/2010/02/primordial-soup-1.html#comment-205876

Oops - got a little carried away there After posting this: STOP! MOVE ALONG - JUST A LITTLE TROLL CONTROL As you can see, I’ve sent IBIG to the Bathroom Wall. Engage with him there all you like! But not here, por favor. I gave him a chance to define what he meant by “Creation”, and he evaded with RNA/whatnot. For crying out loud - his handle was “I BELIEVE IN GOD”. For someone like that to pussyfoot with the definition of ‘creation’ is disingenuous. Thus, to the Bathroom Wall with him. Sorry about the Collateral Damage - I hope you’ll understand. And, it’s not like your comments get Disappeared - they just get a new room, with a cheaper wallpaper that’s got some cracks and pee stains. Cheers, Dave

I was trying to send yet another of IBIG’s inane meanderings to the Bathroom Wall, when I apparently selected the whole raft of comments by accident. And wouldn’t you know, while there’s a way to send the raft to the Bathroom Wall”, there’s no way to fetch them back. My apologies. Consider it a scenery change for the discussion with IBIG. Cheers, Dave I think Dave meant he sent IBIG's posts to the Bathroom Wall, but not IBIG himself. Of course, the fact that IBIG continued to post for many months pointless quarrels on the BW instead of either going away completely or trying to understand evolution and science in general better only proves my point about his idiocy.

IBelieveInGod · 20 January 2011

Dale Husband said: Look at this: http://pandasthumb.org/archives/2010/02/primordial-soup-1.html#comment-205876

Oops - got a little carried away there After posting this: STOP! MOVE ALONG - JUST A LITTLE TROLL CONTROL As you can see, I’ve sent IBIG to the Bathroom Wall. Engage with him there all you like! But not here, por favor. I gave him a chance to define what he meant by “Creation”, and he evaded with RNA/whatnot. For crying out loud - his handle was “I BELIEVE IN GOD”. For someone like that to pussyfoot with the definition of ‘creation’ is disingenuous. Thus, to the Bathroom Wall with him. Sorry about the Collateral Damage - I hope you’ll understand. And, it’s not like your comments get Disappeared - they just get a new room, with a cheaper wallpaper that’s got some cracks and pee stains. Cheers, Dave

I was trying to send yet another of IBIG’s inane meanderings to the Bathroom Wall, when I apparently selected the whole raft of comments by accident. And wouldn’t you know, while there’s a way to send the raft to the Bathroom Wall”, there’s no way to fetch them back. My apologies. Consider it a scenery change for the discussion with IBIG. Cheers, Dave I think Dave meant he sent IBIG's posts to the Bathroom Wall, but not IBIG himself. Of course, the fact that IBIG continued to post for many months pointless quarrels on the BW instead of either going away completely or trying to understand evolution and science in general better only proves my point about his idiocy.
So, you admit that I wasn't banned? So, explain to me if my posts were so idiotic, so inane, so pointless why did so many even respond to them? Wouldn't it be idiotic to respond to pointless, inane, idiotic posts?

Dale Husband · 20 January 2011

IBelieveInGod said: [A lot of old news from the Discovery Institute, along with fallacious crap.]
Hype about the controversies among biologists does not detract from what nearly all of them are certain about. Just as arguments about dark matter and dark energy does not discredit the Big Bang theory.

Dale Husband · 20 January 2011

IBelieveInGod said: So, you admit that I wasn't banned? So, explain to me if my posts were so idiotic, so inane, so pointless why did so many even respond to them? Wouldn't it be idiotic to respond to pointless, inane, idiotic posts?
The same reason I would laugh at police reports of dumb criminals, and comment on them. That doesn't make me a dumb criminal too. You provide a lot of entertainment with your delusions, but nothing else of substance.

OgreMkV · 20 January 2011

OK, IBIG, I'll ask you the same question that 'clast hasn't responded to.

What's the different (result, not process) between artificial selection and natural selection?

(i.e. what 'thing' will tell us whether a gene, organism, protein, or system evolved via artificial or natural selection? and why?)

Be careful... it is a trap... I doubt you'll understand it though.

BTW: There's another question for you at ATBC.

IBelieveInGod · 20 January 2011

Maybe I haven't explained myself very well.

Microevolution (best described as adaptation) which can be observed in the laboratory and in nature, ie different breeds of dogs, birds, etc...

Macroevolution (best described as speciation and the origin of divisions within the taxonomic hierarchy, and the development of new complex novel morphological structures, organs, etc...) this has never been observed in the laboratory or in nature, this is where it ceases to be science and because a type of belief system.

stevaroni · 20 January 2011

IBelieveInGod said: So, you admit that I wasn't banned?
Flushed. Yeah, flushed is a pretty good word for it.

OgreMkV · 20 January 2011

IBelieveInGod said: Maybe I haven't explained myself very well. Microevolution (best described as adaptation) which can be observed in the laboratory and in nature, ie different breeds of dogs, birds, etc... Macroevolution (best described as speciation and the origin of divisions within the taxonomic hierarchy, and the development of new complex novel morphological structures, organs, etc...) this has never been observed in the laboratory or in nature, this is where it ceases to be science and because a type of belief system.
IBIG, do you or do you not want to learn? An honest person would admit (to themselves at the least) that they don't want to learn and then stop trying to convince others who know better than them. I am still willing to teach you science. You still refuse to accept instruction. Until you have examined all the evidence, you may no longer use that strawman argument. I will further point out how much of a hypocrite you are. No one has ever observed an electron. No one has ever observed a memory block changing state based on computer coded instructions. No one has ever observed voice or data traveling down fiber optic lines. You use these tools daily and yet you are convinced that they do not work. Admit that you are a hypocrite or stop using the argument.

Dale Husband · 20 January 2011

IBelieveInGod said: Maybe I haven't explained myself very well. Microevolution (best described as adaptation) which can be observed in the laboratory and in nature, ie different breeds of dogs, birds, etc... Macroevolution (best described as speciation and the origin of divisions within the taxonomic hierarchy, and the development of new complex novel morphological structures, organs, etc...) this has never been observed in the laboratory or in nature, this is where it ceases to be science and because a type of belief system.
And where do you draw the line between the two? This is where the fallacy of "moving the goalposts" becomes so useful for Creationists.

Atheistoclast · 20 January 2011

OgreMkV said:
Atheistoclast said: For those of you who want to know the mechanism behind IDvolution I am proposing that it is case of "directed hypermutation" and artificial selection. I will be presenting this hypothesis in another paper.
Please describe, in detail, the difference (results not process) between artifical selection and natural selection. i.e how can you tell if a structure, gene, protein, or organism was devevloped through artificial or natural selection?
I'm afraid you will have to wait until the paper is published. But artificial selection and a process known as "hypermutation" (as with somatic immune cells) can make profound changes in a very short space of time. The point is you don't need to "poof" new genetic information into existence - you just need to be able to manipulate the existing imperfection (though near perfected state) of the replication system.

OgreMkV · 20 January 2011

Atheistoclast said:
OgreMkV said:
Atheistoclast said: For those of you who want to know the mechanism behind IDvolution I am proposing that it is case of "directed hypermutation" and artificial selection. I will be presenting this hypothesis in another paper.
Please describe, in detail, the difference (results not process) between artifical selection and natural selection. i.e how can you tell if a structure, gene, protein, or organism was devevloped through artificial or natural selection?
I'm afraid you will have to wait until the paper is published. But artificial selection and a process known as "hypermutation" (as with somatic immune cells) can make profound changes in a very short space of time. The point is you don't need to "poof" new genetic information into existence - you just need to be able to manipulate the existing imperfection (though near perfected state) of the replication system.
Interesting, because no scientist 'poofs' "new genetic information". There are several well defined processes for new genetic information. Gene duplication is one of them. I'm afraid that you're are attacking a strawman.

nmgirl · 20 January 2011

ibig, I actually have a question for you: If everything on earth is specially created by god, why do the progressions we see if fossil records occur? Does God have a calendar and tuesday is cartaligineous (sp) fish, then firday the 13th of october is sharks and then for New Year, I'll create a bony fish. i mean since you know the mind of god, how does he keep track?

eric · 20 January 2011

IBelieveInGod said: Maybe I haven't explained myself very well.
You've explained yourself very well. You just don't understand why you're wrong. And when presented with data contrary to your beliefs, you ignore it. Creationists assert that the mechanism for micro cannot accomplish the macro. But you have never explained why. On a biochemical scale such an assertion doesn't even make sense, as there is no possible way a mutation in the genetic code could "know" whether the result will be a dramatic change in development with positive value in the future organism's environment, a dramatic change in development with negative value in the future organism's environment, or no change in development at all. Is a duplication of sequence L to LL physically possible or physically impossible? Creationists need to know the developmental outcome before they make that assesment. But biochemical machinery never knows the outcome. But that isn't your biggest problem. You have not even defined the limit in any consistent manner. Evidently, the genetic difference between chimps and humans could not possibly be bridged, even though you accept that larger genetic differences in other family groups could be bridged. And it is transparently obvious to everyone involved that this irrational inconsistency arises not out of some scientific hypothesis about mutational mechanisms, but merely because you want to keep the biblical concept of kinds intact.
Macroevolution (best described as speciation and the origin of divisions within the taxonomic hierarchy, and the development of new complex novel morphological structures, organs, etc...) this has never been observed in the laboratory or in nature...
It has been observed. Here are many examples. We have pointed these examples out to you before. You simply pretend they don't exist.
this is where it ceases to be science and because a type of belief system.
You've got it exactly backwards. Science is when an observed speciation is taken as proof that speciation can occur. Religious belief is when you ignore or rationalize away all directly observed speciations because you think some holy book says they don't happen.

John Kwok · 20 January 2011

Oh you did, but you're merely demonstrating just how breathtakingly inane your observations are IDiot:
IBelieveInGod said: Maybe I haven't explained myself very well. Microevolution (best described as adaptation) which can be observed in the laboratory and in nature, ie different breeds of dogs, birds, etc... Macroevolution (best described as speciation and the origin of divisions within the taxonomic hierarchy, and the development of new complex novel morphological structures, organs, etc...) this has never been observed in the laboratory or in nature, this is where it ceases to be science and because a type of belief system.

OgreMkV · 20 January 2011

eric said: Creationists assert that the mechanism for micro cannot accomplish the macro. But you have never explained why. On a biochemical scale such an assertion doesn't even make sense, as there is no possible way a mutation in the genetic code could "know" whether the result will be a dramatic change in development with positive value in the future organism's environment, a dramatic change in development with negative value in the future organism's environment, or no change in development at all. Is a duplication of sequence L to LL physically possible or physically impossible? Creationists need to know the developmental outcome before they make that assesment. But biochemical machinery never knows the outcome. But that isn't your biggest problem. You have not even defined the limit in any consistent manner. Evidently, the genetic difference between chimps and humans could not possibly be bridged, even though you accept that larger genetic differences in other family groups could be bridged. And it is transparently obvious to everyone involved that this irrational inconsistency arises not out of some scientific hypothesis about mutational mechanisms, but merely because you want to keep the biblical concept of kinds intact.
Macroevolution (best described as speciation and the origin of divisions within the taxonomic hierarchy, and the development of new complex novel morphological structures, organs, etc...) this has never been observed in the laboratory or in nature...
It has been observed. Here are many examples. We have pointed these examples out to you before. You simply pretend they don't exist.
That bolded bit is the most brilliant reasoning I've ever heard. Yes, IBIG, please explain why the anatomical spectrum in Canis familaris is so much larger than in the rest of the entire order of carnivora (excluding that one species).

Dale Husband · 20 January 2011

Atheistoclast said: I'm afraid you will have to wait until the paper is published. But artificial selection and a process known as "hypermutation" (as with somatic immune cells) can make profound changes in a very short space of time. The point is you don't need to "poof" new genetic information into existence - you just need to be able to manipulate the existing imperfection (though near perfected state) of the replication system.
I thought you said earlier that "Darwinism" was going to be overthrown. Now you affirm that evolution can happen. Make up your mind!

eric · 20 January 2011

OgreMkV said: That bolded bit is the most brilliant reasoning I've ever heard.
Thank you. :)
Yes, IBIG, please explain why the anatomical spectrum in Canis familaris is so much larger than in the rest of the entire order of carnivora (excluding that one species).
I want to address a bad response before it crops up, because I think there's about a 90% likelihood that IBIG will try and use it. The fact that dogs are bred by people provides no answer to the question of how such a wide variation could arise genetically. And that is the micro/macrro issue: could mutations that lead to such wide developmental variations arise? Now, we humans did determine which dogs bred with which. But we did not introduce the variation into the dogs, we merely worked with what nature handed us. So the variation in dog genetics must've come from nature. And it is a very wide variation. And it only took maybe 15,00-20,000 years...a finger snap in terms of geological time.

DS · 20 January 2011

In all of the years that IBIGOT has been trolling here, he has utterly failed to convince even one single person of one single thing. He is consistently and obstinately wrong about every single thing he states and what is worse, he refuses to ever admit it.

I strongly recommend that no one respond to him anywhere but the bathroom wall. The jerk already has his own thread at ATBC, where he has similarly failed to convince anyone of anything. Obviously he only comes here for attention, don't give it to him. If the administrators of this site are unwilling or unable to ban him permanently, we can effectively do it ourselves.

OgreMkV · 20 January 2011

eric said:
OgreMkV said: That bolded bit is the most brilliant reasoning I've ever heard.
Thank you. :)
Yes, IBIG, please explain why the anatomical spectrum in Canis familaris is so much larger than in the rest of the entire order of carnivora (excluding that one species).
I want to address a bad response before it crops up, because I think there's about a 90% likelihood that IBIG will try and use it. The fact that dogs are bred by people provides no answer to the question of how such a wide variation could arise genetically. And that is the micro/macrro issue: could mutations that lead to such wide developmental variations arise? Now, we humans did determine which dogs bred with which. But we did not introduce the variation into the dogs, we merely worked with what nature handed us. So the variation in dog genetics must've come from nature. And it is a very wide variation. And it only took maybe 15,00-20,000 years...a finger snap in terms of geological time.
This is exactly why 'clast CANNOT do what he says he's doing. He cannot differentiate between natural selection and artificial selection. In fact, they are exactly the same thing and it is only because humans have given them two different names is there any difference at all. 'clast, I do hope you send me a freebie of your paper. I'm sure not paying for it. I'd gladly be one of your 'peer-reviewers' though... even for free.

Atheistoclast · 20 January 2011

OgreMkV said:
Atheistoclast said:
OgreMkV said:
Atheistoclast said: For those of you who want to know the mechanism behind IDvolution I am proposing that it is case of "directed hypermutation" and artificial selection. I will be presenting this hypothesis in another paper.
Please describe, in detail, the difference (results not process) between artifical selection and natural selection. i.e how can you tell if a structure, gene, protein, or organism was devevloped through artificial or natural selection?
I'm afraid you will have to wait until the paper is published. But artificial selection and a process known as "hypermutation" (as with somatic immune cells) can make profound changes in a very short space of time. The point is you don't need to "poof" new genetic information into existence - you just need to be able to manipulate the existing imperfection (though near perfected state) of the replication system.
Interesting, because no scientist 'poofs' "new genetic information". There are several well defined processes for new genetic information. Gene duplication is one of them. I'm afraid that you're are attacking a strawman.
I did *NOT* say you need to poof new information into being. Evidently you have a problem with reading comprehension.But you cannot expect a blind process like gene duplication and natural selection to produce new information: My paper clearly shows that this is not the case. At most, duplication can serve to help modify or optimize existing information - not to create anything new.

OgreMkV · 20 January 2011

'clast... define information in this context.

Atheistoclast · 20 January 2011

Dale Husband said:
Atheistoclast said: I'm afraid you will have to wait until the paper is published. But artificial selection and a process known as "hypermutation" (as with somatic immune cells) can make profound changes in a very short space of time. The point is you don't need to "poof" new genetic information into existence - you just need to be able to manipulate the existing imperfection (though near perfected state) of the replication system.
I thought you said earlier that "Darwinism" was going to be overthrown. Now you affirm that evolution can happen. Make up your mind!
You fail to understand that *artificial* selection, or any kind of directed evolution, is essentially intelligent design. Once you allow for a supervisory element into the equation you are arguing against a naturalistic origination.

John Vanko · 20 January 2011

It sure worked with Kris.

Drove him insane!

OgreMkV · 20 January 2011

Atheistoclast said:
Dale Husband said:
Atheistoclast said: I'm afraid you will have to wait until the paper is published. But artificial selection and a process known as "hypermutation" (as with somatic immune cells) can make profound changes in a very short space of time. The point is you don't need to "poof" new genetic information into existence - you just need to be able to manipulate the existing imperfection (though near perfected state) of the replication system.
I thought you said earlier that "Darwinism" was going to be overthrown. Now you affirm that evolution can happen. Make up your mind!
You fail to understand that *artificial* selection, or any kind of directed evolution, is essentially intelligent design. Once you allow for a supervisory element into the equation you are arguing against a naturalistic origination.
I note that in several replies... other than saying "Wait for my paper", you have utterly failed to convince anyone that there even is a difference between the two forms of selection. The simple reason is that you cannot. Please, explain to me in detail, how farmer John 'designed' his high milk producing Holsteins. If you do not explain exactly how farmer John generated the mutations in the cows' genome, then you will have failed to convince anyone that artificial selection is the same as design.

John Vanko · 20 January 2011

(Sorry, forgot the reference.)
DS said about IBIG: ... If the administrators of this site are unwilling or unable to ban him permanently, we can effectively do it ourselves.
It sure worked with Kris. Drove him insane!

mrg · 20 January 2011

DS said: If the administrators of this site are unwilling or unable to ban him permanently, we can effectively do it ourselves.
I doubt it. Some folks like to bait trolls as much as trolls like to bait them -- sort of like a two-way shooting gallery. Both sides declare victory; since there's nothing to it but exchanges of hot air, there's nothing to stop them from doing so. Trolls get fed, guaranteed. I've accepted it. I've learned to glance at troll postings and move on. They're just meaningless arrangements of buzzphrases, amounting to no more than monotonous sneering. I could collect the buzzphrases, cook up a simple program to mix and match them, and they'd sound the same.

John Vanko · 20 January 2011

"But troll bashing, like dwarf bowling, is wicked fun, more so after a few drinks!"

JASONMITCHELL · 20 January 2011

IBelieveInGod said:
John Kwok said:
IBelieveInGod said: Creationists believe that God created various kinds of life, and those various kinds of life have changed and adapted through the years. That change and adaptation is backed by the evidence (microevolution) These changes do not include the evolution of new novel morphological structures.
Sorry IBelieveInNonsense, but the last time I checked, there are devout Christian scientists who accept that biological evolution is valid and is the means through which the Almighty has "created" life on earth: Francis Collins, Darrel Falk, Karl Giberson, Keith Miller, Ken Miller, Steve Matheson, Simon Conway Morris, and many, many others.
IBelieveInGod said: Evolutionists believe that all life evolved from an extremely simple organism or organisms. (macroevolution) Which would require the evolution of new novel morphological structures. Limbs with all the complexity of bones, cartilage, ligaments, tendons, muscles, nerves would have had to evolved, and that is just one example of a complex morphological structure that would have evolved. There is evidence of microevolution, but macroevolution is nothing more then conjecture, and assumption based on ones belief that evolution from common descent happened.
Typical creotard breathtaking inanity from you, IBelieveInNonsense, since your comments ignore the role of geneaology - or to be more precise, phylogeny - in helping to define the "paths" in which descent through modification - to use Darwin's original term for biological evolution - occurs through countless lineages of bacteria, fungi, protists, plants and animals, and has resulted in the present complexity and diversity of life on Planet Earth. The complexity that you speak of is due to accidents of history, not through Divine Intervention of any kind whatsoever, and moreover, as others have noted here, the very processes responsible for microevolution are also responsible for macroevolution (the creation of new species, or rather, in other words, lineage splitting).
Biological evolution (very broad term)? or biological evolution from common descent? where is your evidence that the complexity of limbs is due to accidents of history? Microevolution does not create new novel morphological structures, it only changes structures that already exist. I've already stated in the past that natural selection does not select for the future fitness of a mutation, so how would so many accidents (mutations) ultimately form a fully functioning limb with all of it's complexity?
are you saying that you accept that peeple can walk 100 feet but not 100 yards (or given enough time) 100 miles? THERE IS NO DIFFERENCE between "micro"evolution and "macro"evolution other than scale

eric · 20 January 2011

Atheistoclast said: You fail to understand that *artificial* selection, or any kind of directed evolution, is essentially intelligent design. Once you allow for a supervisory element into the equation you are arguing against a naturalistic origination.
Pure baloney. If the intelligence operates according to the laws of physics, then nature can do whatever it can do and a "naturalistic origin" is entirely possible. At that point, you have kicked the legs out from underneath your own 'its impossible' argument and are left with the much weaker claim that an unintelligent origin and the evolution of complex traits and species is entirely physically possible - you just think it's improbable. OTOH if you claim that your intelligent operator works outside the laws of physics, your explanation is theology, not science.

OgreMkV · 20 January 2011

I think you need to read this 'clast (and anyone else who is interested).

It's probably better than your paper and I wouldn't even consider it for publication, but it pretty much explains why your entire concept is wrong.

Enjoy.

OgreMkV · 20 January 2011

https://docs.google.com/document/d/1A_EfiEhJxqDDobXENGaYSPcsrJrpycDvFlluVeypxv8/edit?hl=en

Oops... guess I should attach the link huh

mrg · 20 January 2011

OgreMkV said: I think you need to read this 'clast (and anyone else who is interested).
"Intelligent Design is an attempt to elevate seeing faces in clouds to a science."

DS · 20 January 2011

mrg said: "Intelligent Design is an attempt to elevate seeing faces in clouds to a science."
Just like astrology is a science?

mrg · 20 January 2011

JASONMITCHELL said: are you saying that you accept that peeple can walk 100 feet but not 100 yards (or given enough time) 100 miles?
Assume we make a penny of interest off the dollar over a century ... nobody would dispute that as "microinterest". Do this and reinvest for a million years, not a long time on a geological timescale, and the result is 1.64E43 dollars. Assuming conservatively that a thousand $100 bills weigh a kilogram, that sum of money would be equivalent to: 1.64E38 / 2E30 = 80 million times the mass of the Sun. "Small changes accumulate." Alas, the only response to this observation is that "it cannot account for complexity" or "it cannot create information" or "I did not have sex with that woman" or something like that.

stevaroni · 20 January 2011

Atheistoclast said: You fail to understand that *artificial* selection, or any kind of directed evolution, is essentially intelligent design. Once you allow for a supervisory element into the equation you are arguing against a naturalistic origination.
Everyone here understands the difference between "artificial" selection and "natural" selection. When we talk about artificial selection, like selective breeding, the point isn't to emphasize what you can do with intelligent direction, it is to is to illustrate the power of mutation with selection. Don't forget, until the 1980's man had not built a single gene. The cumulative difference between a doberman and a dachshund is entirely a result of natural random genetic variation. If the great voyages of discovery had found great danes and chihuahuas living on some isolated island and brought them back to Europe for the first time, there is no way science would ever call them the same species. Somebody with great mechanical ingenuity would eventually manage to cross-breed the two and we'd look at the offspring the same way as we look at ligers. in the case of drastically modified dogs, humans did the selecting, but nature still provided the genes. Humans didn't do anything "magic" to help the process along, they just applied some really weird selection criteria that made it all happen faster and go in weird directions. That's the point. We examine stuff like dog breeding because it happens fast enough to see, not because it breaks some inviolate law of nature. No matter how you want to wave your hands about animal husbandry being intelligent selection, the intelligent part isn't the point - the selection part is, and nature does provide powerful selection pressures. Ask anything that lives on the African plains.

Mike Elzinga · 20 January 2011

DS said:
mrg said: "Intelligent Design is an attempt to elevate seeing faces in clouds to a science."
Just like astrology is a science?
The firecracker went off behind this guy way back early in the thread. He’s not just deaf, he is effectively brain dead. The same can be said for that ibig troll also.

mrg · 20 January 2011

The dividing line between artificial and natural selection is very fuzzy:

http://www.vectorsite.net/taevo_14.html#m3

See section 14.3 if the link doesn't register properly.

Stuart Weinstein · 20 January 2011

Atheistoclast said:
Dale Husband said:
Atheistoclast said: I'm afraid you will have to wait until the paper is published. But artificial selection and a process known as "hypermutation" (as with somatic immune cells) can make profound changes in a very short space of time. The point is you don't need to "poof" new genetic information into existence - you just need to be able to manipulate the existing imperfection (though near perfected state) of the replication system.
I thought you said earlier that "Darwinism" was going to be overthrown. Now you affirm that evolution can happen. Make up your mind!
You fail to understand that *artificial* selection, or any kind of directed evolution, is essentially intelligent design. Once you allow for a supervisory element into the equation you are arguing against a naturalistic origination.
This is stupid. If artifical selection can result in macroevolution, there is then no genetic barrier to macroevolution whether its due to articifical or natural selection. And hence no reason why *Darwinism* is soon to bite the dust.

mrg · 20 January 2011

Stuart Weinstein said: If artifical selection can result in macroevolution, there is then no genetic barrier to macroevolution whether its due to articifical or natural selection.
A honeybee has enough brains to select flowers it finds more attractive in a population from those that are less attractive. Artificial selection or natural selection? In coevolutionary strategies, the partners are selecting each other; if we domesticate cattle and select for milk production, they end up selecting us for lactose tolerance.

SWT · 20 January 2011

Stuart Weinstein said:
Atheistoclast said:
Dale Husband said:
Atheistoclast said: I'm afraid you will have to wait until the paper is published. But artificial selection and a process known as "hypermutation" (as with somatic immune cells) can make profound changes in a very short space of time. The point is you don't need to "poof" new genetic information into existence - you just need to be able to manipulate the existing imperfection (though near perfected state) of the replication system.
I thought you said earlier that "Darwinism" was going to be overthrown. Now you affirm that evolution can happen. Make up your mind!
You fail to understand that *artificial* selection, or any kind of directed evolution, is essentially intelligent design. Once you allow for a supervisory element into the equation you are arguing against a naturalistic origination.
This is stupid. If artifical selection can result in macroevolution, there is then no genetic barrier to macroevolution whether its due to articifical or natural selection. And hence no reason why *Darwinism* is soon to bite the dust.
And, as was pointed out in another thread long ago, if we adopt Dembski's definition of intelligence as the "power and facility to choose between options", then natural selection is an intelligent agent. There's no distinction, mechanistically, between "natural" selection and "artificial" selection. It appears to me that one of the manifold problems with ID arguments is that they subtly conflate "intelligence" with "intention" and "consciousness".

Stuart Weinstein · 20 January 2011

mrg said:
Stuart Weinstein said: If artifical selection can result in macroevolution, there is then no genetic barrier to macroevolution whether its due to articifical or natural selection.
A honeybee has enough brains to select flowers it finds more attractive in a population from those that are less attractive. Artificial selection or natural selection? In coevolutionary strategies, the partners are selecting each other; if we domesticate cattle and select for milk production, they end up selecting us for lactose tolerance.
In other words, we have no need for that hypothesis.

OgreMkV · 20 January 2011

SWT said: And, as was pointed out in another thread long ago, if we adopt Dembski's definition of intelligence as the "power and facility to choose between options", then natural selection is an intelligent agent. There's no distinction, mechanistically, between "natural" selection and "artificial" selection. It appears to me that one of the manifold problems with ID arguments is that they subtly conflate "intelligence" with "intention" and "consciousness".
They also confuse information with 'meaning'. Which is a mistake of the highest order.

Atheistoclast · 20 January 2011

Everyone here understands the difference between "artificial" selection and "natural" selection.
I'm afraid you don't. Both artificial and natural selection do indeed make use of an imperfect replication system (i.e random mutations). But that is where the similarity ends. The former requires an intelligence to select those variations that meet the particular *purpose* in mind. The latter's sole criterion is reproductive fitness and nothing else. If it is beneficial to lose functionality, because it confers a survival advantage, then natural selection will go down that route. Artificial selection always works by way of the conscious intent and will of the *artificer*.

OgreMkV · 20 January 2011

'clast, I will ask you again.

Given two organism, genes, or proteins, can you tell which one evolved by natural selection and which evolved by artificial selection. I need a detailed process so that I can test your results.

If you cannot do this, then your entire point (whatever that is) is moot and a complete waste of your time.

Flint · 20 January 2011

The former requires an intelligence to select those variations that meet the particular *purpose* in mind. The latter’s sole criterion is reproductive fitness and nothing else.

This always amuses me. "Artificial selection" is nothing more than some external agent OTHER than the environment defining reproductive fitness. But whether artificial or natural (that is, regardless of who sets the fitness criteria), those who meet the reproductively-fit criteria are more likely to breed. I guess nature, despite doing selection, doesn't count as a selector because if it has an "intent" it's not obvious enough to meet religious criteria.

IBelieveInGod · 20 January 2011

I'm still waiting for dog breeders to breed a dog with horns, or wings, or fins in place of legs:):):)

Artificial selection should theoretically, be able to create a new novel morphological structure much faster then natural selection, because the breeder would be able to choose the most suitable mutations for a new morphological structure. The difference is that natural selection can only select for the current fitness of a mutation, and not for any future fitness of a mutation, but artificial selection (breeder) can select for the future fitness of any mutation. If OgreMkV can't see the difference, then he is an awful scientist!

Flint · 20 January 2011

Artificial selection should theoretically, be able to create a new novel morphological structure much faster then natural selection

Only up to a point. Consider the genome as containing a certain amount of available variation. Breeders can focus and emphasize SOME of the existing variation while excluding others. But once the limit of existing variation has been reached, breeders are just like any environment - they must wait for NEW genetic variation before they can concentrate it. And that requires mutation, over which the breeders have no control. Not even the best breeders could select for "future fitness", EVEN IF they could foresee the future, if the raw material to be selected is simply not available. It remains beyond the state of the art to introduce genetic variation sufficient to stick wings or fins on a dog. But as GM foods illustrate, it IS currently possible to insert genes across species to a limited extent.

IBelieveInGod · 20 January 2011

Flint said:

Artificial selection should theoretically, be able to create a new novel morphological structure much faster then natural selection

Only up to a point. Consider the genome as containing a certain amount of available variation. Breeders can focus and emphasize SOME of the existing variation while excluding others. But once the limit of existing variation has been reached, breeders are just like any environment - they must wait for NEW genetic variation before they can concentrate it. And that requires mutation, over which the breeders have no control. Not even the best breeders could select for "future fitness", EVEN IF they could foresee the future, if the raw material to be selected is simply not available. It remains beyond the state of the art to introduce genetic variation sufficient to stick wings or fins on a dog. But as GM foods illustrate, it IS currently possible to insert genes across species to a limited extent.
:):):) So evolution by common ancestor didn't occur?

John Kwok · 20 January 2011

I simply feel like I am repeating myself every time I contend with delusional IDiots like IBIG. Thanks for chiming in Jason, and of course I am in complete agreement:
JASONMITCHELL said: are you saying that you accept that peeple can walk 100 feet but not 100 yards (or given enough time) 100 miles? THERE IS NO DIFFERENCE between "micro"evolution and "macro"evolution other than scale

OgreMkV · 20 January 2011

IBelieveInGod said:
Flint said:

Artificial selection should theoretically, be able to create a new novel morphological structure much faster then natural selection

Only up to a point. Consider the genome as containing a certain amount of available variation. Breeders can focus and emphasize SOME of the existing variation while excluding others. But once the limit of existing variation has been reached, breeders are just like any environment - they must wait for NEW genetic variation before they can concentrate it. And that requires mutation, over which the breeders have no control. Not even the best breeders could select for "future fitness", EVEN IF they could foresee the future, if the raw material to be selected is simply not available. It remains beyond the state of the art to introduce genetic variation sufficient to stick wings or fins on a dog. But as GM foods illustrate, it IS currently possible to insert genes across species to a limited extent.
:):):) So evolution by common ancestor didn't occur?
And now for IBIG's amazing moving goalposts... seriously??!?!? Would you like an indepth discussion that proves you are wrong? Cause I can do that. You won't listen and you won't understand it, but I can do it. Heck, I'll even let you pick the domesticated organism, I bet I can still show you are wrong. Anyway, you still have a question at ATBC and you have utterly failed to address the point of the last question (apparently not even reading it when I gave you all the possible answers. So let me ask you... what future mutation was seen by cat breeders that resulted in the Devon Rex?

Flint · 20 January 2011

So evolution by common ancestor didn’t occur?

I give up. I simply can't guess how anything I wrote might even remotely imply such a thing. You quoted my post, but did you bother to read it? Do you know what a mutation is?

Atheistoclast · 20 January 2011

Flint said:

The former requires an intelligence to select those variations that meet the particular *purpose* in mind. The latter’s sole criterion is reproductive fitness and nothing else.

This always amuses me. "Artificial selection" is nothing more than some external agent OTHER than the environment defining reproductive fitness. But whether artificial or natural (that is, regardless of who sets the fitness criteria), those who meet the reproductively-fit criteria are more likely to breed. I guess nature, despite doing selection, doesn't count as a selector because if it has an "intent" it's not obvious enough to meet religious criteria.
NONSENSE. We breed for such things as chihuahuas, sheep with short legs (that can't jump fences) or seedless grapes - organisms and traits that would not survive in the wild. We select what is useful to our society. Natural selection would oppose most of the changes we select as breeders...like with the examples above. Of course, there are *limits* to artificial selection but this is because we don't know how to select individual mutations without an obvious phenotype. What I mean is that we could create a string of characters... "CLASTIEISKING" ..in a protein sequence if we decided to select each amino acid. We can do this now, but not in the past.

John Kwok · 20 January 2011

IBelieveInGod said: I'm still waiting for dog breeders to breed a dog with horns, or wings, or fins in place of legs:):):) Artificial selection should theoretically, be able to create a new novel morphological structure much faster then natural selection, because the breeder would be able to choose the most suitable mutations for a new morphological structure. The difference is that natural selection can only select for the current fitness of a mutation, and not for any future fitness of a mutation, but artificial selection (breeder) can select for the future fitness of any mutation. If OgreMkV can't see the difference, then he is an awful scientist!
Sorry IBIG you are wrong on all counts since you neglect the importance of genealogical history - what is better known as "phylogeny" - in the history of life. The reason why we will never see dogs with horns or wings or fins is because the dog lineage diverged long ago from those lineages which did produce eventually, horns or wings or fins. Artifical selection can produce "novel structures" faster than natural selection, as is clearly demonstrated by the "diversity" we see in dogs, ranging from tiny Pekinese to Great Danes and Greyhounds. But no dog breed can produce the very structures you desire because of historical constraints imposed on dogs via the prior phylogeny of the "dog" clade.

John Kwok · 20 January 2011

Sorry Atheistofool, under the right set of environmental conditions, and sufficient time, Natural Selection could do exactly what you claim it can't:
Atheistoclast said: NONSENSE. We breed for such things as chihuahuas, sheep with short legs (that can't jump fences) or seedless grapes - organisms and traits that would not survive in the wild. We select what is useful to our society. Natural selection would oppose most of the changes we select as breeders...like with the examples above.

OgreMkV · 20 January 2011

'clast, I'm sure you're just missing my posts with a critical question. I'll repeat it here for you.

Given an organism, gene, protein, or structure, can you tell whether it was developed via artificial selection or natural selection? I'll need a complete process so that I can try it on a few example organisms to make sure it works.

If you can't do that, then your entire point (whatever it is) is moot and you're wasting your time on the subject.

Dale Husband · 20 January 2011

Atheistoclast said:
Flint said:

The former requires an intelligence to select those variations that meet the particular *purpose* in mind. The latter’s sole criterion is reproductive fitness and nothing else.

This always amuses me. "Artificial selection" is nothing more than some external agent OTHER than the environment defining reproductive fitness. But whether artificial or natural (that is, regardless of who sets the fitness criteria), those who meet the reproductively-fit criteria are more likely to breed. I guess nature, despite doing selection, doesn't count as a selector because if it has an "intent" it's not obvious enough to meet religious criteria.
NONSENSE. We breed for such things as chihuahuas, sheep with short legs (that can't jump fences) or seedless grapes - organisms and traits that would not survive in the wild. We select what is useful to our society. Natural selection would oppose most of the changes we select as breeders...like with the examples above. Of course, there are *limits* to artificial selection but this is because we don't know how to select individual mutations without an obvious phenotype. What I mean is that we could create a string of characters... "CLASTIEISKING" ..in a protein sequence if we decided to select each amino acid. We can do this now, but not in the past.
Uh, what exactly are you arguing with us about?

IBelieveInGod · 20 January 2011

John Kwok said:
IBelieveInGod said: I'm still waiting for dog breeders to breed a dog with horns, or wings, or fins in place of legs:):):) Artificial selection should theoretically, be able to create a new novel morphological structure much faster then natural selection, because the breeder would be able to choose the most suitable mutations for a new morphological structure. The difference is that natural selection can only select for the current fitness of a mutation, and not for any future fitness of a mutation, but artificial selection (breeder) can select for the future fitness of any mutation. If OgreMkV can't see the difference, then he is an awful scientist!
Sorry IBIG you are wrong on all counts since you neglect the importance of genealogical history - what is better known as "phylogeny" - in the history of life. The reason why we will never see dogs with horns or wings or fins is because the dog lineage diverged long ago from those lineages which did produce eventually, horns or wings or fins. Artifical selection can produce "novel structures" faster than natural selection, as is clearly demonstrated by the "diversity" we see in dogs, ranging from tiny Pekinese to Great Danes and Greyhounds. But no dog breed can produce the very structures you desire because of historical constraints imposed on dogs via the prior phylogeny of the "dog" clade.
But didn't all tetrapods evolve from lobe-finned fish? If so wouldn't dogs and all tetrapods still have those traits left over from lobe-finned fish? If not why? Are you saying that there is a loss of information in the DNA over time? If so, why is there a loss of information?

Flint · 20 January 2011

NONSENSE. We breed for such things as chihuahuas, sheep with short legs (that can’t jump fences) or seedless grapes - organisms and traits that would not survive in the wild. We select what is useful to our society. Natural selection would oppose most of the changes we select as breeders…like with the examples above.

Did you bother to read for comprehension? All you're doing here is changing one set of breeding constraints for another. So what? All you're doing is emphasizing (as if we needed it) that contraints result in evolutionary changes. It really doesn't matter who or what is doing the selecting, or what the "purpose" of the selector may be. All you're illustrating is that selection works, regardless of what does the selecting. And the limits to artifical selection are identical to the limits of natural selection - the variation in the current genome. And the reason they're identical is, selection is selection is selection. You are deliberately confusing the purpose of the selector, with the method used by the selector, which is differential reproductive rates. In both cases. To beat this dead horse a little further in to the ground, "artificial" selection is nothing more than a changed environment to the organism trying to breed. It really doesn't matter whether the organism knows or cares about the CAUSE of the change. It only matters which individuals end up breeding. For whatever reason.

Dale Husband · 20 January 2011

Atheistoclast said:
Everyone here understands the difference between "artificial" selection and "natural" selection.
I'm afraid you don't. Both artificial and natural selection do indeed make use of an imperfect replication system (i.e random mutations). But that is where the similarity ends. The former requires an intelligence to select those variations that meet the particular *purpose* in mind. The latter's sole criterion is reproductive fitness and nothing else. If it is beneficial to lose functionality, because it confers a survival advantage, then natural selection will go down that route. Artificial selection always works by way of the conscious intent and will of the *artificer*.
You are merely stating the obvious, and thus proving yourself incapable of adding anything of substance to this discussion. You are indeed a fraud.

Flint · 20 January 2011

Are you saying that there is a loss of information in the DNA over time? If so, why is there a loss of information?

Normal people (those who have learned anything in their life) also tend to forget things never brought to mind. Normal people also tend to learn new things more immediately useful in their lives. You'll have to trust me on this.

RBH · 20 January 2011

Flint said: Normal people (those who have learned anything in their life) also tend to forget things never brought to mind. Normal people also tend to learn new things more immediately useful in their lives. You'll have to trust me on this.
LOL!!

Stanton · 20 January 2011

IBelieveInGod babbled: But didn't all tetrapods evolve from lobe-finned fish? If so wouldn't dogs and all tetrapods still have those traits left over from lobe-finned fish? If not why? Are you saying that there is a loss of information in the DNA over time? If so, why is there a loss of information?
Hey, moron. Tetrapod vertebrates have many traits in common with ancestral lobe-finned fishes. That is why the lobe-finned fishes are considered to be the closest relatives of tetrapod vertebrates. The loss of some traits, such as gills, occurred because they were selected against. If you keep saying stupid things with the intent to impress us into worshiping you, we're going to have to keep pointing out how you're a moronic lunatic.

DS · 20 January 2011

Atheistoclast said: NONSENSE. We breed for such things as chihuahuas, sheep with short legs (that can't jump fences) or seedless grapes - organisms and traits that would not survive in the wild. We select what is useful to our society. Natural selection would oppose most of the changes we select as breeders...like with the examples above. Of course, there are *limits* to artificial selection but this is because we don't know how to select individual mutations without an obvious phenotype.
Artificial selection can sometimes be more intense than artificial selection. Artificial selection might indeed be capable of selecting for things that would never be selected for naturally. However, all of that is completely irrelevant. The only question is whether natural selection could play an important role in producing the diversity of life found on earth. The answer is yes. IF you think that there is is some limit that prevents this demonstrate what is is an at what point it operates, otherwise piss off. Now, do you or do you not admit that you were wrong about duplicate genes? Do you or do you not admit that gene duplication can remove genes from functional constraint? If you do not, how do you explain all of the pseudogenes that have evolved from functional genes? If they can persist as completely nonfunctional copies, what could prevent them from taking on other functions?

IBelieveInGod · 20 January 2011

Stanton said:
IBelieveInGod babbled: But didn't all tetrapods evolve from lobe-finned fish? If so wouldn't dogs and all tetrapods still have those traits left over from lobe-finned fish? If not why? Are you saying that there is a loss of information in the DNA over time? If so, why is there a loss of information?
Hey, moron. Tetrapod vertebrates have many traits in common with ancestral lobe-finned fishes. That is why the lobe-finned fishes are considered to be the closest relatives of tetrapod vertebrates. The loss of some traits, such as gills, occurred because they were selected against. If you keep saying stupid things with the intent to impress us into worshiping you, we're going to have to keep pointing out how you're a moronic lunatic.
So they are selected against? Tell me what prevents a repressed gene from being expressed in the future?

Stanton · 20 January 2011

IBelieveInGod said:
Stanton said:
IBelieveInGod babbled: But didn't all tetrapods evolve from lobe-finned fish? If so wouldn't dogs and all tetrapods still have those traits left over from lobe-finned fish? If not why? Are you saying that there is a loss of information in the DNA over time? If so, why is there a loss of information?
Hey, moron. Tetrapod vertebrates have many traits in common with ancestral lobe-finned fishes. That is why the lobe-finned fishes are considered to be the closest relatives of tetrapod vertebrates. The loss of some traits, such as gills, occurred because they were selected against. If you keep saying stupid things with the intent to impress us into worshiping you, we're going to have to keep pointing out how you're a moronic lunatic.
So they are selected against? Tell me what prevents a repressed gene from being expressed in the future?
If a gene is silenced due to mutation, then it can not be expressed anymore in the exact same way a recipe in a cookbook can no longer be read if someone were to pour ink on the page it is on. Once a gene has been rendered incapable of being expressed, it becomes a pseudogene, and the only way to reactivate a pseudogene is if another mutation places a start codon at its start. This has happened, but, not that you are capable of caring. If you have a rudimentary knowledge of Genetics and or Biology, you would have known this. But, you have made it clear that you find learning, science and knowledge to be tantamount to devil-worship and murder.

Stanton · 20 January 2011

IBelieveInGod said:
Stanton said:
IBelieveInGod babbled: But didn't all tetrapods evolve from lobe-finned fish? If so wouldn't dogs and all tetrapods still have those traits left over from lobe-finned fish? If not why? Are you saying that there is a loss of information in the DNA over time? If so, why is there a loss of information?
Hey, moron. Tetrapod vertebrates have many traits in common with ancestral lobe-finned fishes. That is why the lobe-finned fishes are considered to be the closest relatives of tetrapod vertebrates. The loss of some traits, such as gills, occurred because they were selected against. If you keep saying stupid things with the intent to impress us into worshiping you, we're going to have to keep pointing out how you're a moronic lunatic.
So they are selected against? Tell me what prevents a repressed gene from being expressed in the future?
Furthermore, what sort of idiotic gotcha-game are you building up to this time? Let me guess, it's because you think that scientists are blind idiots who rail against God, and because you refuse to understand what scientists actually do in laboratories, you assume that they just make stuff up with the intent to spite God?

Flint · 20 January 2011

The only question is whether natural selection could play an important role in producing the diversity of life found on earth. The answer is yes.

Note here that theistic evolutionists, those who believe that the course of evolution is being and always has been divinely directed, are in effect arguing that ALL selection is in that sense artificial (i.e. controlled by some intelligent selective breeding agent). Indeed, all of reality is artifical. So all we have here is a frame of reference issue. Like corn, we cannot KNOW whether we are being bred. Some plants believe they are, some believe they are not, but they have no way of testing.

John Kwok · 20 January 2011

IBelieveInGod said: But didn't all tetrapods evolve from lobe-finned fish? If so wouldn't dogs and all tetrapods still have those traits left over from lobe-finned fish? If not why? Are you saying that there is a loss of information in the DNA over time? If so, why is there a loss of information?
I am not a geneticist, molecular biologist, developmental biologist or biochemist by training, but instead, an invertebrate paleobiologist. If your latest example of breathtaking inanity is true, then how come plesiosaurs, mososaurs, ichthyosaurs, cetaceans, sirenians, pinnipeds and other tetrapods that independently developed fins didn't develop the same fins that their lobe-finned fish ancestors had way back when in the Early to Middle Devonian? The answer is simple. It wasn't due to my "pal" Bill Dembski's absurd assertion that they had "lost" complex specified information, but instead, because the regulatory genes that had cooperated to create the lobe-finned fish fins had been switched off. Since all of these tetrapods had lost this trait, they had to develop secondarily, adequate substitutes which required modifications of the vertebral column and limbs.

IBelieveInGod · 20 January 2011

Stanton said:
IBelieveInGod said:
Stanton said:
IBelieveInGod babbled: But didn't all tetrapods evolve from lobe-finned fish? If so wouldn't dogs and all tetrapods still have those traits left over from lobe-finned fish? If not why? Are you saying that there is a loss of information in the DNA over time? If so, why is there a loss of information?
Hey, moron. Tetrapod vertebrates have many traits in common with ancestral lobe-finned fishes. That is why the lobe-finned fishes are considered to be the closest relatives of tetrapod vertebrates. The loss of some traits, such as gills, occurred because they were selected against. If you keep saying stupid things with the intent to impress us into worshiping you, we're going to have to keep pointing out how you're a moronic lunatic.
So they are selected against? Tell me what prevents a repressed gene from being expressed in the future?
If a gene is silenced due to mutation, then it can not be expressed anymore in the exact same way a recipe in a cookbook can no longer be read if someone were to pour ink on the page it is on. Once a gene has been rendered incapable of being expressed, it becomes a pseudogene, and the only way to reactivate a pseudogene is if another mutation places a start codon at its start. This has happened, but, not that you are capable of caring. If you have a rudimentary knowledge of Genetics and or Biology, you would have known this. But, you have made it clear that you find learning, science and knowledge to be tantamount to devil-worship and murder.
What percentage of mutations are beneficial? What percentage of mutations are damaging? What percentage of mutations are neutral?

Cubist · 20 January 2011

IBelieveInGod said:
John Kwok said: Sorry IBIG you are wrong on all counts since you neglect the importance of genealogical history - what is better known as "phylogeny" - in the history of life. The reason why we will never see dogs with horns or wings or fins is because the dog lineage diverged long ago from those lineages which did produce eventually, horns or wings or fins. Artifical selection can produce "novel structures" faster than natural selection, as is clearly demonstrated by the "diversity" we see in dogs, ranging from tiny Pekinese to Great Danes and Greyhounds. But no dog breed can produce the very structures you desire because of historical constraints imposed on dogs via the prior phylogeny of the "dog" clade.
But didn't all tetrapods evolve from lobe-finned fish? If so wouldn't dogs and all tetrapods still have those traits left over from lobe-finned fish?
Under an evolutionary paradigm, dogs (and tetrapods in general) would be expected to have retained some traits from their (distant) ancestors, the lobe-finned fish. Some of those ancestral traits, not all of those ancestral traits. Because if tetrapods had retained all of the traits from their lobe-finned-fish ancestors, they'd still be lobe-finned fish -- just a somewhat unusual variation of lobe-finned fish, is all.
If not why? Are you saying that there is a loss of information in the DNA over time? If so, why is there a loss of information?
Hold it, IBIG. First: When you talk about "information in the DNA", what definition of "information" are you using?
Second: Under the definition of "information" you're using, how do you measure the "information" content in the DNA? I ask because you're making noise about "loss of information", and if you can't measure the stuff, how the heck can you tell whether or not the DNA has lost any "information"?

stevaroni · 20 January 2011

mrg said: The dividing line between artificial and natural selection is very fuzzy:
I tend to read a lot of Jared Diamond because I find the premise of his work fascinating (he does comparative anthropology, and most of his books delve into the subtle reasons that one group in history was able to do things that other similarly advanced peoples could not). He devotes a large chapter in one of his books to the inadvertent domestication of wheat in the fertile crescent. Basically, individual plants that produced large, prominent seedheads, ordinarily a disadvantage, were preferentially gathered and redistributed by the actions of early modern man. Eventually this produced a prominent seedhead and encouraged plants that all flowered together.

OgreMkV · 20 January 2011

Atheistoclast said: NONSENSE. We breed for such things as chihuahuas, sheep with short legs (that can't jump fences) or seedless grapes - organisms and traits that would not survive in the wild. We select what is useful to our society. Natural selection would oppose most of the changes we select as breeders...like with the examples above. Of course, there are *limits* to artificial selection but this is because we don't know how to select individual mutations without an obvious phenotype. What I mean is that we could create a string of characters... "CLASTIEISKING" ..in a protein sequence if we decided to select each amino acid. We can do this now, but not in the past.
'clast, please tell me you aren't trying to bring that wicked cool, but poorly coded program from 200 back. We can talk about this without referring to strings or any other analogies. We can actually talk about DNA. Analogies never work. BTW: I note you still haven't answered my question or explained why it's invalid.

Stanton · 20 January 2011

IBelieveInGod said: What percentage of mutations are beneficial? What percentage of mutations are damaging? What percentage of mutations are neutral?
Ah, so you're playing games with percentages? Here's where IBelieve, the pompous, arrogant idiot deliberately ignores the fact that beneficial and neutral mutations are retained by their owning organisms because they either improve, or do not impair their owners' chances at reproduction in order to boast and brag about how evolution magically can not happen because there are more harmful mutations than beneficial mutations. Of course, IBelieve wouldn't be playing such a stupid gotcha-game if he were honest, and happened to like learning about science, rather than regarding it as being of the devil.

RBH · 20 January 2011

IBelieveInGod said: What percentage of mutations are beneficial? What percentage of mutations are damaging? What percentage of mutations are neutral?
"Beneficial," "damaging" and "neutral" have meaning only in a specified selective environment. The same mutation might be beneficial in one selective environment, deleterious in another, and neutral in a third. That you think those are properties of a mutation in isolation speaks to your ignorance.

OgreMkV · 20 January 2011

IBelieveInGod said: What percentage of mutations are beneficial? What percentage of mutations are damaging? What percentage of mutations are neutral?
Why do you ask this? This has been explained to you at least three times. Myself once, DS once, and Stanton once. The answer is it doesn't matter. A more advanced answer is that it doesn't matter because some horrible mutations are carried with successful mutations (this is demonstrable). Additionally, some bad, horrible, damaging mutations are precursors for massively positive mutations (again, demonstrable). In fact, I personally provided the paper to you that proves this is happens. You didn't read it, therefore, you have fully admitted to being incapable of learning. You, IBIG, still refuse my offer of teaching you. You'd be getting for free what the State of Texas paid around $50k for. Yet you don't. Whatever. He's just trying to see if anyone doesn't know his cute little word games and he can catch them out on it.

IBelieveInGod · 20 January 2011

Stanton said:
IBelieveInGod said: What percentage of mutations are beneficial? What percentage of mutations are damaging? What percentage of mutations are neutral?
Ah, so you're playing games with percentages? Here's where IBelieve, the pompous, arrogant idiot deliberately ignores the fact that beneficial and neutral mutations are retained by their owning organisms because they either improve, or do not impair their owners' chances at reproduction in order to boast and brag about how evolution magically can not happen because there are more harmful mutations than beneficial mutations. Of course, IBelieve wouldn't be playing such a stupid gotcha-game if he were honest, and happened to like learning about science, rather than regarding it as being of the devil.
Playing a game with percentages? I'm asking what percentage of mutations are good, bad, and neutral. Are you afraid to answer that question, because you think it is a gotcha? Why would you be concerned about a gotcha?

Dale Husband · 20 January 2011

IBelieveInGod said: Playing a game with percentages? I'm asking what percentage of mutations are good, bad, and neutral. Are you afraid to answer that question, because you think it is a gotcha? Why would you be concerned about a gotcha?
Why don't you try asking legitimate scientific questions, like what sort of mutations would give an advantage to an organism in a certain environment? Open-ended questions that have no specific meaning are a waste of everyone's time.

stevaroni · 20 January 2011

IBelieveInGod said: So they are selected against? Tell me what prevents a repressed gene from being expressed in the future?
Actually, you would expect a truly repressed gene to fall apart over time. Genes duplicate imperfectly. That is a known fact. Eventually, every gene which is not repaired can be expected to accumulate enough mutations that it breaks. This happens to all genes. When it happens to an important gene, that animal usually dies is debilitated in such a way that nature selects against it ( an interesting example is the ancestor of great apes, including us, where the vitamin C synthesis gene broke about 10Mya, before humans and their crafty hunter-gathering, this limited the habitat of the great apes to tropical areas where vitamin C rich fruit was plentiful ). When an animal with a faulty important function is selected against, it's usually to the advantage of similar fully functional animal. Hence, it's quite likely that the broken gene is swept out of the gene pool, to be replaced by a better copy. In the case of a truly recessive gene, there's no tendancy to self-correct and fix it, since there's no loss of fitness assosiated to loosing a function that doesn't work. Since all genes mutate at a fixed rate, and no pressure is applied to fix broken genes, you would expect truly recessive genes to slowly turn into junk. This is a simple concept, IBIG. I expect all the parts on my computer to die eventually. If a significant function goes, liek the display or power supply, I will fix it immediately (nature can't fix it, of course, instead it just selects a better, working computer). If a recessive function goes, like my 5 1/4 floppy or parallel port, I probably won't even notice, and will never fix it. In fact, like my 5 1/4 inch floppy, I will probably slowly start to not have the right driver installed, because I never needed it anyway. Eventually, it's not even supported in the operating system. Then 10 years from now, when for some reason I need to access a term paper I wrote in college.... pfffft. That's how recessive genes work in the real world.

Flint · 20 January 2011

I’m asking what percentage of mutations are good, bad, and neutral. Are you afraid to answer that question, because you think it is a gotcha?

As was explained to you, these terms (good, bad, and neutral) are relative to the environment. Any mutation might be good in one environment, bad in another. These are NOT properties of the mutation, but of the situation. Your question is based on a false assumption. Correct the assumption and try again.

Stanton · 20 January 2011

IBelieveInGod said: Playing a game with percentages? I'm asking what percentage of mutations are good, bad, and neutral. Are you afraid to answer that question, because you think it is a gotcha? Why would you be concerned about a gotcha?
I'm concerned with your stupid gotcha-games because whenever you ask an easily answerable question, you then proceed to ignore all of the answers in order to then gloat and brag about how you stumped the evil, stupid science-people, save for a few responses that you deliberately distort in order to dishonestly attack that person. This is one of the primary reasons why we point out that you are a lying idiot whose word is absolutely worthless.

Flint · 20 January 2011

Then 10 years from now, when for some reason I need to access a term paper I wrote in college.… pfffft.

The CD-ROM (remember those? Occasionally they're still used) was said to be the very first medium that was expected to outlast the ability to read it. That is, the physical item wouldn't deteriorate beyond recovery sooner than the hardware and software necessary to extract anything off of it.

fnxtr · 20 January 2011

Flint said:

Then 10 years from now, when for some reason I need to access a term paper I wrote in college.… pfffft.

The CD-ROM (remember those? Occasionally they're still used) was said to be the very first medium that was expected to outlast the ability to read it. That is, the physical item wouldn't deteriorate beyond recovery sooner than the hardware and software necessary to extract anything off of it.
They'll last until they're obsolete. :-) OT: I'm hoping CFL's will soon go the way of Laserdisc. Wiring a house for low-voltage LED's would be *so* much easier!

RBH · 20 January 2011

IBelieveInGod said: Playing a game with percentages? I'm asking what percentage of mutations are good, bad, and neutral. Are you afraid to answer that question, because you think it is a gotcha? Why would you be concerned about a gotcha?
Your question was answered. Read for comprehension or risk banishment to the Bathroom Wall.

Dale Husband · 20 January 2011

RBH said:
IBelieveInGod said: Playing a game with percentages? I'm asking what percentage of mutations are good, bad, and neutral. Are you afraid to answer that question, because you think it is a gotcha? Why would you be concerned about a gotcha?
Your question was answered. Read for comprehension or risk banishment to the Bathroom Wall.
Can you clarify for us whether or not IBIG was indeed banished to the Bathroom Wall once before? If so, it would be pointless to merely banish him again; he should be banned completely.

Cubist · 21 January 2011

IBelieveInGod said: What percentage of mutations are beneficial? What percentage of mutations are damaging? What percentage of mutations are neutral?
As has already been pointed out, you really can't apply any of the terms "beneficial", "damaging", or "neutral" to a mutation until after you've specified the environment in which the mutation-carrying critter will live.
Consider a mutation which gives a critter pure white fur: For a critter which lives up north in the Arctic Circle, pure white fur would be effective camouflage, so that pure-white-fur mutation would be beneficial to an animal in the Arctic. But for a critter which lives in the swamps of Florida, pure white fur would make that critter stand out against its environment, hence make that critter an easier target for predators, so that pure-white-fur mutation would be damaging to an animal in Florida. So… is that pure-white-fur mutation beneficial, or damaging?
All the above said and acknowledged: The last time I checked, something like 90% of all mutations are 'neutral', meaning not really affecting the critter for good or ill; another 9%-or-so of mutations can be considered 'damaging' to those critters which carry them; and the remaining ≈1% of mutations can be considered 'beneficial' to those critters which carry them. What of it, IBIG?

Mike Elzinga · 21 January 2011

Sheesh; if this ibig troll is a child that has been abandoned by its mother, one can hardly blame the mother.

IBelieveInGod · 21 January 2011

Is disease an example of bad mutations?

IBelieveInGod · 21 January 2011

Maybe I should clarify the previous question, are cancer, sickle cell anemia, muscular dystrophy, etc... examples of harmful mutations?

IBelieveInGod · 21 January 2011

Cubist said:
IBelieveInGod said: What percentage of mutations are beneficial? What percentage of mutations are damaging? What percentage of mutations are neutral?
As has already been pointed out, you really can't apply any of the terms "beneficial", "damaging", or "neutral" to a mutation until after you've specified the environment in which the mutation-carrying critter will live.
Consider a mutation which gives a critter pure white fur: For a critter which lives up north in the Arctic Circle, pure white fur would be effective camouflage, so that pure-white-fur mutation would be beneficial to an animal in the Arctic. But for a critter which lives in the swamps of Florida, pure white fur would make that critter stand out against its environment, hence make that critter an easier target for predators, so that pure-white-fur mutation would be damaging to an animal in Florida. So… is that pure-white-fur mutation beneficial, or damaging?
All the above said and acknowledged: The last time I checked, something like 90% of all mutations are 'neutral', meaning not really affecting the critter for good or ill; another 9%-or-so of mutations can be considered 'damaging' to those critters which carry them; and the remaining ≈1% of mutations can be considered 'beneficial' to those critters which carry them. What of it, IBIG?

Please provide actual evidence that 90% of all mutations are 'neutral'. Please don't provide studies or research that have no basis in reality, i.e. Nachman and Crowell did a comparison of Human and Chimpanzee DNA; they then proceeded to use the Evolutionary assumption that Humans and Chimpanzees had a common ancestor that lived about 5 million years ago. Their estimate of 3 harmful mutations per generation had the same basis. This is not real science, because the entire research hinges on whether Chimpanzees and Humans, really had a common ancestor 5 million years ago. This study did not measure actual mutations in humans, so I call it a bogus study. So, please provide actual observable evidence to back up how many mutations are neutral, harmful, and beneficial. I've seen numbers and percentages, but are they have a basis in reality, are they really observed or are they calculated on the assumption like provided earlier in this paragraph.

IBelieveInGod · 21 January 2011

What is Natural Genetic Engineering?

Cubist · 21 January 2011

IBelieveInGod said: What is Natural Genetic Engineering?
Dunno, IBIG. At first blush, it sounds like a contradiction in terms -- but perhaps the person who coined said phrase had a sensible meaning in mind for it. Myself, I've never encountered that term before, so perhaps you might be kind enough to tell me what this "natural genetic engineering" thingie is?

Cubist · 21 January 2011

IBelieveInGod said: [A]re cancer, sickle cell anemia, muscular dystrophy, etc... examples of harmful mutations?
Cancer: Contrary to popular belief, cancer isn't one specific disease. Rather, cancer is a whole family of diseases, which is why we speak of bone cancer, blood cancer (leukemia), lung cancer, and so on. Is there any one particular 'flavor' of cancer you're interested in hearing about, IBIG? Sickle-cell anemia: This one's a mutation, for sure -- and it's a weird one, for people who insist that mutations must be Entirely Harmful or Entirely Beneficial, no "sometimes one, sometimes the other" genes need apply. You see, if just one of your parents passes the sickle-cell gene along to you, that gene makes you resistant to malaria; it's only if you have two copies of the sickle-cell gene, passed along from both of your parents, that you end up with the disease. So you tell me, IBIG: Is the sickle-cell gene harmful or not? Muscular dystrophy: Beats the heck outta me, IBIG -- I can't say I've ever looked into the matter. [shrug] What of it?

OgreMkV · 21 January 2011

stevaroni said:
IBelieveInGod said: So they are selected against? Tell me what prevents a repressed gene from being expressed in the future?
Actually, you would expect a truly repressed gene to fall apart over time. Genes duplicate imperfectly. That is a known fact. Eventually, every gene which is not repaired can be expected to accumulate enough mutations that it breaks. This happens to all genes. When it happens to an important gene, that animal usually dies is debilitated in such a way that nature selects against it ( an interesting example is the ancestor of great apes, including us, where the vitamin C synthesis gene broke about 10Mya, before humans and their crafty hunter-gathering, this limited the habitat of the great apes to tropical areas where vitamin C rich fruit was plentiful ). When an animal with a faulty important function is selected against, it's usually to the advantage of similar fully functional animal. Hence, it's quite likely that the broken gene is swept out of the gene pool, to be replaced by a better copy. In the case of a truly recessive gene, there's no tendancy to self-correct and fix it, since there's no loss of fitness assosiated to loosing a function that doesn't work. Since all genes mutate at a fixed rate, and no pressure is applied to fix broken genes, you would expect truly recessive genes to slowly turn into junk. This is a simple concept, IBIG. I expect all the parts on my computer to die eventually. If a significant function goes, liek the display or power supply, I will fix it immediately (nature can't fix it, of course, instead it just selects a better, working computer). If a recessive function goes, like my 5 1/4 floppy or parallel port, I probably won't even notice, and will never fix it. In fact, like my 5 1/4 inch floppy, I will probably slowly start to not have the right driver installed, because I never needed it anyway. Eventually, it's not even supported in the operating system. Then 10 years from now, when for some reason I need to access a term paper I wrote in college.... pfffft. That's how recessive genes work in the real world.
I'd just like to point out that this entire concept that stevearoni is talking about is in No Way a problem for biology or evolution. This is the way it is and the way it has been since the first replicators crawled out of the ocean. You see, there's this process by which new genes are created... perhaps you've heard of it. It's called reproduction. What's fascinating is that, if 'clast and other ID proponents are right, then reproduction can't happen either. Asexual reproduction is just copying of genes. Admittedly, it's copying a lot of genes, not just one or two. Sexual reproduction is even worse, in that crossing over can occur and when there's a problem with crossing over, an offspring could easily end up with two copies of one gene. That's not the only way, just one way via sexual reproduction. I think my child would beg to differ that these processes are impossible. IBIG, why cite the papers to you? You don't read them. Why don't you go look it up on Google Scholar and show us you're interested in learning and that you are capable of doing this yourself.

Cubist · 21 January 2011

IBelieveInGod said:
Cubist said:
IBelieveInGod said: What percentage of mutations are beneficial? What percentage of mutations are damaging? What percentage of mutations are neutral?
As has already been pointed out, you really can't apply any of the terms "beneficial", "damaging", or "neutral" to a mutation until after you've specified the environment in which the mutation-carrying critter will live.
Consider a mutation which gives a critter pure white fur: For a critter which lives up north in the Arctic Circle, pure white fur would be effective camouflage, so that pure-white-fur mutation would be beneficial to an animal in the Arctic. But for a critter which lives in the swamps of Florida, pure white fur would make that critter stand out against its environment, hence make that critter an easier target for predators, so that pure-white-fur mutation would be damaging to an animal in Florida. So… is that pure-white-fur mutation beneficial, or damaging?
All the above said and acknowledged: The last time I checked, something like 90% of all mutations are 'neutral', meaning not really affecting the critter for good or ill; another 9%-or-so of mutations can be considered 'damaging' to those critters which carry them; and the remaining ≈1% of mutations can be considered 'beneficial' to those critters which carry them. What of it, IBIG?

Please provide actual evidence that 90% of all mutations are 'neutral'. Please don't provide studies or research that have no basis in reality, i.e. Nachman and Crowell did a comparison of Human and Chimpanzee DNA; they then proceeded to use the Evolutionary assumption that Humans and Chimpanzees had a common ancestor that lived about 5 million years ago. Their estimate of 3 harmful mutations per generation had the same basis. This is not real science, because the entire research hinges on whether Chimpanzees and Humans, really had a common ancestor 5 million years ago. This study did not measure actual mutations in humans, so I call it a bogus study. So, please provide actual observable evidence to back up how many mutations are neutral, harmful, and beneficial. I've seen numbers and percentages, but are they have a basis in reality, are they really observed or are they calculated on the assumption like provided earlier in this paragraph.
Gosh, IBIG, how could anyone possibly get the idea that any ostensibly-innocent question of yours could be nothing more than a veiled attempt to play a 'gotcha' trick on those Ee-vil Darwinisticianistas?

IBelieveInGod · 21 January 2011

Cubist said:
IBelieveInGod said:
Cubist said:
IBelieveInGod said: What percentage of mutations are beneficial? What percentage of mutations are damaging? What percentage of mutations are neutral?
As has already been pointed out, you really can't apply any of the terms "beneficial", "damaging", or "neutral" to a mutation until after you've specified the environment in which the mutation-carrying critter will live.
Consider a mutation which gives a critter pure white fur: For a critter which lives up north in the Arctic Circle, pure white fur would be effective camouflage, so that pure-white-fur mutation would be beneficial to an animal in the Arctic. But for a critter which lives in the swamps of Florida, pure white fur would make that critter stand out against its environment, hence make that critter an easier target for predators, so that pure-white-fur mutation would be damaging to an animal in Florida. So… is that pure-white-fur mutation beneficial, or damaging?
All the above said and acknowledged: The last time I checked, something like 90% of all mutations are 'neutral', meaning not really affecting the critter for good or ill; another 9%-or-so of mutations can be considered 'damaging' to those critters which carry them; and the remaining ≈1% of mutations can be considered 'beneficial' to those critters which carry them. What of it, IBIG?

Please provide actual evidence that 90% of all mutations are 'neutral'. Please don't provide studies or research that have no basis in reality, i.e. Nachman and Crowell did a comparison of Human and Chimpanzee DNA; they then proceeded to use the Evolutionary assumption that Humans and Chimpanzees had a common ancestor that lived about 5 million years ago. Their estimate of 3 harmful mutations per generation had the same basis. This is not real science, because the entire research hinges on whether Chimpanzees and Humans, really had a common ancestor 5 million years ago. This study did not measure actual mutations in humans, so I call it a bogus study. So, please provide actual observable evidence to back up how many mutations are neutral, harmful, and beneficial. I've seen numbers and percentages, but are they have a basis in reality, are they really observed or are they calculated on the assumption like provided earlier in this paragraph.
Gosh, IBIG, how could anyone possibly get the idea that any ostensibly-innocent question of yours could be nothing more than a veiled attempt to play a 'gotcha' trick on those Ee-vil Darwinisticianistas?
If evolution from common ancestor is so certain, then there should be no fear of a gocha game right? So, what are you even concerned about?

IBelieveInGod · 21 January 2011

Cubist said:
IBelieveInGod said:
Cubist said:
IBelieveInGod said: What percentage of mutations are beneficial? What percentage of mutations are damaging? What percentage of mutations are neutral?
As has already been pointed out, you really can't apply any of the terms "beneficial", "damaging", or "neutral" to a mutation until after you've specified the environment in which the mutation-carrying critter will live.
Consider a mutation which gives a critter pure white fur: For a critter which lives up north in the Arctic Circle, pure white fur would be effective camouflage, so that pure-white-fur mutation would be beneficial to an animal in the Arctic. But for a critter which lives in the swamps of Florida, pure white fur would make that critter stand out against its environment, hence make that critter an easier target for predators, so that pure-white-fur mutation would be damaging to an animal in Florida. So… is that pure-white-fur mutation beneficial, or damaging?
All the above said and acknowledged: The last time I checked, something like 90% of all mutations are 'neutral', meaning not really affecting the critter for good or ill; another 9%-or-so of mutations can be considered 'damaging' to those critters which carry them; and the remaining ≈1% of mutations can be considered 'beneficial' to those critters which carry them. What of it, IBIG?

Please provide actual evidence that 90% of all mutations are 'neutral'. Please don't provide studies or research that have no basis in reality, i.e. Nachman and Crowell did a comparison of Human and Chimpanzee DNA; they then proceeded to use the Evolutionary assumption that Humans and Chimpanzees had a common ancestor that lived about 5 million years ago. Their estimate of 3 harmful mutations per generation had the same basis. This is not real science, because the entire research hinges on whether Chimpanzees and Humans, really had a common ancestor 5 million years ago. This study did not measure actual mutations in humans, so I call it a bogus study. So, please provide actual observable evidence to back up how many mutations are neutral, harmful, and beneficial. I've seen numbers and percentages, but are they have a basis in reality, are they really observed or are they calculated on the assumption like provided earlier in this paragraph.
Gosh, IBIG, how could anyone possibly get the idea that any ostensibly-innocent question of yours could be nothing more than a veiled attempt to play a 'gotcha' trick on those Ee-vil Darwinisticianistas?
Having trouble finding actual percentages of harmful, beneficial, and neutral mutations that are really observed?

IBelieveInGod · 21 January 2011

Would a mutation/mutations that cause the blood to loose ability to clot be considered beneficial? It would greatly reduce the risk of stroke, which could be considered a benefit, but then again the individual would most likely bleed to death, because of the inability of the blood to clot. So would it be considered a harmful mutation/mutations, neutral, or beneficial?

eric · 21 January 2011

Atheistoclast said: Both artificial and natural selection do indeed make use of an imperfect replication system (i.e random mutations). But that is where the similarity ends.
Progress! Since you admit that both selection processes make use of the same source of variation, it logically follows that the mutations produced by natural, unintelligent processes are fully capable of producing new species. Because those exact same mutations are the things used by humans to produce new species. Right?
Artificial selection always works by way of the conscious intent and will of the *artificer*.
That's nearly a tautology, since the way Darwin used the term 'artificial selection,' its pretty much defined as the selection humans do intentionally. But that's beside the point. From your earlier quote above, you agree that artificial selection works ON the genetic variation produced by nature. Correct?

eric · 21 January 2011

IBIG is just doing the Gish gallup.

Everyone, look at his last several posts. He's stopped even pretending to answer questions, and now just posts a different question every time.

DS · 21 January 2011

I tried to warn you guys. For some reason, you let this pathetic little twit completely screw up another perfectly good thread.

Maybe I can explain it in these terms. IBIGOT is a twelve year old boy who craves attention. His mother hates him, for obvious reasons, so she ignores him completely. She does however give him one dollar for every response he can get on internet blogs, this keeps him out of her hair while she drinks. Now IBIGOT uses the money to buy ammo for his assault rifle which he takes to school every day. Do you really want to respond to him again?

Ignore him and he will go away. Respond to him and you get exactly what you ask for. Ban him permanently and no one will have to deal with his crap. He already had his chance, he already blew it. Don't give him another chance. He still has his own thread, so why is he even here? That's just plain rude.

IBelieveInGod · 21 January 2011

eric said: IBIG is just doing the Gish gallup. Everyone, look at his last several posts. He's stopped even pretending to answer questions, and now just posts a different question every time.
My point of contention is; what are considered harmful, beneficial, and neutral mutations? How is the determination made? What is the basis of the determination? Are the mutations actually observed or are they just a calculation based on the assumption that evolution actually occurred? Whether a mutation is beneficial, harmful, or neutral in many cases is subjective, so how is the determination made?

Kevin B · 21 January 2011

eric said: IBIG is just doing the Gish gallup. Everyone, look at his last several posts. He's stopped even pretending to answer questions, and now just posts a different question every time.
A mutation has occurred! Is it beneficial, harmful or neutral? And would the answer be the same if IBIG were posting on a different blog?

IBelieveInGod · 21 January 2011

DS said: I tried to warn you guys. For some reason, you let this pathetic little twit completely screw up another perfectly good thread. Maybe I can explain it in these terms. IBIGOT is a twelve year old boy who craves attention. His mother hates him, for obvious reasons, so she ignores him completely. She does however give him one dollar for every response he can get on internet blogs, this keeps him out of her hair while she drinks. Now IBIGOT uses the money to buy ammo for his assault rifle which he takes to school every day. Do you really want to respond to him again? Ignore him and he will go away. Respond to him and you get exactly what you ask for. Ban him permanently and no one will have to deal with his crap. He already had his chance, he already blew it. Don't give him another chance. He still has his own thread, so why is he even here? That's just plain rude.
I'm not a twenty year old boy with and assault rifle, I don't even have a gun of any kind. How have I destroyed this perfectly good thread? I have asked questions about mutations, and somehow that is an egregious and despicable thing I have done? If this is a public forum about evolution, then I would think that you would welcome opposing views. Opposing views would only strengthen the theory of evolution, if indeed evolution is true. So, if you really feel that evolution is true, then you should have nothing to worry about, as this would give you the opportunity to answer those opposing views with brilliant evidence backed by real observation.

OgreMkV · 21 January 2011

Eric, yes IBIG is trying to find someone, anyone, to play his 'gotcha' game. In fact... it is EXACTLY the same game he played several months ago on the BW... same questions, same inane responses to the answers he got.

If the answer he got didn't say what he wanted to hear to play his 'gotcha' game, then he would harangue the answerer and 'interpret' his answer until the answerer got fed up and left... at which point IBIG would state that his interpretation was correct, make some totally inane conclusion and declare victory.

I predict that, if this thread is allowed to continue, that he will begin complaining that all these questions are to show us that there are moral absolutes and God is the reason for that. Of course, he's wrong, as I recently showed on his thread at ATBC. He's just too chicken to have an actual conversation on the subject.

I'll note that he thinks we play gotcha games with him. However, he has to lie, 'interpret', attack strawmen, etc. We (I) just have to tell the truth and use logic.

BTW: Hey 'clast, I'm sure you'll get to answering how you can tell the difference between a gene, organism, protein, or strucutre developed (either artificial or natural selection) in just a few posts. I'd hate to have someone think that you can't deal with such an idiotically simple question.

mrg · 21 January 2011

DS said: Ignore him and he will go away.
Pffft. He likes to bait people, people like to bait him back. It's a mutually satisfactory relationship, at least for folks who don't mind pounding their time down a rathole.

eric · 21 January 2011

IBelieveInGod said: I have asked questions about mutations, and somehow that is an egregious and despicable thing I have done?
What's egregious and despicable is you completely ignore the answers. You ask the same crap over and over again and refuse to converse about it. Here you claimed that speciation has never been observed. Here I linked to a whole list of observed speciations. So, converse with me instead of changing the subject. Do you admit your statment was incorrect? If not, how do you account for all those those observed speciations? Respond to evidence and counter-argument instead of just ignoring it.
If this is a public forum about evolution, then I would think that you would welcome opposing views.
When a parrot disagrees with me, I don't consider it an "opposing view." Its just a parrot. Your conversational capability appears to be that of a parrot: words come out, but you show no comprehension of the words going in. Granted, you learned "speciation has never been observed" instead of "polly want a cracker," but that's about the only difference.

Flint · 21 January 2011

Granted, you learned “speciation has never been observed” instead of “polly want a cracker,” but that’s about the only difference.

Here is the essential failure to communicate. Eric regards the statement as being based on evidence, so provides evidence as though it matters. IBIG regards the statement as proof-of-faith, has no clue how or why evidence ought to matter. When a statement is refuted by evidence, eric discards it. IBIG simply repeats it until it becomes true in the minds of the preached-at. If it does not, it's not his fault; he did his best. Both of these are approaches to knowledge, the trivial differencs being that in one case the knowledge is correct and in the other case the knowledge is absolutely certain. Correct is irrelevant.

Atheistoclast · 21 January 2011

It really doesn't matter who or what is doing the selecting, or what the "purpose" of the selector may be. All you're illustrating is that selection works, regardless of what does the selecting. And the limits to artifical selection are identical to the limits of natural selection - the variation in the current genome. And the reason they're identical is, selection is selection is selection. You are deliberately confusing the purpose of the selector, with the method used by the selector, which is differential reproductive rates. In both cases. To beat this dead horse a little further in to the ground, "artificial" selection is nothing more than a changed environment to the organism trying to breed. It really doesn't matter whether the organism knows or cares about the CAUSE of the change. It only matters which individuals end up breeding. For whatever reason.
Let me just repeat for the *asininely dense* in this forum: Natural selection tends to oppose what artificial selection develops. As breeders, we have managed to produce animals and plants which cannot survive in the wild. A chihuahua cannot compete for resources against a wolf or fox - it is essentially a deformed canid. Natural selection would oppose such changes, as with seedless fruit. There is no "environment" with respect to artificial selection - instead there is a human "requirement". Now, what we have been doing for thousands of years is really a form of *genetic engineering*...something natural selection cannot do. Artificial selection means making use of chance mutations to construct something which does not represent an increase in reproductive fitness, but rather in economic or social utility. What you lot don't understand is that natural selection is the worst possible force to explain the diversity of life on earth. Why would anything other than the likes of cyanobacteria exist when they are the most adaptable and reproductively fit organisms that can survive in virtually every possible ecological niche?

IBelieveInGod · 21 January 2011

eric said:
IBelieveInGod said: I have asked questions about mutations, and somehow that is an egregious and despicable thing I have done?
What's egregious and despicable is you completely ignore the answers. You ask the same crap over and over again and refuse to converse about it. Here you claimed that speciation has never been observed. Here I linked to a whole list of observed speciations. So, converse with me instead of changing the subject. Do you admit your statment was incorrect? If not, how do you account for all those those observed speciations? Respond to evidence and counter-argument instead of just ignoring it.
If this is a public forum about evolution, then I would think that you would welcome opposing views.
When a parrot disagrees with me, I don't consider it an "opposing view." Its just a parrot. Your conversational capability appears to be that of a parrot: words come out, but you show no comprehension of the words going in. Granted, you learned "speciation has never been observed" instead of "polly want a cracker," but that's about the only difference.
Really? So speciation has been observed? Or is it new species have been discovered? Are they really new species, or could it be that they were just never discovered before? Anyway let's get back to the topic at hand, mutations. Tell me how it is determined that any particular mutation is beneficial, harmful, or neutral? How makes the determination? If a mutation is beneficial in one aspect and harmful in another is it then determined to be beneficial, harmful or neutral?

IBelieveInGod · 21 January 2011

In the previous post I meant who makes the determination?

Gabriel Hanna · 21 January 2011

IBelieveInGod said:
eric said:
IBelieveInGod said: I have asked questions about mutations, and somehow that is an egregious and despicable thing I have done?
What's egregious and despicable is you completely ignore the answers. You ask the same crap over and over again and refuse to converse about it. Here you claimed that speciation has never been observed. Here I linked to a whole list of observed speciations. So, converse with me instead of changing the subject. Do you admit your statment was incorrect? If not, how do you account for all those those observed speciations? Respond to evidence and counter-argument instead of just ignoring it.
If this is a public forum about evolution, then I would think that you would welcome opposing views.
When a parrot disagrees with me, I don't consider it an "opposing view." Its just a parrot. Your conversational capability appears to be that of a parrot: words come out, but you show no comprehension of the words going in. Granted, you learned "speciation has never been observed" instead of "polly want a cracker," but that's about the only difference.
Really? So speciation has been observed? Or is it new species have been discovered? Are they really new species, or could it be that they were just never discovered before? Anyway let's get back to the topic at hand, mutations. Tell me how it is determined that any particular mutation is beneficial, harmful, or neutral? How makes the determination? If a mutation is beneficial in one aspect and harmful in another is it then determined to be beneficial, harmful or neutral?
Obviously, whether the effect is beneficial, harmful, or neutral is determined by the organims that has the mutation and the environment in lives in. If it's beneficial in one way, and harmful in another, then the net effect could be either. Like the mutation that causes sickle-cell anemia also confers resistance to malaria. Is that beneficial? If you live in a place where there isn't much malaria, no, but if you live in a place where malaria kills people regularly it's beneficial. Have you never heard of the concept of costs vs benefits? This is why all the other commenters are calling you stupid.

Gabriel Hanna · 21 January 2011

IBelieveInGod said: In the previous post I meant who makes the determination?
We can call a mutation anything we want, its effect on survival and reproduction is what determines whether its beneficial regardless of what we call it. Are you thinking there is some kind of Grand Council that confers gold medals on worthy mutations, or what? This is why the other commenters are calling you stupid.

DS · 21 January 2011

Atheistoclast said: Let me just repeat for the *asininely dense* in this forum: Natural selection tends to oppose what artificial selection develops. As breeders, we have managed to produce animals and plants which cannot survive in the wild. A chihuahua cannot compete for resources against a wolf or fox - it is essentially a deformed canid. Natural selection would oppose such changes, as with seedless fruit. There is no "environment" with respect to artificial selection - instead there is a human "requirement". Now, what we have been doing for thousands of years is really a form of *genetic engineering*...something natural selection cannot do. Artificial selection means making use of chance mutations to construct something which does not represent an increase in reproductive fitness, but rather in economic or social utility. What you lot don't understand is that natural selection is the worst possible force to explain the diversity of life on earth. Why would anything other than the likes of cyanobacteria exist when they are the most adaptable and reproductively fit organisms that can survive in virtually every possible ecological niche?
Wrong again. Natural selection can oppose or augment what artificial selection can do. So what? There is still an environment even for artificial selection, otherwise, how could natural selection oppose artificial selection? You contradicted yourself there. Genetic engineering is not just selective breeding. You are once again mistaken. Natural selection can produce complexity and diversity, it s=just depends on the environment and how it changes. Bacteria are still with us, but other organisms have also evolved. You have provided no reason why they couldn't. Artificial selection is irrelevant to this argument. The fact that bacteria persist does not imply that nothing else could ever evolve. Or do you think that every biologist in the world is too stupid to realize that bacteria still exist? Since you still cannot bring yourself to admit that you were wrong a bout duplicated genes, I'll make it easy for you. If I have two cars and one can will not start I can still drive to the store. There, do you get it now?

Gabriel Hanna · 21 January 2011

IBelieveInGod said:
eric said:
IBelieveInGod said: I have asked questions about mutations, and somehow that is an egregious and despicable thing I have done?
What's egregious and despicable is you completely ignore the answers. You ask the same crap over and over again and refuse to converse about it. Here you claimed that speciation has never been observed. Here I linked to a whole list of observed speciations. So, converse with me instead of changing the subject. Do you admit your statment was incorrect? If not, how do you account for all those those observed speciations? Respond to evidence and counter-argument instead of just ignoring it.
If this is a public forum about evolution, then I would think that you would welcome opposing views.
When a parrot disagrees with me, I don't consider it an "opposing view." Its just a parrot. Your conversational capability appears to be that of a parrot: words come out, but you show no comprehension of the words going in. Granted, you learned "speciation has never been observed" instead of "polly want a cracker," but that's about the only difference.
Really? So speciation has been observed? Or is it new species have been discovered? Are they really new species, or could it be that they were just never discovered before? Anyway let's get back to the topic at hand, mutations. Tell me how it is determined that any particular mutation is beneficial, harmful, or neutral? How makes the determination? If a mutation is beneficial in one aspect and harmful in another is it then determined to be beneficial, harmful or neutral?
this is why people are calling you a troll. They gave you a link that stated clearly, THESE ARE OBSERVATIONS OF NEW SPECIES FORMING. You refused to look at the link and then just repeated yourself. "Are they really NEW species, or just newly discovered?" THEY ARE REALLY NEW, genius.

John Kwok · 21 January 2011

IBelieveInGod said:
DS said: I tried to warn you guys. For some reason, you let this pathetic little twit completely screw up another perfectly good thread. Maybe I can explain it in these terms. IBIGOT is a twelve year old boy who craves attention. His mother hates him, for obvious reasons, so she ignores him completely. She does however give him one dollar for every response he can get on internet blogs, this keeps him out of her hair while she drinks. Now IBIGOT uses the money to buy ammo for his assault rifle which he takes to school every day. Do you really want to respond to him again? Ignore him and he will go away. Respond to him and you get exactly what you ask for. Ban him permanently and no one will have to deal with his crap. He already had his chance, he already blew it. Don't give him another chance. He still has his own thread, so why is he even here? That's just plain rude.
I'm not a twenty year old boy with and assault rifle, I don't even have a gun of any kind. How have I destroyed this perfectly good thread? I have asked questions about mutations, and somehow that is an egregious and despicable thing I have done? If this is a public forum about evolution, then I would think that you would welcome opposing views. Opposing views would only strengthen the theory of evolution, if indeed evolution is true. So, if you really feel that evolution is true, then you should have nothing to worry about, as this would give you the opportunity to answer those opposing views with brilliant evidence backed by real observation.
You have yet to respond legitimately to any of my observations, but instead, respond by merely uttering more instances of breathtaking inanity. DS is absolutely right and I think it's time that you take a permanent vacation where you belong, the Bathroom Wall. Depart this thread henceforth immediately!!!

John Kwok · 21 January 2011

IBelieveInGod said: In the previous post I meant who makes the determination?
I determined a long time ago that you are best suited as potential nourishment for a starving python or crocodile.

OgreMkV · 21 January 2011

'clast,

So, my understanding is that you cannot tell the difference between an organism that developed by natural selection and one developed by artificial selection. Is this correct?

If this is not correct, please describe the procedure that objectively classifies an organism as developing via natural or artificial selection.

Saying "artificial selection makes thngs that can't survive in the wild" is a simply ridiculous classification system. Without corrective lenses, I can't survive in the wild. Am I a product of artificial sslection then?

Any researcher should be able to apply your determinination procedure to any organism (or gene or protein or structure) and every single researcher should get the same result (i.e. this organism was developed via natural selection and not artificial selection).

So what criteria do you use to make this determination?

I maintain that you cannot do this. I maintain that there is no difference in the organism, gene, protein, or biologic structure that could possibly indicate artificial or natural selection. The reason is that they are the exact same thing. They use the same starting material, they use the same mutations, and they can result in the same changes. The only difference is the environment of the organism and that isn't reflected in the DNA.

For their environment (little old ladies homes*) the chihuahua is extremely well adapted. In fact, I bet they generally life longer lives than any truly wild dogs (wolves, coyotes, dingos, etc). The ones that do reproduce probably reproduce way more than wild dogs with a much, much higher of surviving offspring. By any measure, they are just as succesful, if not more-so than their wild counterparts.

If you cannot determine the difference between natural and artificial selection by observing the organism, then your entire argument is useless.

*This is a joke people.

Dave Lovell · 21 January 2011

IBelieveInGod said: Are they really new species, or could it be that they were just never discovered before?
Surely this is one thing that we can all agree with you on. You believe "kinds" have speciated many times (100 of thousands of times in the case of beetles) in the last few thousand years. Is not the only point in dispute timescale?

stevaroni · 21 January 2011

fnxtr said: OT: I'm hoping CFL's will soon go the way of Laserdisc. Wiring a house for low-voltage LED's would be *so* much easier!
I do a lot of custom engineering for the film and video industry, and consequently, my place often has a lot of broadcast-type equipment hanging around. In my last house I went through the trouble of installing a big 12 volt power supply in my shop and dropping 12 volt outlets in strategic spots in the shop and house (there's an industry standard 4 pin connector) It was actually surprisingly practical, since it allowed me to loose a lot of wall warts, and I calculated that the one efficient supply actually wasted less power.

Atheistoclast · 21 January 2011

There is still an environment even for artificial selection, otherwise, how could natural selection oppose artificial selection? You contradicted yourself there.
There is no natural environment or fitness landscape. There is only the requirement of the breeder. Chihuahuas are bred to survive under human conditions, not those of Nature.
Genetic engineering is not just selective breeding. You are once again mistaken.
Evidently you have a problem reading English. I stated that selective breeding was a form of genetic engineering.
Natural selection can produce complexity and diversity, it just depends on the environment and how it changes.
Nonsense. Natural selection *reduces* diversity. It does not proliferate variation. How, may I ask, does the environment produce domains for DNA-binding or cell cycle regulation? Do you even know what I am talking about?
Bacteria are still with us, but other organisms have also evolved. You have provided no reason why they couldn't. Artificial selection is irrelevant to this argument. The fact that bacteria persist does not imply that nothing else could ever evolve. Or do you think that every biologist in the world is too stupid to realize that bacteria still exist?
The point is that bacteria are the most effective means of securing DNA replication. That is why there is no natural reason why anything should or would have evolved beyond prokaryotic life.
Since you still cannot bring yourself to admit that you were wrong a bout duplicated genes, I'll make it easy for you. If I have two cars and one can will not start I can still drive to the store. There, do you get it now?
How ,in any way, was I wrong about duplicated genes? Your inability to understand a basic sequence alignment really testifies to your lack of understanding in this subject. I will pass on your stupid analogy.

stevaroni · 21 January 2011

Atheistoclast said: The former requires an intelligence to select those variations that meet the particular *purpose* in mind. The latter's sole criterion is reproductive fitness and nothing else. If it is beneficial to lose functionality, because it confers a survival advantage, then natural selection will go down that route.
Huh? Artificial selection requires selection and natural selection requires selection but somehow you can't use one for a model of the other because selection /= selection when someone does it on purpose rather than through a mechanistic process? If I select animals for greyhound racing and only the fastest individuals get to breed this is somehow not analogous to what happens if only the fastest animals can outrun the cheetah and live to breed?

IBelieveInGod · 21 January 2011

Gabriel Hanna said:
IBelieveInGod said:
eric said:
IBelieveInGod said: I have asked questions about mutations, and somehow that is an egregious and despicable thing I have done?
What's egregious and despicable is you completely ignore the answers. You ask the same crap over and over again and refuse to converse about it. Here you claimed that speciation has never been observed. Here I linked to a whole list of observed speciations. So, converse with me instead of changing the subject. Do you admit your statment was incorrect? If not, how do you account for all those those observed speciations? Respond to evidence and counter-argument instead of just ignoring it.
If this is a public forum about evolution, then I would think that you would welcome opposing views.
When a parrot disagrees with me, I don't consider it an "opposing view." Its just a parrot. Your conversational capability appears to be that of a parrot: words come out, but you show no comprehension of the words going in. Granted, you learned "speciation has never been observed" instead of "polly want a cracker," but that's about the only difference.
Really? So speciation has been observed? Or is it new species have been discovered? Are they really new species, or could it be that they were just never discovered before? Anyway let's get back to the topic at hand, mutations. Tell me how it is determined that any particular mutation is beneficial, harmful, or neutral? How makes the determination? If a mutation is beneficial in one aspect and harmful in another is it then determined to be beneficial, harmful or neutral?
this is why people are calling you a troll. They gave you a link that stated clearly, THESE ARE OBSERVATIONS OF NEW SPECIES FORMING. You refused to look at the link and then just repeated yourself. "Are they really NEW species, or just newly discovered?" THEY ARE REALLY NEW, genius.
Gabriel Hanna said:
IBelieveInGod said: In the previous post I meant who makes the determination?
We can call a mutation anything we want, its effect on survival and reproduction is what determines whether its beneficial regardless of what we call it. Are you thinking there is some kind of Grand Council that confers gold medals on worthy mutations, or what? This is why the other commenters are calling you stupid.
So there is no way of actually knowing if a currently observed mutation is beneficial, harmful, or neutral? I'm stupid for asking questions? You see I hear percentages of what are harmful, beneficial, and neutral mutations.

stevaroni · 21 January 2011

IBelieveInGod said: Is disease an example of bad mutations?
Well, from an evolutionary point of view, there's bad, and then there's bad. For example, there's progeria, which causes premature aging and invariably kills it's victems before sexual maturity. In evolutionary terms, this is a very bad disease, and is quickly culled from the gene pool. on the other hand, there is Parkinsons disease, an affliction that strikes later in life, after the individual has reproduced and passed his genes on. Since there is no disability at sexual maturity, there is no selection pressure against the gene so the gene merrily passes on. there are some pockets in Brazil where 50% of the elder population has Parkinsons. And actually, "disease" is sometimes a relative term. In the western world, the genetic disease sickle cell anemia is debilitating and life-shortening. But in tropical Africa, where the condition originated, it's actually a useful adaptation since sickle-cells aren't susceptible to malaria, so the individual, though somewhat less fit generally, is much more likely to survive to sexual maturity. And, let us not forget that "good" and "bad' are all relative. From a human point of view, MSRA is a very "bad" strain of streptococcus sice it's very hard to kill. From a streptococcal point of view, MSRA is a fantastic improvement, since it allows more opportunity in the face of poisonous environments.

stevaroni · 21 January 2011

IBelieveInGod said: So there is no way of actually knowing if a currently observed mutation is beneficial, harmful, or neutral?
Sure there is. You just have to drop the mutation into an environment and observe whether it helps, hurts, or does nothing.
I'm stupid for asking questions?
No, you're stupid for purposely ignoring the subtitles of the answer. You're asking a question like "I have a handful of screws, what are the chances they'll help with the machine I'm working on?". That question does have an answer, but it's not a simple "13%" - it's going to be situationaly dependent. If you were to go out to my shop, and open the drawer marked #6, and take a handful of machine screws, I could tell you that they'll probably be useful in small machines built in North America, but almost useless in Japanese cameras and cars. Likewise, if you tell me that the savanna grasses are dying, what are the survival implications of changing an organism's neck length, I could give you a coherent answer.

Kevin B · 21 January 2011

Atheistoclast said:
There is still an environment even for artificial selection, otherwise, how could natural selection oppose artificial selection? You contradicted yourself there.
There is no natural environment or fitness landscape. There is only the requirement of the breeder. Chihuahuas are bred to survive under human conditions, not those of Nature.
Mere quibbling. There is an environment. The actions of the breeder merely adjust the parameters somewhat. The human/Nature dichotomy is just another variant of the "It's Designed" fallacy.
Genetic engineering is not just selective breeding. You are once again mistaken.
Evidently you have a problem reading English. I stated that selective breeding was a form of genetic engineering.
Natural selection can produce complexity and diversity, it just depends on the environment and how it changes.
Nonsense. Natural selection *reduces* diversity. It does not proliferate variation. How, may I ask, does the environment produce domains for DNA-binding or cell cycle regulation? Do you even know what I am talking about?
Selection reduces variation. Gene duplication, point mutation, sexual reproduction, (and the rest....) generate the variation that selection discriminates for and against. The fact that you can even ask "does the environment produce domains for DNA-binding" shows that you simply do not have the slightest understanding of what you're trying to argue against.
Bacteria are still with us, but other organisms have also evolved. You have provided no reason why they couldn't. Artificial selection is irrelevant to this argument. The fact that bacteria persist does not imply that nothing else could ever evolve. Or do you think that every biologist in the world is too stupid to realize that bacteria still exist?
The point is that bacteria are the most effective means of securing DNA replication. That is why there is no natural reason why anything should or would have evolved beyond prokaryotic life.
Since you still cannot bring yourself to admit that you were wrong a bout duplicated genes, I'll make it easy for you. If I have two cars and one can will not start I can still drive to the store. There, do you get it now?
How ,in any way, was I wrong about duplicated genes? Your inability to understand a basic sequence alignment really testifies to your lack of understanding in this subject. I will pass on your stupid analogy.
What has sequence alignment got to do with this? You are just trying to confuse the issue with non-sequiturs. Try a programming analogy. Only yesterday I took a copy of a program and edited the copy to make it do something completely different. The original program remains and still works, and worked even during the period when the copy was incomplete and non-functional. Please explain why the same principle doesn't work for genes.

Gabriel Hanna · 21 January 2011

IBelieveInGod said:
Gabriel Hanna said:
IBelieveInGod said:
eric said:
IBelieveInGod said: I have asked questions about mutations, and somehow that is an egregious and despicable thing I have done?
What's egregious and despicable is you completely ignore the answers. You ask the same crap over and over again and refuse to converse about it. Here you claimed that speciation has never been observed. Here I linked to a whole list of observed speciations. So, converse with me instead of changing the subject. Do you admit your statment was incorrect? If not, how do you account for all those those observed speciations? Respond to evidence and counter-argument instead of just ignoring it.
If this is a public forum about evolution, then I would think that you would welcome opposing views.
When a parrot disagrees with me, I don't consider it an "opposing view." Its just a parrot. Your conversational capability appears to be that of a parrot: words come out, but you show no comprehension of the words going in. Granted, you learned "speciation has never been observed" instead of "polly want a cracker," but that's about the only difference.
Really? So speciation has been observed? Or is it new species have been discovered? Are they really new species, or could it be that they were just never discovered before? Anyway let's get back to the topic at hand, mutations. Tell me how it is determined that any particular mutation is beneficial, harmful, or neutral? How makes the determination? If a mutation is beneficial in one aspect and harmful in another is it then determined to be beneficial, harmful or neutral?
this is why people are calling you a troll. They gave you a link that stated clearly, THESE ARE OBSERVATIONS OF NEW SPECIES FORMING. You refused to look at the link and then just repeated yourself. "Are they really NEW species, or just newly discovered?" THEY ARE REALLY NEW, genius.
Gabriel Hanna said:
IBelieveInGod said: In the previous post I meant who makes the determination?
We can call a mutation anything we want, its effect on survival and reproduction is what determines whether its beneficial regardless of what we call it. Are you thinking there is some kind of Grand Council that confers gold medals on worthy mutations, or what? This is why the other commenters are calling you stupid.
So there is no way of actually knowing if a currently observed mutation is beneficial, harmful, or neutral? I'm stupid for asking questions? You see I hear percentages of what are harmful, beneficial, and neutral mutations.
Yes, there is a way of knowing, and there are degrees of harm and benefit. You're not stupid because you are asking questions--you are stupid for asking stupid questions and refusing to listen to the answers. Your questions about percentage of "beneficial" mutations is like asking what percentage of people are "beautiful". Different people have different ideas of what beauty is, and those ideas vary with time, place, culture and fashion. But this doesn't mean that beautiful people don't exist, or that it's meaningless to call someone beautiful. It does mean that asking "what percentage of people are beautiful" is a stupid question and impossible to answer unless you make it very clear what you mean by beautiful. It is the same with the benefit or harm conferred by mutations. The overall reproductive success of the organism is what determines the benefit, and this benefit can change with different circumstances. There's no way to look at a snippet of DNA and say "AH, a beneficial mutation". Because you are stupid, you think hair splitting games are a substitute for argument. It's like asking me what percentage of a man's hair must be missing before we call him "bald".

DS · 21 January 2011

Atheistoclast said: There is no natural environment or fitness landscape. There is only the requirement of the breeder. Chihuahuas are bred to survive under human conditions, not those of Nature.
Bullshit. You cannot breed without an environment. Humans cannot control all aspects of the environment or development. Therefore, you are wrong. Genetic engineering is more than just selective breeding. You are not using the term incorrectly. If you mean selective breeding then say so.
Nonsense. Natural selection *reduces* diversity. It does not proliferate variation. How, may I ask, does the environment produce domains for DNA-binding or cell cycle regulation? Do you even know what I am talking about?
I know you are talking bullshit. You once again conveniently forgot about mutation. That coupled with selection produces diversity. Get a clue.
The point is that bacteria are the most effective means of securing DNA replication. That is why there is no natural reason why anything should or would have evolved beyond prokaryotic life.
Bullshit. Bacteria are the best replicators in some environments. There is no reason why anything else had to evolve, but it did. You cannot deny that it did. All you can do is nitpick mechanisms. Since you still cannot bring yourself to admit that you were wrong a bout duplicated genes, I'll make it easy for you. If I have two cars and one can will not start I can still drive to the store. There, do you get it now?
How ,in any way, was I wrong about duplicated genes? Your inability to understand a basic sequence alignment really testifies to your lack of understanding in this subject. I will pass on your stupid analogy.
You claimed that the duplicated copy would be selected against. That is wrong. Admit it. Duplicated copies can be removed from functional constraints. It is true whether you admit it or not. The fact that you cannot refute even the analogy tells me that you know you are wrong. You cannot explain pseudogenes because you refuse to accept this basic point.

Bobsie · 21 January 2011

Here is a back of the envelope accounting.

If mutations occur evenly across the entire genome and only 2% of the DNA is coding. Then only 2% of the mutations have the potential to be immediately harmful and/or beneficial or more likely than not, neutral. Of the 98% of the remaining mutations, they will be de facto neutral (if a tree falls in the forest ...) with a potential upside to be beneficial if a new gene regulatory function results. (see Sean Carroll's work if truly interested)

You are of the mistaken notion that there is an ongoing catalog of all mutations and each gets classified into one of your categories immediately. Genome sequencing is making great advances but I assure you, your understanding is quite sophomoric. That you continue to insist on that delusion only adds to your irrelevancy to biological science reality.

Ever try explaining Quantum Mechanics to a four year old? Yes, they ask a lot of questions but the questions more often exposes the child's incompetence rather than indicate any deep understand of the material and the implications of any of the concepts. If you cannot add anything to the intelligence of the conversation, you are merely the four year old distracting child.

eric · 21 January 2011

Gabriel Hanna said: this is why people are calling you a troll. They gave you a link that stated clearly, THESE ARE OBSERVATIONS OF NEW SPECIES FORMING. You refused to look at the link and then just repeated yourself.
That's exactly right. IBIG, if you ask "are there new species" and someone provides evidence that, yes, there are, you do not make your arguments strong by replying "but are they really new species?" Look at the frakking evidence provided. And your argument won't get any stronger if you then ask "but are they really really new species," or asking "are they really really REALLY news species? Really?" Naked incredulity is a stupid non-argument, and getting more incredulous does not make it less stupid, it makes it more stupid. The way you make your argument stronger is to read the evidence provided and say what about the evidence you think is incorrect. You seem to be incapable of doing that. As predicted, you just continued the Gish gallop by changing the subject and asking a different question. A parrot that learns many different phrases is more impressive than a parrot that only learns one, but you still aren't really trying to have a conversation, because you have absolutely no intention of considering anyone else's arguments. You are talking at us rather than with us. You are advertising. Grandstanding. Proselytizing.

John Kwok · 21 January 2011

Atheistoclast said: Natural selection tends to oppose what artificial selection develops. As breeders, we have managed to produce animals and plants which cannot survive in the wild. A chihuahua cannot compete for resources against a wolf or fox - it is essentially a deformed canid. Natural selection would oppose such changes, as with seedless fruit. What you lot don't understand is that natural selection is the worst possible force to explain the diversity of life on earth. Why would anything other than the likes of cyanobacteria exist when they are the most adaptable and reproductively fit organisms that can survive in virtually every possible ecological niche?
Apparently the mosquitoes in the London Underground Subway system didn't heed your message about natural selection being "the worst possible force to explain the diversity of life on earth", since they evolved into a new species in the more than one hundred and forty-odd years since the subway was first dug as noted here: http://www.nature.com/hdy/journal/v82/n1/full/6884120a.html Here are four more examples of recent speciation as noted in the Talk Origins archive and I am merely scratching the surface: http://www.talkorigins.org/faqs/speciation.html

stevaroni · 21 January 2011

Atheistoclast said: Natural selection tends to oppose what artificial selection develops. As breeders, we have managed to produce animals and plants which cannot survive in the wild. A chihuahua cannot compete for resources against a wolf or fox
Huh? Take a dog and put it in an environment with really weird selection pressures (like fitting into Paris Hilton's purse) and you end up with a chihuahua. Now take that animal and put it into an environment that has nothing to do with the selection pressures that formed it, and it does poorly. And you're surprised at this? Take the wolf and let it loose in a tight city and see how long it lasts before the predator species animacontrolius commonus selects against it. It's like complaining that if you take a porpoise and drop it into the savannas of its ancestors it does poorly.

Dave Wisker · 21 January 2011

Athgeistoclast writes:
What you lot don’t understand is that natural selection is the worst possible force to explain the diversity of life on earth. Why would anything other than the likes of cyanobacteria exist when they are the most adaptable and reproductively fit organisms that can survive in virtually every possible ecological niche?
Basic ecology, yet another subject Atheistoclast appears to know nothing about.

eric · 21 January 2011

Atheistoclast said: Nonsense. Natural selection *reduces* diversity. It does not proliferate variation.
It does both. When cheetahs kill the slower or more developmentally unusual Thompson's gazelles, they are reducing tommy variation. When lions move into the area and kill/drive off the cheetahs, tommy variation goes up. Natural selection by lions increases tommy variation.
The point is that bacteria are the most effective means of securing DNA replication. That is why there is no natural reason why anything should or would have evolved beyond prokaryotic life.
Competition is the reason. When the most ideal ecosystem for DNA replication becomes full of critters, some of those critters will have to change ecosystems or die. If you and your buddy prokaryote are regularly outcompeted in your home environment, but YOU happen to be born with the ability to utilize some other, less ideal, source of food, you will survive and pass on your genes. Your buddy will not. In some respects the evolution of complex life may be considered to be a never-ending series of losers being exiled/running away from the winners. "Out of africa" is not so much a story of intrepid human explorers, as it is a story of the weakest ape kids getting kicked out of the troop and having to move away from the comfortable terrority into the unknown to support themselves.

DS · 21 January 2011

The atheist guy is somehow confusing the environment with selection pressure. Perhaps a reasonable mistake, but when corrected he once again refused to admit that he was wrong and persisted in his misconceptions. This is the only way in which he can continue to be a rebel without a clue. Or is he a maverick? I can't tell.

Atheistoclast · 21 January 2011

Mere quibbling. There is an environment. The actions of the breeder merely adjust the parameters somewhat. The human/Nature dichotomy is just another variant of the "It's Designed" fallacy.
No, the breeder proactively selects certain variations for their perceived utility and so alters the natural course.
Selection reduces variation. Gene duplication, point mutation, sexual reproduction, (and the rest....) generate the variation that selection discriminates for and against. The fact that you can even ask "does the environment produce domains for DNA-binding" shows that you simply do not have the slightest understanding of what you're trying to argue against.
Er...what is the difference between variation and genetic diversity? And I'd like to know how environmental pressures can generate something like the DNA-binding homeodomain.
What has sequence alignment got to do with this? You are just trying to confuse the issue with non-sequiturs. Try a programming analogy. Only yesterday I took a copy of a program and edited the copy to make it do something completely different. The original program remains and still works, and worked even during the period when the copy was incomplete and non-functional. Please explain why the same principle doesn't work for genes.
The most powerful piece of evidence presented in my paper was the sequence alignment showing that the classic examples of gene duplication and adaptation entailed significant deletions of information. Your analogy is baseless. For the two succinct reasons: 1) Gene duplicates tend to serve as backups for each other. If you change the functionality of a duplicate it prevents it from compensating for any damage done to a paralog. 2) Natural selection has no intelligence and cannot change a gene or program as a human would. Trial and error can only get you so far. All gene duplicates end up as variations of the same theme. You will find gene families with lots of paralogous members but all doing pretty much the same thing - albeit with minor and subtle differences in function and expression.

OgreMkV · 21 January 2011

Atheistoclast said:
Mere quibbling. There is an environment. The actions of the breeder merely adjust the parameters somewhat. The human/Nature dichotomy is just another variant of the "It's Designed" fallacy.
No, the breeder proactively selects certain variations for their perceived utility and so alters the natural course.
Define 'natural course'. You are assuming that anything humans do is not natural. This is not a correct assumption.
Selection reduces variation. Gene duplication, point mutation, sexual reproduction, (and the rest....) generate the variation that selection discriminates for and against. The fact that you can even ask "does the environment produce domains for DNA-binding" shows that you simply do not have the slightest understanding of what you're trying to argue against.
Er...what is the difference between variation and genetic diversity? And I'd like to know how environmental pressures can generate something like the DNA-binding homeodomain.
Ah, the famous "If evolution works then how did X come about". What if we can't explain why X came about? So what? If you think that because we can't currently explain X that evolution is wrong... you are using a fallacious argument and you are wrong.
What has sequence alignment got to do with this? You are just trying to confuse the issue with non-sequiturs. Try a programming analogy. Only yesterday I took a copy of a program and edited the copy to make it do something completely different. The original program remains and still works, and worked even during the period when the copy was incomplete and non-functional. Please explain why the same principle doesn't work for genes.
The most powerful piece of evidence presented in my paper was the sequence alignment showing that the classic examples of gene duplication and adaptation entailed significant deletions of information.
Third request... define "information" in this context. Because you still haven't answered so simple a request, then I will assume you are purposely keeping the definition as vague as possible because you know that any definition you choose can be shown to be wrong. Further, when presented with one example of how wrong you are, you will immediately revert to a different definition and say, "no, this is what I'm talking about." Repeat until we get sick of your antics. Dude, really.
Your analogy is baseless. For the two succinct reasons: 1) Gene duplicates tend to serve as backups for each other. If you change the functionality of a duplicate it prevents it from compensating for any damage done to a paralog. 2) Natural selection has no intelligence and cannot change a gene or program as a human would. Trial and error can only get you so far.
Care to bet on that. I bet that evolution can produce systems that no human designer could. In fact, I'll bet evolution can produce a system that humans can't even understand. Further, I'll point out that the results of evolution as science describes it is exactly what we see in the real world. There's a reason that there are massive problems with modern organisms, everything from the human eye being backwards to hernias are caused by our evolutionary legacy.
All gene duplicates end up as variations of the same theme. You will find gene families with lots of paralogous members but all doing pretty much the same thing - albeit with minor and subtle differences in function and expression.
Really? So the bacterial flagellum (well the motor proteins are exactly the same as the ATP production system that they are homologous to? I didn't know that... fascinating (end sarcasm). BTW: You still haven't answered the question of if you can tell natural selection from artificial selection. If you can't (and you can't), then your entire argument is useless... still.

RBH · 21 January 2011

Atheistoclast said: All gene duplicates end up as variations of the same theme. You will find gene families with lots of paralogous members but all doing pretty much the same thing - albeit with minor and subtle differences in function and expression.
Which brings us full circle back to the research in the OP: A new function (antifreeze) from an old duplicated gene that did something quite different, much more than a "minor and subtle" difference.

Kevin B · 21 January 2011

Atheistoclast said:
Mere quibbling. There is an environment. The actions of the breeder merely adjust the parameters somewhat. The human/Nature dichotomy is just another variant of the "It's Designed" fallacy.
No, the breeder proactively selects certain variations for their perceived utility and so alters the natural course.
As I said. Mere quibbling. You are making an arbitrary and entirely spurious distinction between natural selection and artificial selection.
Selection reduces variation. Gene duplication, point mutation, sexual reproduction, (and the rest....) generate the variation that selection discriminates for and against. The fact that you can even ask "does the environment produce domains for DNA-binding" shows that you simply do not have the slightest understanding of what you're trying to argue against.
Er...what is the difference between variation and genetic diversity? And I'd like to know how environmental pressures can generate something like the DNA-binding homeodomain.
What has sequence alignment got to do with this? You are just trying to confuse the issue with non-sequiturs. Try a programming analogy. Only yesterday I took a copy of a program and edited the copy to make it do something completely different. The original program remains and still works, and worked even during the period when the copy was incomplete and non-functional. Please explain why the same principle doesn't work for genes.
The most powerful piece of evidence presented in my paper was the sequence alignment showing that the classic examples of gene duplication and adaptation entailed significant deletions of information. Your analogy is baseless. For the two succinct reasons: 1) Gene duplicates tend to serve as backups for each other. If you change the functionality of a duplicate it prevents it from compensating for any damage done to a paralog. 2) Natural selection has no intelligence and cannot change a gene or program as a human would. Trial and error can only get you so far. All gene duplicates end up as variations of the same theme. You will find gene families with lots of paralogous members but all doing pretty much the same thing - albeit with minor and subtle differences in function and expression.
I see you got the point of my analogy and are trying to pretend that you didn't. Once there are two copies of a gene one (or the other) of the copies can suffer a deleterious mutation without it affecting the fitness of the organism. Once one copy has changed, mutation of the other will have fitness consequences, and so will tend to be selected against, but the first changed copy can continue to mutate without impact unless and until the changes lead to a form that changes the fitness. Your point 1) is backwards. Your point 2) is a restatement of the tired old "too difficult" fallacy. You are just as wrong as Dembski is in trying to argue against Dawkin's Weasel program.

DS · 21 January 2011

Atheistoclast said: Your analogy is baseless. For the two succinct reasons: 1) Gene duplicates tend to serve as backups for each other. If you change the functionality of a duplicate it prevents it from compensating for any damage done to a paralog. 2) Natural selection has no intelligence and cannot change a gene or program as a human would. Trial and error can only get you so far. All gene duplicates end up as variations of the same theme. You will find gene families with lots of paralogous members but all doing pretty much the same thing - albeit with minor and subtle differences in function and expression.
1) My second car is only needed as a back up if the first car doesn't work. Since the organism survived just fine for millions of years before the gene duplication occurred, your hypothesis is falsified. Besides, you can have three cars, one as backup and one that does other things like plows your driveway or tows your boat. And before you go there, the third car could become nonfunctional or serve a completely different function, such as flower bed or sculpture. Since selection has no foresight, the organism could go extinct if the second copy didn't serve as a backup, but since it was NOT intelligently designed this happens all the time. 2) Maybe, but you have failed to demonstrate how far. HINT: it ain't how far you would like to think. 3) All gene duplication do not end up as variations on the same theme. Some definitely take on novel functions. The bacterial genes have already been presented as an example. I also presented an example from fish that you ignored. Many examples exist. Apparently you are ignorant of them. That doesn't alter the fact that, once again, you are dead wrong.

Stanton · 21 January 2011

Atheistoclast said: What you lot don't understand is that natural selection is the worst possible force to explain the diversity of life on earth. Why would anything other than the likes of cyanobacteria exist when they are the most adaptable and reproductively fit organisms that can survive in virtually every possible ecological niche?
And yet, you and all other Creationists/Intelligent Design proponents refuse to explain why God magically poofing organisms into existence, using magic, is supposed to be a superior explanation.

eric · 21 January 2011

DS said: The atheist guy is somehow confusing the environment with selection pressure.
He's also confusing mutation and selection. Or maybe he's just doing the old creationist goalpost move: start at 'it is physically impossible for that biochemical reaction to occur,' but when someone questions that, move to 'such an animal would not likely survive to pass on its genes.' Ah, the classics. My client was nowhere near the crime scene your honor, and anyway, it was self-defense.

Dave Wisker · 21 January 2011

eric said:
DS said: The atheist guy is somehow confusing the environment with selection pressure.
He's also confusing mutation and selection. Or maybe he's just doing the old creationist goalpost move: start at 'it is physically impossible for that biochemical reaction to occur,' but when someone questions that, move to 'such an animal would not likely survive to pass on its genes.' Ah, the classics. My client was nowhere near the crime scene your honor, and anyway, it was self-defense.
He's also pretty clueless about the basic concept of a niche.

John Vanko · 21 January 2011

RBH said:
IBelieveInGod said: Playing a game with percentages? I'm asking what percentage of mutations are good, bad, and neutral. Are you afraid to answer that question, because you think it is a gotcha? Why would you be concerned about a gotcha?
Your question was answered. Read for comprehension or risk banishment to the Bathroom Wall.
Since this IS a public forum, and we live in a democracy, IF we voted on banishing IBIG to the BW (or out of PT altogether), could you get rid of him for us? On the other hand, if this forum is a meritocracy (like science), with peer review, could we not banish IBIG's posts to the BW for failing to pass muster (as they always fail)?

RBH · 21 January 2011

John Vanko said: Since this IS a public forum, and we live in a democracy, IF we voted on banishing IBIG to the BW (or out of PT altogether), could you get rid of him for us? On the other hand, if this forum is a meritocracy (like science), with peer review, could we not banish IBIG's posts to the BW for failing to pass muster (as they always fail)?
The Thumb is neither a meritocracy nor a democracy, it's a (usually) benevolent dictatorship. The main goals (for me, at least) are education and intellectual recreation, and people like IBIG help advance both. His clueless comments provide the opportunity to correct him, for the lurkers if no one else, and thus serve the educational goal by exemplifying the sheer ignorance and perversity of the opposition. We need to be reminded of that, I think. And the recreation comes in the effort to solve the puzzles the cluelessness of his comments embody: 'Just what is he claiming now?'

seebs · 21 January 2011

No, clastie never wrote my bosses. He does, however, continue to call me "Herr Seebach", presumably to go along with his repeated allegations that my side lost WWII (see, it's a German name, right, so that means I'm German!).

And to correct one of the other posters: I'm not "Dr. Seebach". I got a B.A. in psychology, and that's it. I'm just some guy who programs because it's fun.

I am so glad to see that he is continuing to amuse.

RBH · 21 January 2011

Hiya seebs! Long time no see!

DS · 21 January 2011

RBH said:
John Vanko said: Since this IS a public forum, and we live in a democracy, IF we voted on banishing IBIG to the BW (or out of PT altogether), could you get rid of him for us? On the other hand, if this forum is a meritocracy (like science), with peer review, could we not banish IBIG's posts to the BW for failing to pass muster (as they always fail)?
The Thumb is neither a meritocracy nor a democracy, it's a (usually) benevolent dictatorship. The main goals (for me, at least) are education and intellectual recreation, and people like IBIG help advance both. His clueless comments provide the opportunity to correct him, for the lurkers if no one else, and thus serve the educational goal by exemplifying the sheer ignorance and perversity of the opposition. We need to be reminded of that, I think. And the recreation comes in the effort to solve the puzzles the cluelessness of his comments embody: 'Just what is he claiming now?'
I must respectfully disagree. That is what the bathroom wall is for. There an endless stream of mindless bluster that can be ignored by those seeking serious conversation on the main threads. That is what ATBC is for. He already has his very own thread there. Why shouldn't he be forced to use it? Those are the appropriate places for those who have proven that they cannot or will not learn. Why let a troll fill a thread about gene duplication with redundant nonsense about abiogenesis? Why let him derail yet another thread? Why let him disrupt a serious conversation with a veritable deluge of fecal material? I am disappointed that anyone would stoop to responding to someone who has proven so many times that his only intent in is to disrupt and infuriate. If anyone can learn anything from responses to the troll, this is not the place for it. It isn't censorship to stop someone from screaming while others are watching a play. If he wants a response from me he can get it on the bathroom wall. Don't forget, he even abused that dubious honor.

John Kwok · 21 January 2011

It's really more like mental torture if you ask me. I strongly endorse DS and John Vanko's latest comments. IBIG should stay where he/she/it belongs, on the BW:
RBH said:
John Vanko said: Since this IS a public forum, and we live in a democracy, IF we voted on banishing IBIG to the BW (or out of PT altogether), could you get rid of him for us? On the other hand, if this forum is a meritocracy (like science), with peer review, could we not banish IBIG's posts to the BW for failing to pass muster (as they always fail)?
The Thumb is neither a meritocracy nor a democracy, it's a (usually) benevolent dictatorship. The main goals (for me, at least) are education and intellectual recreation, and people like IBIG help advance both. His clueless comments provide the opportunity to correct him, for the lurkers if no one else, and thus serve the educational goal by exemplifying the sheer ignorance and perversity of the opposition. We need to be reminded of that, I think. And the recreation comes in the effort to solve the puzzles the cluelessness of his comments embody: 'Just what is he claiming now?'

Atheistoclast · 21 January 2011

No, clastie never wrote my bosses. He does, however, continue to call me "Herr Seebach", presumably to go along with his repeated allegations that my side lost WWII (see, it's a German name, right, so that means I'm German!).
I just bet you wish Deutsche was the national language of America. Your kith and kin on the other side of the Atlantic lost the war: now deal with it. Anyway, I didn't want to get you fired from your job - that is why I relented and did not write to your bosses. I also have a new and wonderful program which really will falsify the T of E.....even someone like yourself could understand it.

OgreMkV · 21 January 2011

Atheistoclast said:
No, clastie never wrote my bosses. He does, however, continue to call me "Herr Seebach", presumably to go along with his repeated allegations that my side lost WWII (see, it's a German name, right, so that means I'm German!).
I just bet you wish Deutsche was the national language of America. Your kith and kin on the other side of the Atlantic lost the war: now deal with it. Anyway, I didn't want to get you fired from your job - that is why I relented and did not write to your bosses. I also have a new and wonderful program which really will falsify the T of E.....even someone like yourself could understand it.
Let us know how that works out. I bet it doesn't do what you think it does though. BTW: You still haven't answered any of my questions. A real scientist would be interested in hearing criticism so that they don't like idiots when something obvious is pointed out in their work.. that completely falsifies it.

Atheistoclast · 21 January 2011

Which brings us full circle back to the research in the OP: A new function (antifreeze) from an old duplicated gene that did something quite different, much more than a "minor and subtle" difference.
Except that neither you NOR ANYONE HERE *ACTUALLY READ THE PAPER* beyond the title and abstract! It does help to read the details and not just the attention whoring headlines! If you don't want to pay, here is a link from the author's website. You have no excuse to remain ignorant. http://www.life.illinois.edu/ccheng/Deng%20et%20al%20PNAS2010_online.pdf The authors make it quite clear the ancestral SAS gene was "bifunctional" and that its “C-terminus peptide would be quite sufficient in inhibiting ice-crystal expansion in the fish body fluids.” They also make it clear that the *loss* of the N-terminal domain was one of the key changes involved in the evolution of the antifreeze gene. In other words, this is an example of "subfunctionalization" followed by a process of specialization and optimization. And this really is the most "innovation" that natural selection can accomplish.

Dale Husband · 21 January 2011

DS said: The atheist guy is somehow confusing the environment with selection pressure. Perhaps a reasonable mistake, but when corrected he once again refused to admit that he was wrong and persisted in his misconceptions. This is the only way in which he can continue to be a rebel without a clue. Or is he a maverick? I can't tell.
No, he is a con artist, like most Creationist bigots.

stevaroni · 21 January 2011

Atheistoclast said: I just bet you wish Deutsche was the national language of America. Your kith and kin on the other side of the Atlantic lost the war: now deal with it.
Well, lost is one of those interesting terms. In the bog picture, Germany and japan were destroyed in the war, but not a few economists point out that they were subsequently rebuilt with industrial infrastructure far more up to date than that of the allies. Combined with the fact that post-war restrictions meant that they got to commit the share of GDP that would ordinarily go to defense into things like universal healthcare and extensive free secondary education, while America picked up the tab for defending them from the Red Menace... Well, 60years on, the "losers" live longer, have better education, higher literacy rates and universal access to healthcare, and are the #3 and #4 economies on the planet is all I'm sayin'.

Atheistoclast · 21 January 2011

Dale Husband said:
DS said: The atheist guy is somehow confusing the environment with selection pressure. Perhaps a reasonable mistake, but when corrected he once again refused to admit that he was wrong and persisted in his misconceptions. This is the only way in which he can continue to be a rebel without a clue. Or is he a maverick? I can't tell.
No, he is a con artist, like most Creationist bigots.
Says someone with a zero publication record. If you have something important to say, submit to the journals. Any fool can participate in a forum like this.

SWT · 21 January 2011

Atheistoclast said: I also have a new and wonderful program which really will falsify the T of E.....even someone like yourself could understand it.
10 REM 20 REM PROGRAM ATHEISTOCLAST 30 REM 40 PRINT ("EVOLUTION IS FALSE!") 50 GO TO 40 60 END

Mike Elzinga · 21 January 2011

SWT said:
Atheistoclast said: I also have a new and wonderful program which really will falsify the T of E.....even someone like yourself could understand it.
10 REM 20 REM PROGRAM ATHEISTOCLAST 30 REM 40 PRINT ("EVOLUTION IS FALSE!") 50 GO TO 40 60 END
Neat; and he doesn’t even have to learn how to initialize any variables.

Dale Husband · 21 January 2011

Atheistoclast said:
Which brings us full circle back to the research in the OP: A new function (antifreeze) from an old duplicated gene that did something quite different, much more than a "minor and subtle" difference.
Except that neither you NOR ANYONE HERE *ACTUALLY READ THE PAPER* beyond the title and abstract! It does help to read the details and not just the attention whoring headlines! If you don't want to pay, here is a link from the author's website. You have no excuse to remain ignorant. http://www.life.illinois.edu/ccheng/Deng%20et%20al%20PNAS2010_online.pdf The authors make it quite clear the ancestral SAS gene was "bifunctional" and that its “C-terminus peptide would be quite sufficient in inhibiting ice-crystal expansion in the fish body fluids.” They also make it clear that the *loss* of the N-terminal domain was one of the key changes involved in the evolution of the antifreeze gene. In other words, this is an example of "subfunctionalization" followed by a process of specialization and optimization. And this really is the most "innovation" that natural selection can accomplish.
And isn't that really all that's needed for evolution to occur? What else were you expecting? Expecting genes to appear out of nothing is a Creationist idea, not an evolutionist idea. You seem to be arguing with us about.......nothing we have a problem with. Man, you are STUPID!!!!

Dale Husband · 21 January 2011

Atheistoclast said:
Dale Husband said:
DS said: The atheist guy is somehow confusing the environment with selection pressure. Perhaps a reasonable mistake, but when corrected he once again refused to admit that he was wrong and persisted in his misconceptions. This is the only way in which he can continue to be a rebel without a clue. Or is he a maverick? I can't tell.
No, he is a con artist, like most Creationist bigots.
Says someone with a zero publication record. If you have something important to say, submit to the journals. Any fool can participate in a forum like this.
So you admit to being a fool like the rest of us? If your publications are full of $#it, who cares?

Stanton · 21 January 2011

Dale Husband said:
Atheistoclast said:
Dale Husband said:
DS said: The atheist guy is somehow confusing the environment with selection pressure. Perhaps a reasonable mistake, but when corrected he once again refused to admit that he was wrong and persisted in his misconceptions. This is the only way in which he can continue to be a rebel without a clue. Or is he a maverick? I can't tell.
No, he is a con artist, like most Creationist bigots.
Says someone with a zero publication record. If you have something important to say, submit to the journals. Any fool can participate in a forum like this.
So you admit to being a fool like the rest of us? If your publications are full of $#it, who cares?
Atheistoclast cares, because he wants us to worship him like the God he thinks he is for writing his inane programs. After all, he isn't attention-whoring for just nothing.

DS · 21 January 2011

Atheistoclast said: Says someone with a zero publication record. If you have something important to say, submit to the journals. Any fool can participate in a forum like this.
Well I guess he did learn something after all. That's what you call a self describing prophecy.

OgreMkV · 21 January 2011

and still no simple yes/no answer for if he can tell natural selection from artificial selection by looking at the products.

Of course, he doesn't understand that his entire point is gone if he can't do this.

So, do keep babbling and I'll keep asking you until you admit that you can't do it.

OgreMkV · 21 January 2011

DS said:
Atheistoclast said: Says someone with a zero publication record. If you have something important to say, submit to the journals. Any fool can participate in a forum like this.
Well I guess he did learn something after all. That's what you call a self describing prophecy.
Heh, is that all you want, a publication record? If I had a couple of bucks I could get into that crap journal just as easily as you. Complexity wasn't it called? An impact of 1.2. Where Nature is about a 16. Stunning achievement. Anyway, you still can't answer a silly little question that blows your entire proposal out of the water and deep into Colorado.

DS · 21 January 2011

Of course this guy has no idea who he is talking to. He has no idea of the publication record of anyone. He just assumes that his record is superior. Well I guess that's his whole argument in a nut shell, remain ignorant and make whatever unjustified assumptions are required in order to maintain you misconceptions. It works for him, kind of.

I almost forgot - the end of creationism is at hand! I got me a 'puter program what says so.

seebs · 21 January 2011

Atheistoclast said:
No, clastie never wrote my bosses. He does, however, continue to call me "Herr Seebach", presumably to go along with his repeated allegations that my side lost WWII (see, it's a German name, right, so that means I'm German!).
I just bet you wish Deutsche was the national language of America. Your kith and kin on the other side of the Atlantic lost the war: now deal with it.
Dude, poisoning the well doesn't work when you do it so very obviously. Hint: I haven't got ancestors from Germany within the last hundred and many years. Calling me a Nazi by implication just makes you look like you've got no actual responsive arguments.
Anyway, I didn't want to get you fired from your job - that is why I relented and did not write to your bosses.
No, you didn't write to my bosses because, as long as you don't, you can pretend that you somehow did anything but look stupid in that argument. The moment you test that belief against reality, you lose -- you get confirmation that you made yourself a laughingstock. Writing my bosses would not yield narcissistic supply, so you'll never do it. Your brain can't let you confront something that could prove you wrong. If you wrote my boss to tell him I didn't know C, he'd laugh his ass off. My boss is an actual programmer, who was writing real code before you were chewing food. He knows quite well how good or bad I am at C. He also knows I attract kooks. It's all good. I'm just sad because you're a liar and you deprived us of amusement. Ultimately, that's why I gave up on interacting with you; you're too dishonest to be any fun.
I also have a new and wonderful program which really will falsify the T of E.....even someone like yourself could understand it.
This remains laughable. You can't code your way out of a paper bag. You could learn, except that to do so you'd have to understand that you currently suck. If you ever wanna be good at stuff, lose the ego and the pathological narcissism. Get some competent mental health care, get your head straight, figure out what you're really mad about, and start learning rather than pretending you already did. Seriously, it's worth it. There is more to life than lying to yourself. The truth will set you free... You don't have to be afraid and angry all the time. There is another way...

Stanton · 21 January 2011

seebs said:
Atheistoclast said:
No, clastie never wrote my bosses. He does, however, continue to call me "Herr Seebach", presumably to go along with his repeated allegations that my side lost WWII (see, it's a German name, right, so that means I'm German!).
I just bet you wish Deutsche was the national language of America. Your kith and kin on the other side of the Atlantic lost the war: now deal with it.
Dude, poisoning the well doesn't work when you do it so very obviously. Hint: I haven't got ancestors from Germany within the last hundred and many years. Calling me a Nazi by implication just makes you look like you've got no actual responsive arguments.
And it's doubly ironic given as how Atheistoclast is also a Holocaust denier, as well.

fnxtr · 21 January 2011

No, no, he's a revisionist. Yeah, that's it, revisionist.

John Kwok · 22 January 2011

I have far more trustworthy reliance on his judgement than I ever will with your ample instances of breathtaking inanity Atheistofool:
Atheistoclast said:
Dale Husband said:
DS said: The atheist guy is somehow confusing the environment with selection pressure. Perhaps a reasonable mistake, but when corrected he once again refused to admit that he was wrong and persisted in his misconceptions. This is the only way in which he can continue to be a rebel without a clue. Or is he a maverick? I can't tell.
No, he is a con artist, like most Creationist bigots.
Says someone with a zero publication record. If you have something important to say, submit to the journals. Any fool can participate in a forum like this.

John Kwok · 22 January 2011

Stanton said:
Dale Husband said:
Atheistoclast said:
Dale Husband said:
DS said: The atheist guy is somehow confusing the environment with selection pressure. Perhaps a reasonable mistake, but when corrected he once again refused to admit that he was wrong and persisted in his misconceptions. This is the only way in which he can continue to be a rebel without a clue. Or is he a maverick? I can't tell.
No, he is a con artist, like most Creationist bigots.
Says someone with a zero publication record. If you have something important to say, submit to the journals. Any fool can participate in a forum like this.
So you admit to being a fool like the rest of us? If your publications are full of $#it, who cares?
Atheistoclast cares, because he wants us to worship him like the God he thinks he is for writing his inane programs. After all, he isn't attention-whoring for just nothing.
He's so funny I can't help but wonder whether he is really Bill Dembski in disguise. The very thought makes me howl with laughter again.... HEHEHEHEHEHEHEHE!!!

DS · 22 January 2011

Well I'll pass on "directed hypermutations". There is absolutely no evidence whatsoever that any mutation is ever "directed". If there were, you could publish in Nature and Science and probably win the Nobel Prize. Of course the atheist guy still can't explain who is doing the directing, how or why. No wonder he has no evidence with a "hypothesis" like that.

The atheist guy still can't bring himself to admit that he was wrong a bout duplicate copies not being selected against either. He must know he is wrong and is just too stubborn to admit it. Of course, he has also completely ignored all of the questions regarding the evolution of hox genes. Now I wonder why that is? It's so cute when someone with no background or training tries to play scientist. Everyone can see they haven't got a clue, except themselves.

Waterloo for creationism! 111 eleventy!

OgreMkV · 22 January 2011

What was the name of that first paper he published in Complexity? ANyone know?

I'd like to do a little search and see if anyone has ever cited it. After all, that's a much more useful measure of how good it is. Anyone can write a paper, but will anyone else read it?

Atheistoclast · 22 January 2011

And isn't that really all that's needed for evolution to occur? What else were you expecting? Expecting genes to appear out of nothing is a Creationist idea, not an evolutionist idea. You seem to be arguing with us about.......nothing we have a problem with.
Firstly, evolutionists do claim that genes like CLLU1 and BSC4 can appear out of a random piece of non-coding DNA just as they lied for years about a frameshift mutation causing the "nylonase" oligomer-degrading enzyme. What did Cheng actually claim?
“This is the first clear demonstration - with strong supporting molecular and functional evidence - of escape from adaptive conflict as the underlying process of gene duplication and the creation of a completely new function in one of the daughter copies,” Cheng said. “This has not been documented before in the field of molecular evolution.
Oh...an "entirely new function" which was also a preexisting sub-function. Hmmm. Except that she made such a claim back in 1997 with this paper: http://www.pnas.org/content/94/8/3811.full
The notothenioid trypsinogen to AFGP conversion is the first clear example of how an old protein gene spawned a new gene for an entirely new protein with a new function.
Thankfully, I debunked her stupid conversion process in the paper in Complexity. Evidently, she had already backed off.

Dave Wisker · 22 January 2011

OgreMkV said: What was the name of that first paper he published in Complexity? ANyone know? I'd like to do a little search and see if anyone has ever cited it. After all, that's a much more useful measure of how good it is. Anyone can write a paper, but will anyone else read it?
"Is Gene Duplication a Viable Explanation for the Origination Of Biological Information and Complexity?"

Atheistoclast · 22 January 2011

Well I'll pass on "directed hypermutations". There is absolutely no evidence whatsoever that any mutation is ever "directed".
Except that humans have been directing molecular evolution for a long time now. http://peds.oxfordjournals.org/content/17/9/659.full.pdf+html The process is, of course, analogous with artificial selection.

Dave Wisker · 22 January 2011

Atheistoclast said:
And isn't that really all that's needed for evolution to occur? What else were you expecting? Expecting genes to appear out of nothing is a Creationist idea, not an evolutionist idea. You seem to be arguing with us about.......nothing we have a problem with.
Firstly, evolutionists do claim that genes like CLLU1 and BSC4 can appear out of a random piece of non-coding DNA just as they lied for years about a frameshift mutation causing the "nylonase" oligomer-degrading enzyme. What did Cheng actually claim?
“This is the first clear demonstration - with strong supporting molecular and functional evidence - of escape from adaptive conflict as the underlying process of gene duplication and the creation of a completely new function in one of the daughter copies,” Cheng said. “This has not been documented before in the field of molecular evolution.
Oh...an "entirely new function" which was also a preexisting sub-function. Hmmm. Except that she made such a claim back in 1997 with this paper: http://www.pnas.org/content/94/8/3811.full
The notothenioid trypsinogen to AFGP conversion is the first clear example of how an old protein gene spawned a new gene for an entirely new protein with a new function.
Thankfully, I debunked her stupid conversion process in the paper in Complexity. Evidently, she had already backed off.
TURF-13. A protein coding gene which arose from the cobbling together of non-protein-coding sequences.

Atheistoclast · 22 January 2011

TURF-13. A protein coding gene which arose from the cobbling together of non-protein-coding sequences.
Do you have a citation to research on TURF-13 in a peer-reviewed journal? I can't find any mention of it

SWT · 22 January 2011

OgreMkV said: What was the name of that first paper he published in Complexity? ANyone know? I'd like to do a little search and see if anyone has ever cited it. After all, that's a much more useful measure of how good it is. Anyone can write a paper, but will anyone else read it?
The Complexity paper is in early release, and does not show up in Scopus; Scopus also indicates that his previous paper has zero citations to date.

Dave Wisker · 22 January 2011

Atheistoclast said:
TURF-13. A protein coding gene which arose from the cobbling together of non-protein-coding sequences.
Do you have a citation to research on TURF-13 in a peer-reviewed journal? I can't find any mention of it
Stop asking me to keep spoon-feeding you. The references are in the Panda's Thumb post by Art Hunt.

John Kwok · 22 January 2011

Dave Wisker said:
Atheistoclast said:
TURF-13. A protein coding gene which arose from the cobbling together of non-protein-coding sequences.
Do you have a citation to research on TURF-13 in a peer-reviewed journal? I can't find any mention of it
Stop asking me to keep spoon-feeding you. The references are in the Panda's Thumb post by Art Hunt.
You have my condolences Dave in dealing with this absurd buffoon.

Gabriel Hanna · 22 January 2011

John Kwok said:
Dave Wisker said:
Atheistoclast said:
TURF-13. A protein coding gene which arose from the cobbling together of non-protein-coding sequences.
Do you have a citation to research on TURF-13 in a peer-reviewed journal? I can't find any mention of it
Stop asking me to keep spoon-feeding you. The references are in the Panda's Thumb post by Art Hunt.
You have my condolences Dave in dealing with this absurd buffoon.
Yeah, he keeps doubling down on seebs not knowing how to code--and then asks seebs to write code for him! He also pretends to be American. It's easy to spot because he doesn't know American spelling or usage. This is a guy with a vastly inflated sense of his own importance and knowledge, and a total crackpot. Because my publication record is more extensive than his, he has to accept what I say. :)

Bobsie · 22 January 2011

I know how one could one discriminate natural and artificial selection. For the former you will observe a satified grin on the face of a supernatural; for the latter, a satisfied grin from the human breeder.

I suppose then that means any supernatural is interchangeable with any humans. I think I'm on to something and could just beat Atheistoclast to that Nobel. Wha da ya all think?

DS · 22 January 2011

Atheistoclast said:
Well I'll pass on "directed hypermutations". There is absolutely no evidence whatsoever that any mutation is ever "directed".
Except that humans have been directing molecular evolution for a long time now. http://peds.oxfordjournals.org/content/17/9/659.full.pdf+html The process is, of course, analogous with artificial selection.
Except that humans could not possibly have been responsible for directing the evolution that led to the diversity of life, so this is completely irrelevant. Once again, you got nothin. Give it up already. No one is fooled by your blustering and evasion. When you are willing to admit that you were wrong about selection pressures on duplicated genes, maybe then someone will take you seriously. I mean come on dude, what's the big deal? Why can't you admit that duplicate copies can be removed from functional constraint? What's so bad about that? What could possibly prevent it? You were wrong, just admit it and move on. Until then, piss off. Oh and still no response about hox genes either. I guess that one has you really stumped. There are lots of references you know. You read them for your review article, right?

John Kwok · 22 January 2011

Make sure you mention that the Intelligent Designer(s) were the Klingons or the Vorlons or whatever. You get my ringing endorsement:
Bobsie said: I know how one could one discriminate natural and artificial selection. For the former you will observe a satified grin on the face of a supernatural; for the latter, a satisfied grin from the human breeder. I suppose then that means any supernatural is interchangeable with any humans. I think I'm on to something and could just beat Atheistoclast to that Nobel. Wha da ya all think?

Atheistoclast · 22 January 2011

Dave Wisker said:
Atheistoclast said:
TURF-13. A protein coding gene which arose from the cobbling together of non-protein-coding sequences.
Do you have a citation to research on TURF-13 in a peer-reviewed journal? I can't find any mention of it
Stop asking me to keep spoon-feeding you. The references are in the Panda's Thumb post by Art Hunt.
Aha: so again you haven't actually read any papers - like a puppet you just repeat what you have been told.

Mike Elzinga · 22 January 2011

Bobsie said: I know how one could one discriminate natural and artificial selection. For the former you will observe a satified grin on the face of a supernatural; for the latter, a satisfied grin from the human breeder. I suppose then that means any supernatural is interchangeable with any humans. I think I'm on to something and could just beat Atheistoclast to that Nobel. Wha da ya all think?
This is sheer genius, Bobsie. You have set out the parameters for a research program that can go on for generations. Natural selection produces some really stupid and undesirable things (e.g., ID/creationists) whereas artificial selection aims for desired traits that look designed. So whenever we see the satisfied smirk on the face of an ID/creationist, we instantly think, “Ah, mutation; proof of natural selection.” The more I think about this, the better it gets.

Mike Elzinga · 22 January 2011

Atheistoclast said:
Dave Wisker said:
Atheistoclast said:
TURF-13. A protein coding gene which arose from the cobbling together of non-protein-coding sequences.
Do you have a citation to research on TURF-13 in a peer-reviewed journal? I can't find any mention of it
Stop asking me to keep spoon-feeding you. The references are in the Panda's Thumb post by Art Hunt.
Aha: so again you haven't actually read any papers - like a puppet you just repeat what you have been told.
QED

DS · 22 January 2011

Atheistoclast said:
Dave Wisker said:
Atheistoclast said:
TURF-13. A protein coding gene which arose from the cobbling together of non-protein-coding sequences.
Do you have a citation to research on TURF-13 in a peer-reviewed journal? I can't find any mention of it
Stop asking me to keep spoon-feeding you. The references are in the Panda's Thumb post by Art Hunt.
Aha: so again you haven't actually read any papers - like a puppet you just repeat what you have been told.
This is the most ironic thing the atheist loon has posted yet. He can't be bothered to read the literature, or even make a coherent argument. He can't even deal with a simple analogy. Then he accuses others of not reading a paper! Man, there are whole branches of science this guy is ignoring. First observe the beam that is thine own eye. This is even worse then him claiming he has a superior publication record than that of complete strangers ( and I do mean stranger).

Shebardigan · 22 January 2011

seebs said: Seriously, it's worth it. There is more to life than lying to yourself. The truth will set you free... You don't have to be afraid and angry all the time. There is another way...
There are no prison walls stronger than the ones we construct for ourselves. FWIW, although I've been developing stuff in C since 1986, I found the whole TalkRational thread, even more interminable than this one, to be very instructive. Reviewing the coding style of clastie's submitted masterpiece, it struck me as the larval form of a bit of code I was asked to review and perhaps fix for a printer manufacturer in India. The meat of the character interpretation module was an 8000-line switch statement containing over 190 gotos. Because so many bits would goto particular points in this ...assemblage... they found it necessary to use "come_from" flags to indicate how they got there. In the end, I had to tell them that the least expensive fix would be to start from the behavioural spec and get some folks that understood real-time and good coding practice. Fortunately, their Payables department, apparently as efficent as Engineering, screwed up and remitted the entire contract amount in advance.

Atheistoclast · 22 January 2011

This is the most ironic thing the atheist loon has posted yet. He can't be bothered to read the literature, or even make a coherent argument. He can't even deal with a simple analogy. Then he accuses others of not reading a paper! Man, there are whole branches of science this guy is ignoring. First observe the beam that is thine own eye. This is even worse then him claiming he has a superior publication record than that of complete strangers ( and I do mean stranger).
Did you or did you not read the cited papers relating to T-URF13 or not? You are the baboon who brought it up! I would expect you to talk the talk on the subject Or do I have to painstakingly go through the citations and explain why you are so mistaken?

Dave Wisker · 22 January 2011

Atheistoclast said:
This is the most ironic thing the atheist loon has posted yet. He can't be bothered to read the literature, or even make a coherent argument. He can't even deal with a simple analogy. Then he accuses others of not reading a paper! Man, there are whole branches of science this guy is ignoring. First observe the beam that is thine own eye. This is even worse then him claiming he has a superior publication record than that of complete strangers ( and I do mean stranger).
Did you or did you not read the cited papers relating to T-URF13 or not? You are the baboon who brought it up! I would expect you to talk the talk on the subject Or do I have to painstakingly go through the citations and explain why you are so mistaken?
Actually, that was me. And yes, you are going to have to actually read the cited literature and explain why it's wrong, Mr "Computational Biologist" Internet Tough Guy. Why? Because the authors have a far better publishing record than you do.

Stanton · 22 January 2011

Atheistoclast said:
This is the most ironic thing the atheist loon has posted yet. He can't be bothered to read the literature, or even make a coherent argument. He can't even deal with a simple analogy. Then he accuses others of not reading a paper! Man, there are whole branches of science this guy is ignoring. First observe the beam that is thine own eye. This is even worse then him claiming he has a superior publication record than that of complete strangers ( and I do mean stranger).
Did you or did you not read the cited papers relating to T-URF13 or not? You are the baboon who brought it up! I would expect you to talk the talk on the subject Or do I have to painstakingly go through the citations and explain why you are so mistaken?
It would help if you were actually explain how your programs magically disprove the existence of Evolution, even though it continues to happen, observed, even as we speak. On the other hand, it's quite obvious that your "papers" are nothing but reiterations of appeals to incredulity disguised in pseudoscientific jargon, AND it's also painfully obvious that you have no intention of doing anything beyond being a bigoted, hypocritical attention whore, denouncing everyone who doesn't agree with you as being devil-worshiping liars. Furthermore, from your insults to Mr Seebs, it's quite obvious you love insulting people with racial slurs.

DS · 22 January 2011

Atheistoclast said: Did you or did you not read the cited papers relating to T-URF13 or not? You are the baboon who brought it up! I would expect you to talk the talk on the subject Or do I have to painstakingly go through the citations and explain why you are so mistaken?
Did you or did you not read all of the literature relating to hox gene duplications? I am the one who brought it up, you are the one who is avoiding the subject, just like you tried to duck the fact that you were wrong about selection pressure on duplicated genes. Oh yea and my publication record is better than yours, so you lose again. 11111

OgreMkV · 22 January 2011

Bobsie said: I know how one could one discriminate natural and artificial selection. For the former you will observe a satified grin on the face of a supernatural; for the latter, a satisfied grin from the human breeder. I suppose then that means any supernatural is interchangeable with any humans. I think I'm on to something and could just beat Atheistoclast to that Nobel. Wha da ya all think?
I wrote this a while back ago and don't remember if I posted it here or not yet. https://docs.google.com/document/d/1A_EfiEhJxqDDobXENGaYSPcsrJrpycDvFlluVeypxv8/edit?hl=en Comments welcome.

John Kwok · 22 January 2011

Atheistoclast said:
This is the most ironic thing the atheist loon has posted yet. He can't be bothered to read the literature, or even make a coherent argument. He can't even deal with a simple analogy. Then he accuses others of not reading a paper! Man, there are whole branches of science this guy is ignoring. First observe the beam that is thine own eye. This is even worse then him claiming he has a superior publication record than that of complete strangers ( and I do mean stranger).
Did you or did you not read the cited papers relating to T-URF13 or not? You are the baboon who brought it up! I would expect you to talk the talk on the subject Or do I have to painstakingly go through the citations and explain why you are so mistaken?
Atheistofool, I strongly second Dave Wisker's observation. You seem to demonstrate profound ignorance of ecology, speciation, population genetics, and probably paleobiology too, though thankfully I haven't quizzed you yet.

John Kwok · 22 January 2011

Mike Elzinga said:
Bobsie said: I know how one could one discriminate natural and artificial selection. For the former you will observe a satified grin on the face of a supernatural; for the latter, a satisfied grin from the human breeder. I suppose then that means any supernatural is interchangeable with any humans. I think I'm on to something and could just beat Atheistoclast to that Nobel. Wha da ya all think?
This is sheer genius, Bobsie. You have set out the parameters for a research program that can go on for generations. Natural selection produces some really stupid and undesirable things (e.g., ID/creationists) whereas artificial selection aims for desired traits that look designed. So whenever we see the satisfied smirk on the face of an ID/creationist, we instantly think, “Ah, mutation; proof of natural selection.” The more I think about this, the better it gets.
I concur completely Mike. Can't wait for him to test it on the entire mendacious staff of the Dishonesty Institute, from Dembski, Behe, Minnich, Wells and Luskin all the way down to their latest delusional student intern (Probably from some hick town in Washington state, but I say that sarcastically. I don't mean to assert that all Washingtonians live in hick towns.)

OgreMkV · 22 January 2011

What's hilarious is that (again), the scientists are doing more work in ID than the ID proponents.

'clast has refused to even acknowledge the single question that destroys his entire notion, but Bobsie comes up with a testable (sort of) idea.

I even have a way of testing it. According to the Bible, God destroyed his entire creation twice (once when he kicked Adam and Eve out and again with the Flud), so I'm guessing that he wasn't smiling then. We win... ummm... what do we win?

Science Avenger · 22 January 2011

Atheistoclast said: No, the breeder proactively selects certain variations for their perceived utility and so alters the natural course.
The breeder selects the individuals that are to live to breed, which is all nature does. His motivations are irrelevant.

RBH · 22 January 2011

Shebardigan said: There are no prison walls stronger than the ones we construct for ourselves.
From a post of mine four months ago, quoting Daniel Dennett:
One of the really powerful ideas [in religions] is the idea of sacred truths. And a sacred truth is one that even thinking about it is evil. Don’t even think about it! And when you can establish that about anything, when you can build that taboo against thinking and internalize it – and people internalize it – then they become their own jailers. They become very effective protectors of their own incarceration. (Emphases in Dennett’s intonation)

Shebardigan · 22 January 2011

RBH said: quoting Daniel Dennett:
... then they become their own jailers. They become very effective protectors of their own incarceration.
Many years ago I came to the conclusion that "Your strongest beliefs are likely to be your most powerful enemies".

David Fickett-Wilbar · 22 January 2011

OgreMkV said: Define 'natural course'. You are assuming that anything humans do is not natural. This is not a correct assumption.
This is the essence of his problem, I think. He has separated humans from the natural world, so that anything done by humans doesn't count as natural.

Dave Wisker · 23 January 2011

DS said: Did you or did you not read all of the literature relating to hox gene duplications? I am the one who brought it up, you are the one who is avoiding the subject, just like you tried to duck the fact that you were wrong about selection pressure on duplicated genes.
Atheistoclast gets this wrong-headed view on duplications and selection from a couple of studies suggesting that duplications contribute to genetic robustness, i.e., the ability to withstand null and degenerative mutations, and papers describing the concept of subfunctionalization. First of all, the studies on robustness do not establish that degenerative mutations to gene copies are bad as a general rule-- they point out that advantages--if any--related to robustness depend heavily on the individual circumstances surrounding the genes themselves. As for subfunctionalization, that is simply one way in which gene duplicates can avoid degeneration-- it in no way suggests that duplicate sequences must persist intact in a population as a general rule. Atheistoclast has taken these examples and made the completely unjustified conceptual leap to asserting that some purifying or stabilizing selection must be present preserving duplicate copy sequences. This does not follow logically at all.

DS · 23 January 2011

Dave Wisker said: Atheistoclast gets this wrong-headed view on duplications and selection from a couple of studies suggesting that duplications contribute to genetic robustness, i.e., the ability to withstand null and degenerative mutations, and papers describing the concept of subfunctionalization. First of all, the studies on robustness do not establish that degenerative mutations to gene copies are bad as a general rule-- they point out that advantages--if any--related to robustness depend heavily on the individual circumstances surrounding the genes themselves. As for subfunctionalization, that is simply one way in which gene duplicates can avoid degeneration-- it in no way suggests that duplicate sequences must persist intact in a population as a general rule. Atheistoclast has taken these examples and made the completely unjustified conceptual leap to asserting that some purifying or stabilizing selection must be present preserving duplicate copy sequences. This does not follow logically at all.
Exactly. Well, maybe since he isn't an expert and obviously has no real training or understanding, perhaps he can be forgiven for this misunderstanding. That is, until he disregarded a perfectly good analogy that pointed out the error of his ways. When did he do then? DId he admit that he was wrong? DId he admit that his assumptions weren't logical? Did he admit that there was no evidence to support his assumption? No, he PASSED. That sure fooled everybody. See that's the problem with willful ignorance, it cannot be penetrated by evidence or facts or logic. If you think that is a good thing, you are sadly mistaken. Just ask yourself, why does this guy refuse to read the literature on hox genes? Why does he do the Behe two step? "No I haven't read these papers, but I'm sure they won't convince me because my mind is already made up."

Dave Wisker · 23 January 2011

Exactly. Well, maybe since he isn’t an expert and obviously has no real training or understanding, perhaps he can be forgiven for this misunderstanding.
I'm not saying he should be forgiven. He did, after all, decide to leave the kiddies table by actually getting published. Unfortunately for him, as you, me and others are showing, his paper is very poor, and deserves the pointing and laughing it's getting.

DS · 23 January 2011

Hox genes definitely arose by duplication, after which they absolutely underwent divergence. Indeed, this has been a major mechanism behind the evolution of all of the diversity of body forms seen throughout the animal kingdom. This one example absolutely demolishes the hypothesis that gene duplication is not important in the evolution of novel functions. There are literally thousands of papers on this topic, here are a few to get the atheist guy started:

Brooke et. al. (1998) The parahox gene cluster is an evolutionary sister of the hox gene cluster. Nature 392:920-922.

McClintock et. al. (2001) Consequences of hox gene duplication in the vertebrates: An investigation of zebrafish paralogous grouped genes. Development 128(13):2471-2481.

Lynch et. al. (2006) Adaptive evolution of hox gene homeodomains after cluster duplications. BMC Evolutionary Biology 6:86-94.

Any good review of gene duplication would certainly document this important mechanism of evolution. Unless of course a 1000 page story isn't "novel" enough for you.

Dave Wisker · 23 January 2011

Atheistoclast seems to think that a gene must be composed of entirely new sequences before it can be considered novel.That is like arguing a word cannot be considered new because it uses letters that older words have already used.

DS · 23 January 2011

Dave Wisker said: Atheistoclast seems to think that a gene must be composed of entirely new sequences before it can be considered novel.That is like arguing a word cannot be considered new because it uses letters that older words have already used.
How much do you want to bet that he is going to claim that hox genes are just the same old tools. Even if they can be used to build any different type of house, that doesn't count because you still used the same kind of hammer and saw, no matter how many of them you had. Too bad for him that you can still build a different kind of house, that's all that counts. You know how much he loves analogies. Maybe the new house has two cars in the garage.

mrg · 23 January 2011

Dave Wisker said: Atheistoclast seems to think that a gene must be composed of entirely new sequences before it can be considered novel.That is like arguing a word cannot be considered new because it uses letters that older words have already used.
The mindset seems to be that the succession A B C D ... X Y Z (which is what evolution says) does not represent a creation of "new information" (whatever that is supposed to mean) -- it has to be straight from A to Z, or more exactly Z just appearing de novo, there never having been an A. In other words, it's a roundabout way of expressing creationism: "It couldn't have got from there to here by evolving through a succession of forms building on themselves by slow increments. It all had to be poofed into existence."

Atheistoclast · 23 January 2011

Did you or did you not read all of the literature relating to hox gene duplications? I am the one who brought it up, you are the one who is avoiding the subject, just like you tried to duck the fact that you were wrong about selection pressure on duplicated genes.
What about hox genes? What are you babbling on about now? How was I "wrong" on the selective pressures of gene duplication? What are you actually trying to argue in favor of or against?
Oh yea and my publication record is better than yours, so you lose again. 11111
Well, then you can post references to them here. I find it strange such a prolific author as yourself couldn't even be bothered to read the Cheng paper which is the subject of this thread. Indeed, nobody here actually read the paper. They just read the title and abstract and make up their minds based on just that. The "Devil", or rather the "Darwin" is in the detail.

Dave Wisker · 23 January 2011

mrg said:
Dave Wisker said: Atheistoclast seems to think that a gene must be composed of entirely new sequences before it can be considered novel.That is like arguing a word cannot be considered new because it uses letters that older words have already used.
The mindset seems to be that the succession A B C D ... X Y Z (which is what evolution says) does not represent a creation of "new information" (whatever that is supposed to mean) -- it has to be straight from A to Z, or more exactly Z just appearing de novo, there never having been an A. In other words, it's a roundabout way of expressing creationism: "It couldn't have got from there to here by evolving through a succession of forms building on themselves by slow increments. It all had to be poofed into existence."
That's why T-URF13 makes IDC's heads explode. They drew a line in the sand that they were confident could not be crossed, and T-URF13 crosses it so thoroughly they can't even draw a new line. All they can do is splutter.

Dale Husband · 23 January 2011

Atheistoclast said: I find it strange such a prolific author as yourself couldn't even be bothered to read the Cheng paper which is the subject of this thread. Indeed, nobody here actually read the paper. They just read the title and abstract and make up their minds based on just that. The "Devil", or rather the "Darwin" is in the detail.
Why do you assume that? Because we don't reach the same conclusions about the subject matter you do? You could be suffering from psychotic delusions.

OgreMkV · 23 January 2011

And still no answers to the very simple question... can he tell the difference between natural and artificial selection when presented with the results?

Oh well, I guess it was too much to ask that he be a thinking person and interested in critical discussion of his works.

Mike Elzinga · 23 January 2011

Dave Wisker said:
Exactly. Well, maybe since he isn’t an expert and obviously has no real training or understanding, perhaps he can be forgiven for this misunderstanding.
I'm not saying he should be forgiven. He did, after all, decide to leave the kiddies table by actually getting published. Unfortunately for him, as you, me and others are showing, his paper is very poor, and deserves the pointing and laughing it's getting.
The cruelest fate a paper can have is to be completely ignored. The next cruelest fate is to be mocked. It isn’t getting a paper in a peer reviewed journal - no matter how obscure - that really counts. Sometimes that is the worst possible thing that can happen to you. This troll’s primary problem is that he hasn’t a clue about science at any level. He has cobbled together a bunch of words that he thinks makes him look and speak like a scientist. If this were a little five year old doing it, it might be cute and endearing. However, in this troll’s case, it makes him look totally insane.

mrg · 23 January 2011

Mike Elzinga said: The cruelest fate a paper can have is to be completely ignored. The next cruelest fate is to be mocked.
I've got documents on my website that I put some work into and, not only do they get no traffic ... but nobody even slams them. "Oh the shame! Oh the ignominy!"

DS · 23 January 2011

Atheistoclast said: What about hox genes? What are you babbling on about now? How was I "wrong" on the selective pressures of gene duplication? What are you actually trying to argue in favor of or against? Well, then you can post references to them here.
So you never read any of my posts either. No wonder you keep confusing me with others. Now, admit you were wrong about the selection pressure on duplicated genes. Admit that they can be removed from functional constraint. Then read the hox gene papers I cited and admit that you were wrong a bout duplicated genes not being able to take on new functions. Until then, piss off. If you want my publication record you can just go online and search for it yourself. I have nothing top prove to you. After all, you are the one who makes baseless assertations that he accepts without evidence. You have absolutely no idea who you are talking to, don't pretend that you do.

Atheistoclast · 23 January 2011

Dale Husband said:
Atheistoclast said: I find it strange such a prolific author as yourself couldn't even be bothered to read the Cheng paper which is the subject of this thread. Indeed, nobody here actually read the paper. They just read the title and abstract and make up their minds based on just that. The "Devil", or rather the "Darwin" is in the detail.
Why do you assume that? Because we don't reach the same conclusions about the subject matter you do? You could be suffering from psychotic delusions.
I assume this because all of you have blindly bought into the spin and propaganda surrounding the Cheng paper - that of some wonderful new function created as a result of evolutionary exaptation. But if you had actually read the paper, and studied the provisional sequences, you would realize that this really isn't a case of "neofunctionalization" so much as that of "subfunctionalization" and specialization made possible by gene duplication. This is the problem with you lot - you pay no attention to the details but only to the headlines. You fail to realize that evolutionist scientists are under pressure to find evidence at the molecular level to support their "theory" of innovation by evolution. As there is no evidence, they hyperbolize and extrapolate the data as best they can. They include words like "amazing", "remarkable", "extraordinary" and "astonishing" to try and deceive the reader into thinking something stupendous has happened when it has not. So, I am not really that surprised that you have been brainwashed into thinking that the Darwinian mechanism of trial and error can explain just about anything and everything. But if you would care to read the small print you will understand that you are being conned...big time. The tragedy is that it is your money that is funding the research grants of these fraudsters. This is why you should lobby your legislature to cut life support to these scoundrels...divest from Darwinism.

Atheistoclast · 23 January 2011

Now, admit you were wrong about the selection pressure on duplicated genes. Admit that they can be removed from functional constraint.
Yes, duplicate genes do evolve under a *relaxed* regime of purifying selection. My paper clearly states this. However, you are wrong to assume that a respite in selection facilitates innovation. Rather, it makes degeneration of sequence and function more likely. You would know this if you studied some gene duplicates.
Then read the hox gene papers I cited and admit that you were wrong a bout duplicated genes not being able to take on new functions. Until then, piss off.
Which papers? What hox gene? This is a huge protein family.
If you want my publication record you can just go online and search for it yourself. I have nothing top prove to you. After all, you are the one who makes baseless assertations that he accepts without evidence. You have absolutely no idea who you are talking to, don't pretend that you do.
With no name or title, I might as well look up "Mickey Mouse" and see if he is on PubMed. Mind you, there might well be a Dr. Michael Mouse out there...you never know.

Dale Husband · 23 January 2011

Atheistoclast said:
Dale Husband said: Why do you assume that? Because we don't reach the same conclusions about the subject matter you do? You could be suffering from psychotic delusions.
I assume this because all of you have blindly bought into the spin and propaganda surrounding the Cheng paper - that of some wonderful new function created as a result of evolutionary exaptation. But if you had actually read the paper, and studied the provisional sequences, you would realize that this really isn't a case of "neofunctionalization" so much as that of "subfunctionalization" and specialization made possible by gene duplication.
Then why don't you copy and paste the ENTIRE paper here for all of us to see? Then you can prove your case.
This is the problem with you lot - you pay no attention to the details but only to the headlines. You fail to realize that evolutionist scientists are under pressure to find evidence at the molecular level to support their "theory" of innovation by evolution. As there is no evidence, they hyperbolize and extrapolate the data as best they can. They include words like "amazing", "remarkable", "extraordinary" and "astonishing" to try and deceive the reader into thinking something stupendous has happened when it has not.
Maybe you ARE suffering from psychotic delusions. I do not see such rhetoric in the scientific articles or papers I've read.
So, I am not really that surprised that you have been brainwashed into thinking that the Darwinian mechanism of trial and error can explain just about anything and everything. But if you would care to read the small print you will understand that you are being conned...big time. The tragedy is that it is your money that is funding the research grants of these fraudsters. This is why you should lobby your legislature to cut life support to these scoundrels...divest from Darwinism.
You are a liar, big time!

DS · 23 January 2011

Atheistoclast said: Then read the hox gene papers I cited and admit that you were wrong a bout duplicated genes not being able to take on new functions. Until then, piss off.
Which papers? What hox gene? This is a huge protein family.
With no name or title, I might as well look up "Mickey Mouse" and see if he is on PubMed. Mind you, there might well be a Dr. Michael Mouse out there...you never know.
DS said: Hox genes definitely arose by duplication, after which they absolutely underwent divergence. Indeed, this has been a major mechanism behind the evolution of all of the diversity of body forms seen throughout the animal kingdom. This one example absolutely demolishes the hypothesis that gene duplication is not important in the evolution of novel functions. There are literally thousands of papers on this topic, here are a few to get the atheist guy started: Brooke et. al. (1998) The parahox gene cluster is an evolutionary sister of the hox gene cluster. Nature 392:920-922. McClintock et. al. (2001) Consequences of hox gene duplication in the vertebrates: An investigation of zebrafish paralogous grouped genes. Development 128(13):2471-2481. Lynch et. al. (2006) Adaptive evolution of hox gene homeodomains after cluster duplications. BMC Evolutionary Biology 6:86-94. Any good review of gene duplication would certainly document this important mechanism of evolution. Unless of course a 1000 page story isn't "novel" enough for you.
Do try to keep up. These papers prove that you are once again absolutely wrong and that you are the one who is brainwashed. I can see why you keep trying to ignore them, but I can post them as many times as necessary, long with thousands more. My point is that you have no idea who you are talking or what their publication record is. Trust me, mine is superior to yours. I don't have to prove it to you and I don't care if you believe it or not. Since you now admit that duplicate genes can be removed from functional constraint, something you previously denied, then I must point out that there is absolutely nothing that prevents these genes form becoming functional again or even taking on new functions. You have failed to even provide a possible mechanism that could prevent this. Claiming that it could never happen does not make it impossible. The papers that I cited that you ignored prove just this. Deal with it.

paul poland · 23 January 2011

athei whines :

I assume this because all of you have blindly bought into the spin and propaganda surrounding the Cheng paper - that of some wonderful new function created as a result of evolutionary exaptation. But if you had actually read the paper, and studied the provisional sequences, you would realize that this really isn’t a case of “neofunctionalization” so much as that of “subfunctionalization” and specialization made possible by gene duplication.

In other words - A GAIN OF INFORMATION, since the fish still have the original SAS gene PLUS this new one ! What you are calling 'subfunctionalization' is idiocy - you are implying that SAS is NORMALLY used as an antifreeze when it isn't. Even tropical fish have SAS, and they aren't particularly freeze resistant. It is more of an exploitable coincidence - like the FACT that multiple enzymes have been used as lens crystallins in the eyes of various critters. Would you whine that such a use isn't truly novel, but merely 'subfunctionalization' ? Initiating standard delusional bluster :

This is the problem with you lot - you pay no attention to the details but only to the headlines. You fail to realize that evolutionist scientists are under pressure to find evidence at the molecular level to support their “theory” of innovation by evolution.

There is plenty of evidence that evolution can produce innovations - its just that IDiots and creotards shove their heads three feet up their own arses, wave their hands frantically and scream "THAT DOESN'T COUNT ! IT DOESN'T !! IT DOESN'T !! IT DOESNT' !!" Begin delusional whining here :

As there is no evidence, they hyperbolize and extrapolate the data as best they can. They include words like “amazing”, “remarkable”, “extraordinary” and “astonishing” to try and deceive the reader into thinking something stupendous has happened when it has not.

Too bad for you that something has happened, and is fully explainable via the known mechanisms of evolution. Your 'alternative' is what again ? Oh, right : "An unknown being somehow did stuff sometime in the past for some reason !!" Initiate bellicose posturing :

So, I am not really that surprised that you have been brainwashed into thinking that the Darwinian mechanism of trial and error can explain just about anything and everything.

It explains quite a bit. Certainly much more than the 'alternatives' do.

But if you would care to read the small print you will understand that you are being conned…big time.

The only con is coming from the IDiots and creotards trying to sell their tired old stories about Magical Sky Pixies/'Intelligent Designers' that somehow do stuff. Initiating surreal delusion :

The tragedy is that it is your money that is funding the research grants of these fraudsters. This is why you should lobby your legislature to cut life support to these scoundrels…divest from Darwinism.

There was no fraud simpleton - just researchers getting results you don't like or understand. And just WHAT would you have people invest in - the gibbering idiocy of 'Intelligent' Design ? The vapid whinings of creationism ?

Yes, duplicate genes do evolve under a *relaxed* regime of purifying selection. My paper clearly states this. However, you are wrong to assume that a respite in selection facilitates innovation. Rather, it makes degeneration of sequence and function more likely. You would know this if you studied some gene duplicates.

It has been known for quite some time that the USUAL fate of duplicated genes is deactivation into pseudogenes. But is certainly NOT the only fate. Once a DUPLICATE is free of constraint, it can evolve into something else. Why is such a simple concept so hard for you to accept or understand ?

DS : Then read the hox gene papers I cited and admit that you were wrong about duplicated genes not being able to take on new functions. Until then, piss off.

Which papers? What hox gene? This is a huge protein family. And just HOW did it become a huge family ? By DUPLICATIONS and divergence of course ! By your flaccid whinings, there shouldn't be so many, since 'duplicates, freed of constraints, degenerate'. The Sdic gene of D melanogaster is a gain of information - all other species have AnnX-Cdic next to each other; only D mel has AnnX - Sdic1-Sdic2-Sdic3-Sdic4-Cdic. From examination of the genomic DNA, the sane, rational and parsimonious explanation is that the Sdic gene cluster arose in D mel. Much like jingwei arose in the ancestor of two closely related Drosophila species - all over species have ymp and Adh; only two species have ymp, Adh AND jgw. Another example that you 'assert' you 'debunked' by flaccid whining and frantic handwaving : the AFGP of the notothenioids is unique to them - examination of genomic DNA reveals that it is evolved from trypsinogen. Other fish have trypsinogen; only notothenioids have their AFGP AND trypsinogen. The repeats that enable it to BE an antifreeze arose from repeat expansion of intronic DNA - these sequences are cleaved out of standard trypsinogen.

Dave Wisker · 23 January 2011

Atheistoclast said:
Now, admit you were wrong about the selection pressure on duplicated genes. Admit that they can be removed from functional constraint.
Yes, duplicate genes do evolve under a *relaxed* regime of purifying selection. My paper clearly states this.
This guy is slipperier than Walter ReMine.

Mike Elzinga · 23 January 2011

Dave Wisker said: This guy is slipperier than Walter ReMine.
He also appears to be as psychotic as Heath Ledger’s version of The Joker.

John Kwok · 24 January 2011

Mike Elzinga said: The cruelest fate a paper can have is to be completely ignored. The next cruelest fate is to be mocked. It isn’t getting a paper in a peer reviewed journal - no matter how obscure - that really counts. Sometimes that is the worst possible thing that can happen to you. This troll’s primary problem is that he hasn’t a clue about science at any level. He has cobbled together a bunch of words that he thinks makes him look and speak like a scientist. If this were a little five year old doing it, it might be cute and endearing. However, in this troll’s case, it makes him look totally insane.
Am in complete agreement, Mike. Atheistofool is most likely insane.

John Kwok · 24 January 2011

Dale Husband said: You could be suffering from psychotic delusions.
You're too charitable, Dale. I think he does suffer from psychotic delusions. Reminds me all too much of the Facebook troll who has been stalking me and two friends/acquaintances who are well known writers over there.

Atheistoclast · 24 January 2011

In other words - A GAIN OF INFORMATION, since the fish still have the original SAS gene PLUS this new one !
In other words, you don't know wtf you are talking about. You represent the tragedy of when the scientifically illiterate and ignorant claim to be knowledgeable. The research clearly shows that ice-binding activity was already present in the ancestral gene.
What you are calling 'subfunctionalization' is idiocy - you are implying that SAS is NORMALLY used as an antifreeze when it isn't. Even tropical fish have SAS, and they aren't particularly freeze resistant.
Again...READ THE PAPER! This is what the authors report: "To summarize, through tracing the processes in the SAS-B to AFPIII evolution in the Antarctic eel pout, we provided strong and comprehensive molecular and functional evidence for a clear example of EAC-compelled duplication of a bifunctional ancestral gene" So, we are dealing with a bifunctional ancestor that became subfunctionalized through gene duplication. They also admit that... "The incipient ice activity of the ancestral SAS molecule or its detached C-terminal peptide would be quite sufficient in inhibiting ice-crystal expansion in the fish body fluids." The key "innovation" was to *delete* the N-terminal domain to remove any adaptive conflict caused by pleiotropic antagonism.
It is more of an exploitable coincidence - like the FACT that multiple enzymes have been used as lens crystallins in the eyes of various critters. Would you whine that such a use isn't truly novel, but merely 'subfunctionalization'?
Because subfunctionalization is actually mentioned in the paper with respect to the EAC model!: "The evolutionary partitioning of the two functions of the Gal1 gene in yeasts (9) is a case of subfunctionalization of preexisting gene functions between the daughter genes." Again, IT HELPS TO READ THE PAPER!
There is plenty of evidence that evolution can produce innovations - its just that IDiots and creotards shove their heads three feet up their own arses, wave their hands frantically and scream "THAT DOESN'T COUNT ! IT DOESN'T !! IT DOESN'T !! IT DOESNT' !!"
Except that I debunked most of the classic examples of "evolutionary innovation" in my paper - which you also haven't read.
Too bad for you that something has happened, and is fully explainable via the known mechanisms of evolution.
Well, if you choose to be delusional, then there is nothing I can do to help you. I would suggest that you study the actual data rather than repeat mantras of dogma.
Once a DUPLICATE is free of constraint, it can evolve into something else. Why is such a simple concept so hard for you to accept or understand ?
If it is free of constraint, it will degenerate - it will not evolve into something else. That is plain stupid. However, gene duplicates are still subject to purifying selection because they can serve as useful backups. Evolutionary persistence of functional compensation by duplicate genes in Arabidopsis http://gbe.oxfordjournals.org/content/early/2009/10/29/gbe.evp043.short
By DUPLICATIONS and divergence of course ! By your flaccid whinings, there shouldn't be so many, since 'duplicates, freed of constraints, degenerate'.
Yes, gene families can be formed by duplication - but if you actually bother to look at them the degeneration is obvious - you will find truncations and bulk deletions all over the place that would never be tolerated in a singleton.
The Sdic gene of D melanogaster is a gain of information - all other species haveAnnX-Cdic next to each other; only D mel has AnnX - Sdic1-Sdic2-Sdic3-Sdic4-Cdic.
Again, you are mistaken because you haven't studied the gene sequences or read my paper. Sdic was formed by a bulk deletion at the N-terminus of a copy of Cdic and a frameshift disabling another domain.
Much like jingwei arose in the ancestor of two closely related Drosophila species - all over species have ymp and Adh; only two species have ymp, Adh AND jgw.
Indeed it did...but jingwei is a chimeric gene whose function is still unknown. However, it is an alcohol dehydrogenase like Adh.
Another example that you 'assert' you 'debunked' by flaccid whining and frantic handwaving : the AFGP of the notothenioids is unique to them - examination of genomic DNA reveals that it is evolved from trypsinogen. Other fish have trypsinogen; only notothenioids have their AFGP AND trypsinogen.The repeats that enable it to BE an antifreeze arose from repeat expansion of intronic DNA - these sequences are cleaved out of standard trypsinogen.
And I showed how this was pure speculation and nothing more on their part. They authors have since distanced themselves from this nonsense when they found that both the AFGP and the trysinogen-like protease are biosynthesised in the pancreas: which explains some of the commonalities they share.

Atheistoclast · 24 January 2011

In other words - A GAIN OF INFORMATION, since the fish still have the original SAS gene PLUS this new one !
In other words, you don't know wtf you are talking about. You represent the tragedy of when the scientifically illiterate and ignorant claim to be knowledgeable. The research clearly shows that ice-binding activity was already present in the ancestral gene.
What you are calling 'subfunctionalization' is idiocy - you are implying that SAS is NORMALLY used as an antifreeze when it isn't. Even tropical fish have SAS, and they aren't particularly freeze resistant.
Again...READ THE PAPER! This is what the authors report: "To summarize, through tracing the processes in the SAS-B to AFPIII evolution in the Antarctic eel pout, we provided strong and comprehensive molecular and functional evidence for a clear example of EAC-compelled duplication of a bifunctional ancestral gene" So, we are dealing with a bifunctional ancestor that became subfunctionalized through gene duplication. They also admit that... "The incipient ice activity of the ancestral SAS molecule or its detached C-terminal peptide would be quite sufficient in inhibiting ice-crystal expansion in the fish body fluids." The key "innovation" was to *delete* the N-terminal domain to remove any adaptive conflict caused by pleiotropic antagonism.
It is more of an exploitable coincidence - like the FACT that multiple enzymes have been used as lens crystallins in the eyes of various critters. Would you whine that such a use isn't truly novel, but merely 'subfunctionalization'?
Because subfunctionalization is actually mentioned in the paper with respect to the EAC model!: "The evolutionary partitioning of the two functions of the Gal1 gene in yeasts (9) is a case of subfunctionalization of preexisting gene functions between the daughter genes." Again, IT HELPS TO READ THE PAPER!
There is plenty of evidence that evolution can produce innovations - its just that IDiots and creotards shove their heads three feet up their own arses, wave their hands frantically and scream "THAT DOESN'T COUNT ! IT DOESN'T !! IT DOESN'T !! IT DOESNT' !!"
Except that I debunked most of the classic examples of "evolutionary innovation" in my paper - which you also haven't read.
Too bad for you that something has happened, and is fully explainable via the known mechanisms of evolution.
Well, if you choose to be delusional, then there is nothing I can do to help you. I would suggest that you study the actual data rather than repeat mantras of dogma.
Once a DUPLICATE is free of constraint, it can evolve into something else. Why is such a simple concept so hard for you to accept or understand ?
If it is free of constraint, it will degenerate - it will not evolve into something else. That is plain stupid. However, gene duplicates are still subject to purifying selection because they can serve as useful backups. Evolutionary persistence of functional compensation by duplicate genes in Arabidopsis http://gbe.oxfordjournals.org/content/early/2009/10/29/gbe.evp043.short
By DUPLICATIONS and divergence of course ! By your flaccid whinings, there shouldn't be so many, since 'duplicates, freed of constraints, degenerate'.
Yes, gene families can be formed by duplication - but if you actually bother to look at them the degeneration is obvious - you will find truncations and bulk deletions all over the place that would never be tolerated in a singleton.
The Sdic gene of D melanogaster is a gain of information - all other species haveAnnX-Cdic next to each other; only D mel has AnnX - Sdic1-Sdic2-Sdic3-Sdic4-Cdic.
Again, you are mistaken because you haven't studied the gene sequences or read my paper. Sdic was formed by a bulk deletion at the N-terminus of a copy of Cdic and a frameshift disabling another domain.
Much like jingwei arose in the ancestor of two closely related Drosophila species - all over species have ymp and Adh; only two species have ymp, Adh AND jgw.
Indeed it did...but jingwei is a chimeric gene whose function is still unknown. However, it is an alcohol dehydrogenase like Adh.
Another example that you 'assert' you 'debunked' by flaccid whining and frantic handwaving : the AFGP of the notothenioids is unique to them - examination of genomic DNA reveals that it is evolved from trypsinogen. Other fish have trypsinogen; only notothenioids have their AFGP AND trypsinogen.The repeats that enable it to BE an antifreeze arose from repeat expansion of intronic DNA - these sequences are cleaved out of standard trypsinogen.
And I showed how this was pure speculation and nothing more on their part. They authors have since distanced themselves from this nonsense when they found that both the AFGP and the trysinogen-like protease are biosynthesised in the pancreas: which explains some of the commonalities they share.

DS · 24 January 2011

Atheist,

You can pout and bluster all you want to about how one example or another isn't good enough for you, but you still have provided no reason whatsoever why evolution cannot occur. And you still have not addressed the hox genes you are just blowing smoke.

Look dude, it really doesn't matter if the function is new or not. Evolution occurred. Deal with it. There are now two genes where there was only one before. Finding the intermediate step doesn't mean that evolution never happened, it just means that we know exactly how it happened.

If the gene had only one function initially, then a completely new function did indeed evolve. All that means is that there is now one more mechanism known by which this could happen. Since you refuse to provide any real alternative, you can't really complain now can you?

Besides, your publication record stinks and mine is much better. You lose.

DS · 24 January 2011

Atheist wrote:

"Yes, gene families can be formed by duplication - but if you actually bother to look at them the degeneration is obvious - you will find truncations and bulk deletions all over the place that would never be tolerated in a singleton."

Dude, this is only true of pesudogenes. The very existence of hox gene complexes completely falsifies this unhopeful monster argument.

Relaxed selection does NOT mean that the gene must ALWAYS degenerate. It means that, when freed from functional constraint, any sequence can evolve, even if the intermediates are nonfunctional. This provides tremendous opportunity to explore adaptive space. You just can't seem to get this simple concept through your head.

Still no examples of "directed" mutations? Well I guess we can forget about that nonsense then.

Atheistoclast · 24 January 2011

You can pout and bluster all you want to about how one example or another isn't good enough for you, but you still have provided no reason whatsoever why evolution cannot occur. And you still have not addressed the hox genes you are just blowing smoke.
See,this is the problem. We are not talking about whether gene duplication or evolution happens but whether new information can be created by trial and error.
Look dude, it really doesn't matter if the function is new or not. Evolution occurred. Deal with it. There are now two genes where there was only one before. Finding the intermediate step doesn't mean that evolution never happened, it just means that we know exactly how it happened.
Of course it does! You can't label something evidence of "neofunctionalization" if the function is pre-existing! The fact is that that there is no change in the information content both before and after the duplication event. You can keep creating new copies but it doesn't help increase the functionality of the genome.
If the gene had only one function initially, then a completely new function did indeed evolve. All that means is that there is now one more mechanism known by which this could happen. Since you refuse to provide any real alternative, you can't really complain now can you?
I am really losing patience with you. READ THE PAPER! READ THE PAPER! READ THE PAPER! READ THE PAPER! READ THE PAPER! READ THE PAPER! READ THE PAPER! The authors clearly state that SAS-B is a BIFUNCTIONAL gene. How many times do I have to repeat this before it sinks into your grey matter?

OgreMkV · 24 January 2011

'clast,

Define information in this context. Thanks

Atheistoclast · 24 January 2011

Relaxed selection does NOT mean that the gene must ALWAYS degenerate. It means that, when freed from functional constraint, any sequence can evolve, even if the intermediates are nonfunctional. This provides tremendous opportunity to explore adaptive space. You just can't seem to get this simple concept through your head.
No, it does not...because you haven't studied gene duplicate sequences you don't know. When you relax selection you allow deleterious changes to creep in. This won't necessarily lead to pseudogenization - but to partial degradation of function, and often the loss of expression patterns. However, as I say, gene duplicates are often recruited as backups to compensate for harmful changes occurring at sister sites. Your argument seems to be that if you let random mutations mess things about, you can end up with a brand new function. That is a case of wishful thinking.
Still no examples of "directed" mutations? Well I guess we can forget about that nonsense then.
Read about the controversy http://en.wikipedia.org/wiki/Directed_mutagenesis

Atheistoclast · 24 January 2011

OgreMkV said: 'clast, Define information in this context. Thanks
The instructions pertaining to the operational capability and functional specificity of the gene. In this case, we do see a quantitative *improvement* in ice-binding capability but with the *loss* of motifs that specify the functionality of the N-terminus domain. Again, why have you lot not read the paper? Is this what you always do - just accept an author's *interpretation* at face value? If so, why don't you accept all the points made in my own paper?

OgreMkV · 24 January 2011

Atheistoclast said:
OgreMkV said: 'clast, Define information in this context. Thanks
The instructions pertaining to the operational capability and functional specificity of the gene. In this case, we do see a quantitative *improvement* in ice-binding capability but with the *loss* of motifs that specify the functionality of the N-terminus domain. Again, why have you lot not read the paper? Is this what you always do - just accept an author's *interpretation* at face value? If so, why don't you accept all the points made in my own paper?
Ah, I think I see the confusion. You're conflating information and meaning. That's a huge difference. Since the meaning hasn't changed (anti-freeze ability or whatever), then you think that information hasn't changed. This is incorrect and a common error. We could play a few games to show you that information content of DNA can change without changing the meaning (i.e. the protein produced from the DNA). We can also show that meaning can change without a change in the volume of information (though the actual sequence must change). But I think one of your biggest issues is that you are not seperating the DNA from the results of the DNA (i.e. the protein). I can think of several conditions that would result in a change in a protein that would not result from a change in the DNA. I can also think of several changes in the DNA that would not result in a change in the protein. Are those information changes or not? So, you must define information (or just stop talking about it all together) in a way that it can be measured to the specific system under consideration. You are measuring the 'information' contained in a protein and using that to talk about the DNA. Again, this is, very simply, incorrect. If you want to talk about DNA, then talk about it. Don't try to conflate the protein with the DNA. Using slipperly language is just a method that either shows dishonesty or shoddy communication skills. BTW: Have you ever figured out how to tell the difference between natural and artifical selection when only being able to review the results? I've got several examples ready to test for you, once you tell me the process and values to consider.

Dave Lovell · 24 January 2011

Atheistoclast said: Read about the controversy http://en.wikipedia.org/wiki/Directed_mutagenesis
Did you read it? Or perhaps you wrote it.
It states: The hypothesis was first proposed in 1988 by John Cairns, of Harvard University,[citation needed] who was studying Escherichia coli that lacked the ability to metabolize lactose. He grew these bacteria in media in which lactose was the only source of energy. In doing so, he found that the rate at which the bacteria evolved the ability to metabolize lactose was many orders of magnitude higher than would be expected if the mutations were truly random.
As stated, surely the only conclusion a scientist can draw from this is that the starting material was contaminated. With no ability to use the only food source available, mutation rates would just not need to be orders of magnitude higher, but almost infinite. Did he manage to repeat his experiment?

Atheistoclast · 24 January 2011

Ah, I think I see the confusion. You're conflating information and meaning. That's a huge difference. Since the meaning hasn't changed (anti-freeze ability or whatever), then you think that information hasn't changed. This is incorrect and a common error.
The definition of information, by Shannon, is that it is the "reduction in uncertainty". It has to convey something meaningful within the particular context.
Using slipperly language is just a method that either shows dishonesty or shoddy communication skills.
I gave you an operational definition. Information is fundamentally a form of *communication*. This applies as much to human language as it does to molecular processes.
BTW: Have you ever figured out how to tell the difference between natural and artifical selection when only being able to review the results? I've got several examples ready to test for you, once you tell me the process and values to consider.
It is quite simple. Natural (positive) selection represents a gain in reproductive fitness. Artificial selection, however, represents a gain in utility as defined by human society. If something has been selected for reasons other than reproductive fitness, then it is a case of artificial selection.

eric · 24 January 2011

Atheistoclast said: So, we are dealing with a bifunctional ancestor that became subfunctionalized through gene duplication.
How is that not evolution? Over the course of generations the function performed by one gene is now performed by two. Those two genes continue to change (over more generations) so that each does what they do better than the original did.
The key "innovation" was to *delete* the N-terminal domain to remove any adaptive conflict caused by pleiotropic antagonism.
Again, you seem to be citing an example of evolution in your attempts to disprove it.
Except that I debunked most of the classic examples of "evolutionary innovation" in my paper - which you also haven't read.
Subfunctionalizing some biological process is a type of innovation.
If it [a duplicate gene] is free of constraint, it will degenerate - it will not evolve into something else... [later]However, gene duplicates are still subject to purifying selection because they can serve as useful backups.
These two comments are contradictory. If a gene duplicate undergoes purifying selection, that means it does not always degenerate. (Your own example, SAS also seems to be an example of non-degeneration, since a gene undergoing subfunctionalization is not merely degenerating)
The Sdic gene of D melanogaster is a gain of information - all other species haveAnnX-Cdic next to each other; only D mel has AnnX - Sdic1-Sdic2-Sdic3-Sdic4-Cdic.
Again, you are mistaken because you haven't studied the gene sequences or read my paper. Sdic was formed by a bulk deletion at the N-terminus of a copy of Cdic and a frameshift disabling another domain.
It doesn't matter how it was formed. The sequence ASSSSC has more information than AC, pretty much regardless of what the characters A, S, and C represent.

eric · 24 January 2011

Atheistoclast said: Your argument seems to be that if you let random mutations mess things about, you can end up with a brand new function. That is a case of wishful thinking.
And in his next post:
In this case, we do see a quantitative *improvement* in ice-binding capability but with the *loss* of motifs that specify the functionality of the N-terminus domain.
So, atheistoclast is admitting that duplication and mutation can lead to a quantitative improvement in some capability, all the while arguing evolution does not occur???

Dave Lovell · 24 January 2011

Atheistoclast said: It is quite simple. Natural (positive) selection represents a gain in reproductive fitness. Artificial selection, however, represents a gain in utility as defined by human society. If something has been selected for reasons other than reproductive fitness, then it is a case of artificial selection.
If a blackberry increases its "reproductive fitness" by making its fruit more attractive to birds so they will more effectively distribute the included seeds, this is natural selection? What then is the maximum a more intelligent organism can "know" in order to achieve the same result without being guilty of performing artificial selection?

OgreMkV · 24 January 2011

Atheistoclast said:
Ah, I think I see the confusion. You're conflating information and meaning. That's a huge difference. Since the meaning hasn't changed (anti-freeze ability or whatever), then you think that information hasn't changed. This is incorrect and a common error.
The definition of information, by Shannon, is that it is the "reduction in uncertainty". It has to convey something meaningful within the particular context.
Sorry, that's wrong. The string: "198540981641756490256098259" probably does not convey any meaning to you, yet it is information. Sure, in context it may have some meaning, but that does not affect how the information is transmitted, which is the only thing that Shannon was concerned with. The uncertainty is in whether the reciever actually got the bit that was transmitted, not whether he understood the transmission. It's official, you are confusing meaning and information. Plus, you do not seem to know what Shannon was talking about.
Using slipperly language is just a method that either shows dishonesty or shoddy communication skills.
You gave a definition that is meaningless. You have no method of measuring the information content of DNA. You have no method of determining the relationship between the product (meaning) and the source (DNA/information). Without this, your definition is utterly useless. I won't go so far as to say that it is wrong, but I suspect it may be.
I gave you an operational definition. Information is fundamentally a form of *communication*. This applies as much to human language as it does to molecular processes.
BTW: Have you ever figured out how to tell the difference between natural and artifical selection when only being able to review the results? I've got several examples ready to test for you, once you tell me the process and values to consider.
It is quite simple. Natural (positive) selection represents a gain in reproductive fitness. Artificial selection, however, represents a gain in utility as defined by human society. If something has been selected for reasons other than reproductive fitness, then it is a case of artificial selection.
'clast, your last statement, just like all the others show just how much you don't know. EVERYTHING is related to reproductive fitness. If we choose to breed a cow because it produces more milk, then that's the measure of reproductive fitness. Other cows that produce less milk will have less of a chance to reproduce. Duh. But that doesn't answer the question. Can you tell the difference between natural and artifical selection given only an organism, structure, gene, or protien? You don't know the history of the object. Just looking at, can you tell the difference? Of course you can't. So what you are saying is that "If I know it was artificial selection, then I can show it was artificial selection." Just like Dembski, "if I know it's designed, then I can show it's designed." Utterly useless, but thanks for playing.

Mike Elzinga · 24 January 2011

Atheistoclast said: The definition of information, by Shannon, is that it is the "reduction in uncertainty". It has to convey something meaningful within the particular context. ... I gave you an operational definition. Information is fundamentally a form of *communication*. This applies as much to human language as it does to molecular processes. ... It is quite simple. Natural (positive) selection represents a gain in reproductive fitness. Artificial selection, however, represents a gain in utility as defined by human society. If something has been selected for reasons other than reproductive fitness, then it is a case of artificial selection.
The “Fundamental Misconception of ID/creationism” will eventually appear in the arguments of an ID/creationist; and here we begin to see it uncovered. Once an ID/creationist starts bandying about “information” and Shannon information, he has revealed this fundamental problem in his conceptual understanding. This is where this character’s problems begin. Everything else above that level is screwed up because of this. He appears to have other problems as well; but that would be for clinical psychiatry to deal with.

Atheistoclast · 24 January 2011

So, atheistoclast is admitting that duplication and mutation can lead to a quantitative improvement in some capability, all the while arguing evolution does not occur???
The argument is not over whether evolution can occur or not, but whether Cheng is correct in calling this a case of "neofunctionalization" versus "sufunctionalization": namely, the differential partitioning of function or expression. Let me explain for the nth time for those of you who just don't get it: Duplicate genes evolve under a *relaxed regime of purifying selection*. This means that much of their essential functionality is preserved, but other regions may be subject to degeneration. In the case of the AFP, the N-terminal of the SAS-B ancestor was deleted, while the C-terminus was preserved along with adjustments made to amplify ice-binding activity. This is a case of subfunctionalization followed by optimization and specialization. The ice-binding capability was pre-existing - it did not evolve from scratch as some of you misread the paper. Do you finally understand? *IT HELPS TO READ THE PAPER*

Dave Wisker · 24 January 2011

Dave Lovell said:
Atheistoclast said: Read about the controversy http://en.wikipedia.org/wiki/Directed_mutagenesis
Did you read it? Or perhaps you wrote it.
It states: The hypothesis was first proposed in 1988 by John Cairns, of Harvard University,[citation needed] who was studying Escherichia coli that lacked the ability to metabolize lactose. He grew these bacteria in media in which lactose was the only source of energy. In doing so, he found that the rate at which the bacteria evolved the ability to metabolize lactose was many orders of magnitude higher than would be expected if the mutations were truly random.
As stated, surely the only conclusion a scientist can draw from this is that the starting material was contaminated. With no ability to use the only food source available, mutation rates would just not need to be orders of magnitude higher, but almost infinite. Did he manage to repeat his experiment?
Atheistoclast is such a lazy scholar. See this paper: Sniegowski PD & RE Lenski (1995). Mutation and adaptation: the directed mutation controversy in evolutionary perspective. Annual Review of Ecology and Systematics 26: 553-578
In an earlier review, Lenski & Mittler (54) identified several effects that have the potential to mislead experimenters into concluding that directed mutation is occurring when, in fact, it is not. The lacZam and Mu cases indeed illustrate two of these effects; others will be brought out below when we discuss subsequent cases of apparently directed mutation. The "Poisson-like" distri- butions of lacZam revertants that Cairns et al observed in fluctuation tests were quite plausibly due to slow growth of some revertants, particularly amber suppressors, prior to selective plating. In the case of Mu excision, starvation and the presence of selective substrates were confounded; the observed discrepancy between rates of mutation to Lac(Ara)+ during growth and during starvation on lactose-arabinose medium was a nonspecific con- sequence of starvation rather than a specific response to the presence of lactose and arabinose. Indeed, the case of Mu excision illustrates the general point, made earlier, that the occurrence of mutations after the imposition of a selective agent does not demonstrate that the selective agent is the cause of those mutations.

mrg · 24 January 2011

Atheistoclast said: *IT HELPS TO READ THE PAPER*
Considering that your postings have no credibility, nobody has reason to think your paper has more and they are under no obligation to care. "The author serves the reader, not the other way around." Besides, if what you have to say is so important, why are you not trying to get to people who actually carry some weight instead of simply trolling the internet and picking quarrels with no one in particular?

DS · 24 January 2011

Atheist,

And I am really losing patience with you. You refuse to read any papers and then scream at others READ THE PAPER! You are nothing but a hypocrite. Once again, you have offered no reason whatsoever that a new function could not evolve. Your incredulity is NOT evidence.

Look dude, I'll make this real easy for you. Just answer three simple yes/no questions:

1) Did hox genes arise by duplication?

2) Dis hox genes diverge?

3) Did hox genes take on new functions?

Until you answer those three simple yes./no questions, I see no point in continuing a discussion with someone who is so opposed to rationality.

Atheistoclast · 24 January 2011

Sorry, that's wrong. The string: "198540981641756490256098259" probably does not convey any meaning to you, yet it is information.
It doesn't have to convey meaning or a message to me - but it does have to convey it to something or somebody.
Sure, in context it may have some meaning, but that does not affect how the information is transmitted, which is the only thing that Shannon was concerned with.
No, Shannon defines information as a reduction of uncertainty in a communication channel.
The uncertainty is in whether the reciever actually got the bit that was transmitted, not whether he understood the transmission.
Nonsense...you haven't read his paper.The definition applies to the nature and not to the transmission of information.
It's official, you are confusing meaning and information. Plus, you do not seem to know what Shannon was talking about.
How do you define information if it has no meaning or value - how do you distinguish it from random noise?
You gave a definition that is meaningless. You have no method of measuring the information content of DNA. You have no method of determining the relationship between the product (meaning) and the source (DNA/information). Without this, your definition is utterly useless.
It works perfectly. Genetic information contains the instructions to make functional proteins with a high degree of specificity. All biologists agree on this.
'clast, your last statement, just like all the others show just how much you don't know. EVERYTHING is related to reproductive fitness. If we choose to breed a cow because it produces more milk, then that's the measure of reproductive fitness. Other cows that produce less milk will have less of a chance to reproduce. Duh.
Overproducing milk represents a waste of metabolism and will be selected against in the wild. How is a chihuahua reproductively more fit than a wolf? Often, we produce breeds that are essentially deformed but still useful to us.
But that doesn't answer the question. Can you tell the difference between natural and artifical selection given only an organism, structure, gene, or protien? You don't know the history of the object. Just looking at, can you tell the difference?
I can tell if it is designed or not by applying the *design inference* already used in palaeontology and astrobiology (SETI). http://www.nature.com/nature/journal/v466/n7308/abs/nature09248.html http://spsr.utsi.edu/articles/markjbis2007.pdf You need to read up.

Atheistoclast · 24 January 2011

"The author serves the reader, not the other way around."
I AM REFERRING TO THE CHENG PAPER, IDIOT!

Atheistoclast · 24 January 2011

Atheistoclast is such a lazy scholar. See this paper:
Let me guess...you also read the Lenksi paper? Is that all you do - you just read the title and abstract and that is good enough for you? Lenksi disputes the findings of Cairns and others. He is not the definitive word on the subject. You claimed the idea of a "directed mutation" was my own invention - but it was coined by a Harvard professor.

mrg · 24 January 2011

Atheistoclast said: I AM REFERRING TO THE CHENG PAPER, IDIOT!
I have no reason to care about that than any other. Get the clue: nobody is impressed by what you have to say, nobody has any reason to be, nobody ever will. I'm bored now. Have a nice day.

Atheistoclast · 24 January 2011

Honestly, I have never encountered so many morons in so small of a forum. However, with all of the misconceptions around, it is no surprise that you lot are in the dark about biology and evolution.

My advice to you is to *read* scientific research and articles rather than just the summaries you find on sciencey sites. That way you will get a more nuanced perspective.

I can't be bothered explaining each point to all of you...I have my own research projects to worry about.

OgreMkV · 24 January 2011

I suspect that your research is just as fruitless as your blathering here. For example,
Atheistoclast said:
Sorry, that's wrong. The string: "198540981641756490256098259" probably does not convey any meaning to you, yet it is information.
It doesn't have to convey meaning or a message to me - but it does have to convey it to something or somebody.
No it doesn't. Wow, read Shannon why don't you? One of the areas Shannon is specifically used in is cryptography which is the sending of essentially random information across a channel. In this case, the degree of certainty has nothing to do with the meaning, because the meaning cannot be deciphered by just anyone... often, even the recipient cannot decipher the message and must confirm the receipt of effectively random numbers. Duh.
Sure, in context it may have some meaning, but that does not affect how the information is transmitted, which is the only thing that Shannon was concerned with.
No, Shannon defines information as a reduction of uncertainty in a communication channel.
The uncertainty is in whether the reciever actually got the bit that was transmitted, not whether he understood the transmission.
Nonsense...you haven't read his paper.The definition applies to the nature and not to the transmission of information.
I've done more than read the paper. I've studied it and related works until I understand it, specifically to refute people such as yourself who misrepresent about such things.
It's official, you are confusing meaning and information. Plus, you do not seem to know what Shannon was talking about.
How do you define information if it has no meaning or value - how do you distinguish it from random noise?
Exactly. I almost think you're getting it. The Shannon information has absolutely nothing to do with the meaning or even the content of the message itself. Shannon doesn't care whether the message is understandable or not, just that the same bits that were sent were recieved and how to compress those messages (noting that a purely random message cannot be compressed).
You gave a definition that is meaningless. You have no method of measuring the information content of DNA. You have no method of determining the relationship between the product (meaning) and the source (DNA/information). Without this, your definition is utterly useless.
It works perfectly. Genetic information contains the instructions to make functional proteins with a high degree of specificity. All biologists agree on this.
And no one is disagreeing with this. However, you fail to be able to disntguish between the DNA and the proteins involved. You fail to note that the DNA can change with no change in the protein and that the protein can change with no change in the DNA. Since you fail to separate the two, you are falsly using the state of one to determine the state of the other. It doesn't work that way. If you want to talk about DNA, let's talk about DNA.
'clast, your last statement, just like all the others show just how much you don't know. EVERYTHING is related to reproductive fitness. If we choose to breed a cow because it produces more milk, then that's the measure of reproductive fitness. Other cows that produce less milk will have less of a chance to reproduce. Duh.
Overproducing milk represents a waste of metabolism and will be selected against in the wild. How is a chihuahua reproductively more fit than a wolf? Often, we produce breeds that are essentially deformed but still useful to us.
Again, no one is arguing this. However, chihuahuas don't live in the wild do they? They live in little old ladies homes where they are perfectly adapted. Again, you assume that anything that humans have influenced is no longer natural. It is exactly the same as natural selection, except that the selector is different. You cannot determine the difference between an articially selected thing and a naturally selected thing, because the starting material, the mutations, the selection process, and the results are the same. The only difference is that the breeder determines what is reproductively morefit instead of nature.
But that doesn't answer the question. Can you tell the difference between natural and artifical selection given only an organism, structure, gene, or protien? You don't know the history of the object. Just looking at, can you tell the difference?
I can tell if it is designed or not by applying the *design inference* already used in palaeontology and astrobiology (SETI). http://www.nature.com/nature/journal/v466/n7308/abs/nature09248.html http://spsr.utsi.edu/articles/markjbis2007.pdf You need to read up.
Holy crap, you didn't just go there did you? Wow. Honestly, you need to read something other than UD and other creationist websites. SETI is looking for the non-natural manipulation of electromagnetic energy. Non-natural, as in "cannot have occured with out intelligent intervention". SETI, and anyone who thinks about this for more than 5 seconds, knows that there are only certain methods of using the EM spectrum to communicate. Those methods must differentiate the message from the signal, otherwise. They are looking for those patterns. Further, SETI does not expect to be able to decode a message that they might recieve. It's knowledge of the message, not what the message says. Again, you are confusing meaning with information, especially by invoking Shannon. you may stop misrepresenting this now.

paul poland · 24 January 2011

In other words - A GAIN OF INFORMATION, since the fish still have the original SAS gene PLUS this new one !

In other words, you don’t know wtf you are talking about. Actually, I DO know what I'm talking about - by all sane and rational definitions of information, forming AFPIII from SAS IS a gain of information. Lord Athei the Deluded looks in the mirror and screams :

You represent the tragedy of when the scientifically illiterate and ignorant claim to be knowledgeable.

Lord Athei the bellicose whines :

The research clearly shows that ice-binding activity was already present in the ancestral gene.

Only by accident. From the paper : "Of the six conserved residues (Q9, T18, A16, T15, Q44, and N14) in Atlantic ocean pout AFPIII identified through structural studies to constitute a PUTATIVE flat ice-binding surface, two (T15 and T18) are ancestral, preexisting in the C-terminal domain of both SAS-A and SAS-B (T305 and T308, respectively) of L. dearborni and other teleost SAS. These MIGHT have constituted an ACCIDENTAL structural basis for RUDIMENTARY ice affinity in SAS." The ice binding wasn't a 'subfunction' - IT WAS A CONVENIENT ACCIDENT ! Boosting antifreeze capability KILLS SAS activity. So the ONLY way the ADDITIONAL MUTATIONS in AFPIII could evolve is if the SAS gene duplicated, freeing up one copy to evolve into an antifreeze protein. By boosting an ACCIDENTAL property.

What you are calling ‘subfunctionalization’ is idiocy - you are implying that SAS is NORMALLY used as an antifreeze when it isn’t. Even tropical fish have SAS, and they aren’t particularly freeze resistant.

Again…READ THE PAPER! This is what the authors report: “To summarize, through tracing the processes in the SAS-B to AFPIII evolution in the Antarctic eel pout, we provided strong and comprehensive molecular and functional evidence for a clear example of EAC-compelled duplication of a bifunctional ancestral gene” So, we are dealing with a bifunctional ancestor that became subfunctionalized through gene duplication. WHICH IS A GAIN OF INFORMATION BY ALL SANE AND RATIONAL DEFINITIONS. Again, simpleton : most fish have SAS-A and SAS-B. These eelpout have SAS-A, SAS-B, and a WHOLE FRECKING CLUSTER OF AFPIII genes located elsewhere on the chromosome ! Generated via duplication and translocation - both KNOWN to happen in genomes.

They also admit that… “The incipient ice activity of the ancestral SAS molecule or its detached C-terminal peptide would be quite sufficient in inhibiting ice-crystal expansion in the fish body fluids.” The key “innovation” was to *delete* the N-terminal domain to remove any adaptive conflict caused by pleiotropic antagonism.

AND to mutate a few residues to improve ice-binding ability. From the paper : "One of three adaptive changes detected in the LdSAS-B C-terminal domain K351 (as opposed to D351 in LdSAS-A and other teleost SAS) corresponds to K61 in AFPIII. K61 in AFPIII forms intramolecular hydrogen bonds with two putative ice-binding residues (Q44 and N14) that are important in stabilizing the flat ice-binding surface or the global protein fold, and both are essential for antifreeze activity." SAS-B does NOT have Q44 or N14. To see what would happen if they mutated the C-term of SAS-B, they changed 4 residues to match those of AFPIII - THIS KILLED SAS ACTIVITY. So the sane, rational and parsimonious explanation of how AFPIII arose is that SAS-B was duplicated, and the DUPLICATE evolved. REPRESENTING A GAIN OF INFORMATION. You may now resume your standard posturing, bellowing, and strutting about as if your gibbering idiocy meant anything ...

eric · 24 January 2011

Atheistoclast said: How do you define information if it has no meaning or value - how do you distinguish it from random noise?
Number of bits required to represent the string accurately. Random noise can have quite a lot of Shannon Information precisely because it is random, and thus not compressible.
I can tell if it is designed or not by applying the *design inference* already used in palaeontology and astrobiology (SETI).
Awesome. One of these strings is not designed. You tell me which. You've got a one in 16 chance of getting it right: aaccgcatatcgggcggctgattgaataatgccccaacgatgagcat acccgcatatcgggcggctgattgaataatgccccaacgatgagcat agccgcatatcgggcggctgattgaataatgccccaacgatgagcat atccgcatatcgggcggctgattgaataatgccccaacgatgagcat caccgcatatcgggcggctgattgaataatgccccaacgatgagcat ccccgcatatcgggcggctgattgaataatgccccaacgatgagcat cgccgcatatcgggcggctgattgaataatgccccaacgatgagcat ctccgcatatcgggcggctgattgaataatgccccaacgatgagcat gaccgcatatcgggcggctgattgaataatgccccaacgatgagcat gcccgcatatcgggcggctgattgaataatgccccaacgatgagcat ggccgcatatcgggcggctgattgaataatgccccaacgatgagcat gtccgcatatcgggcggctgattgaataatgccccaacgatgagcat taccgcatatcgggcggctgattgaataatgccccaacgatgagcat tcccgcatatcgggcggctgattgaataatgccccaacgatgagcat tgccgcatatcgggcggctgattgaataatgccccaacgatgagcat ttccgcatatcgggcggctgattgaataatgccccaacgatgagcat

paul poland · 24 January 2011

The Sdic gene of D melanogaster is a gain of information - all other species haveAnnX-Cdic next to each other; only D mel has AnnX - Sdic1-Sdic2-Sdic3-Sdic4-Cdic. Lord Athei howls :

Again, you are mistaken because you haven’t studied the gene sequences or read my paper. Sdic was formed by a bulk deletion at the N-terminus of a copy of Cdic and a frameshift disabling another domain.

Nope - it was formed from TWO genes : AnnX and Cdic. Genomic Sdic has the 5' UTR from AnnX and coding exons from Cdic. Sdic's amino terminus was generated from intronic sequence. AnnX is not testes-specific. Neither is Cdic. BUT SDIC MOST CERTAINLY IS ! Examination of the genomic DNA reveals it gained a few promoters in what was once AnnX DNA. Much like jingwei arose in the ancestor of two closely related Drosophila species - all over species have ymp and Adh; only two species have ymp, Adh AND jgw.

Indeed it did…but jingwei is a chimeric gene whose function is still unknown. However, it is an alcohol dehydrogenase like Adh.

Adh works with short-chain alcohols like ethanol; jingwei works on long-chain alcohols (like insect hormone precursors). The Adh region has mutations NOT SEEN IN ANY OTHER ADH. And whining 'but it is still an alcohol dehydrogenase !!!!1!!!1!' does NOT negate the fact that it is a gain of information. Another example that you ‘assert’ you ‘debunked’ by flaccid whining and frantic handwaving : the AFGP of the notothenioids is unique to them - examination of genomic DNA reveals that it is evolved from trypsinogen. Other fish have trypsinogen; only notothenioids have their AFGP AND trypsinogen.The repeats that enable it to BE an antifreeze arose from repeat expansion of intronic DNA - these sequences are cleaved out of standard trypsinogen.

And I showed how this was pure speculation and nothing more on their part.

The 5' end of AFGP is 95% IDENTICAL to trypsinogen; the 3' end of AFGP is 98% IDENTICAL to trypsinogen; the sane, rational and parsimonious explanation is that AFGP is derived from trypsinogen.

They authors have since distanced themselves from this nonsense when they found that both the AFGP and the trysinogen-like protease are biosynthesised in the pancreas: which explains some of the commonalities they share.

You got a reference to where they 'distanced themselves' from that, or is everyone just supposed to take your gibbering word for it ? The high sequence similarity (and identical intron/exon structure) is why they claimed AFGP was derived from trypsinogen.

DS · 24 January 2011

Atheistoclast said: Honestly, I have never encountered so many morons in so small of a forum. However, with all of the misconceptions around, it is no surprise that you lot are in the dark about biology and evolution. My advice to you is to *read* scientific research and articles rather than just the summaries you find on sciencey sites. That way you will get a more nuanced perspective. I can't be bothered explaining each point to all of you...I have my own research projects to worry about.
Right back atcha skippy. Perhaps you should think for a while about why all real journal editors hate you. Perhaps you should contemplate why all real scientists disagree with you. Perhaps you should consider the fact that you are the one who refuses to accept reality due to your own brainwashing. Perhaps you should consider the fact that you are the one who refused to read any papers. I would feel pity for you, but somehow I can't seem to be bothered to care enough for that. You are nothing but a pathetic little science wannabe who can only recognize his own deficiencies in others. You had the chance to discuss real science with real scientists and you blew it. And don't think we haven't noticed that you couldn't even answer three simple yes/no questions about a topic you are supposedly familiar with. Your inability to address the evidence is the only criteria necessary for rejecting your ideas. If you ever do publish your crap about "directed hypermutation", some thing you admit you have absolutely no evidence for, we will all give it exactly the attention it deserves.

Mike Elzinga · 24 January 2011

Atheistoclast said: That way you will get a more nuanced perspective.
So, given the expression - Σpilnpi, what values of pi maximize this expression and what does it mean?

Dave Wisker · 24 January 2011

Lenksi disputes the findings of Cairns and others. He is not the definitive word on the subject.
Never said he was. Papers by Charlesworth, Charlesworth & Bull, Paul Sniegowski, and Partridge & Morgan agree with him as well.
You claimed the idea of a “directed mutation” was my own invention - but it was coined by a Harvard professor.
I did no such thing.

Atheistoclast · 24 January 2011

From the paper : "Of the six conserved residues (Q9, T18, A16, T15, Q44, and N14) in Atlantic ocean pout AFPIII identified through structural studies to constitute a PUTATIVE flat ice-binding surface, two (T15 and T18) are ancestral, preexisting in the C-terminal domain of both SAS-A and SAS-B (T305 and T308, respectively) of L. dearborni and other teleost SAS. These MIGHT have constituted an ACCIDENTAL structural basis for RUDIMENTARY ice affinity in SAS."The ice binding wasn't a 'subfunction' - IT WAS A CONVENIENT ACCIDENT !
At last you have something useful to say and have taken the time to actually read the paper. I commend you for this. The authors are *speculating* that the ice-binding structure was "accidental" - something resulting from a promiscuous enzymatic function. But they themselves admit that the eelpout was already adapted to chilly water temperatures using the SAS-B enzyme: The ice-binding activity of the ancestral SAS molecule or its detached C-terminal peptide would be quite sufficient in inhibiting ice-crystal expansion in the fish body fluids. So, it seems unlikely that the two conserved residues were present "accidentally". That is unjustified reasoning.
Boosting antifreeze capability KILLS SAS activity. So the ONLY way the ADDITIONAL MUTATIONS in AFPIII could evolve is if the SAS gene duplicated, freeing up one copy to evolve into an antifreeze protein. By boosting an ACCIDENTAL property.
You are entirely correct that boosting antifreeze capability would adversely affect SAS activity. Duplication removed the pleiotropic bottleneck. But to do so: i) The N-terminal domain had to be deleted (as with Sdic): consituting a *loss* of genetic information. 2) The C-terminus experienced some adjustments to a "rudimentary" but pre-existing function. This is a case of optimization and not innovation.
WHICH IS A GAIN OF INFORMATION BY ALL SANE AND RATIONAL DEFINITIONS.
No new information was added. Instead an existing function was amplified and elaborated.
Again, simpleton : most fish have SAS-A and SAS-B. These eelpout have SAS-A, SAS-B, and a WHOLE FRECKING CLUSTER OF AFPIII genes located elsewhere on the chromosome ! Generated via duplication and translocation - both KNOWN to happen in genomes.
And your point is?
SAS-B does NOT have Q44 or N14. To see what would happen if they mutated the C-term of SAS-B, they changed 4 residues to match those of AFPIII - THIS KILLED SAS ACTIVITY.So the sane, rational and parsimonious explanation of how AFPIII arose is that SAS-B was duplicated, and the DUPLICATE evolved.
Did I deny that there ever was an adaptive conflict in the ancestral gene or that AFPIII is an evolved duplicate of SAS-B? No, I didn't. As such, this is a case of subfunctionalization and specialization made possible by duplication. No new information was created. Instead, there was both a loss and modification of existing information.

Atheistoclast · 24 January 2011

The authors also state this:
The capacity to code for a functional signal peptide (SP), in fact, existed in the precursor sequence in LdSAS-B, because we found comparable levels of AFPIII-exporting activity by the SP precursor-mature AFPIII construct and the native pre-AFPIII cDNA.
So, both the C-terminus ice-binding functionality and the N-terminus signal peptide were already present in SAS-B. And this is natural selection at its most "innovative".

John Vanko · 24 January 2011

"...there was both a loss and modification of existing information."
A "modification of existing information" in indeed "new" information.

Atheistoclast · 24 January 2011

John Vanko said:
"...there was both a loss and modification of existing information."
A "modification of existing information" in indeed "new" information.
No, it isn't. Natural selection has the ability to tweak and tinker, optimize and compensate but not to create from scratch. Modification of existing genetic information is generally limited and only ever results in a closely related function. This is part of the problem with the theory of evolution. In order for something to evolve, there needs to be a functional system or component to begin with. Evolution should not be confused with origination.

Mike Elzinga · 24 January 2011

Atheistoclast said: No, it isn't. Natural selection has the ability to tweak and tinker, optimize and compensate but not to create from scratch. Modification of existing genetic information is generally limited and only ever results in a closely related function. This is part of the problem with the theory of evolution. In order for something to evolve, there needs to be a functional system or component to begin with. Evolution should not be confused with origination.
Here it is again; the injection of another ID/creationist obstacle called “function,” again without any explanation of why the transition to a “functional system” is “forbidden” in chemistry and physics. The injection of “information” or “intelligence” to push atoms and molecules doesn’t cut it.

Dale Husband · 24 January 2011

Atheistoclast said:
John Vanko said:
"...there was both a loss and modification of existing information."
A "modification of existing information" in indeed "new" information.
No, it isn't. Natural selection has the ability to tweak and tinker, optimize and compensate but not to create from scratch. Modification of existing genetic information is generally limited and only ever results in a closely related function. This is part of the problem with the theory of evolution. In order for something to evolve, there needs to be a functional system or component to begin with. Evolution should not be confused with origination.
Hey, stupid! Your "problem" with evolution is exactly what we have said all along; evolution is by nature a gradual process in which preexisting features are modified to produce new features, like fish fins becoming amphibian legs. Only Creationists think life (or even new genes) must have arisen out of nothing. Your objections to evolution are pointless.

Mike Elzinga · 24 January 2011

Dale Husband said: Your objections to evolution are pointless.
He seems to be no different from any other ID/creationist in that regard. One doesn’t have to mud-wrestle over published papers to know where his problems lie. They are misconceptions about high school and early college level fundamentals in physics and chemistry (upper sixth form in British education); and these never get addressed before sectarian dogma displaces conceptual understanding and twists it to fit dogma. The tendency of ID/creationists to want to mud-wrestle in biology or with complex systems is partly due to the fact that their misconceptions about fundamentals don’t become noticeable as easily. But once the notions of information are breached, we know. Creationists don’t seem to know how it is we can pick up on this stuff so quickly; they think we are really stupid and can be bamboozled by bluster and scolding.

Atheistoclast · 24 January 2011

Hey, stupid! Your "problem" with evolution is exactly what we have said all along; evolution is by nature a gradual process in which preexisting features are modified to produce new features, like fish fins becoming amphibian legs. Only Creationists think life (or even new genes) must have arisen out of nothing.
Interesting. How exactly did a fish fin evolve into a tetrapod limb by way of a gradual process? At some point in this hypothetical transition you would have an organ that was neither good as a fin nor as a functioning leg. In other words, the intermediate stage would be useless. It is a bit like the "apeman" ancestor who can neither walk fully upright nor can he knuckle-walk and brachiate. He is just a maladapted freak who is neither human nor ape. The fact is that the core information in the genome is not merely derived from pre-existing function, as APFIII clearly is. Where did the conserved protein domains that form the backbone of countless gene families come from? Your ignorance and personal gullibility can never be used as an argument in support of evolutionism.

Atheistoclast · 24 January 2011

But once the notions of information are breached, we know. Creationists don’t seem to know how it is we can pick up on this stuff so quickly; they think we are really stupid and can be bamboozled by bluster and scolding.
Do you actually have anything useful to say other than ranting on about your phobia and paranoia regarding non-Darwinians?

OgreMkV · 24 January 2011

Yep, still conflating meaning and information, even after being told not to. He's too stuck in his biased belief to understand.

Oh, I'll try one more time.

If you have
123456789

and then you have

123456789123456789

the amount of information has increased. In terms of meaning the amount has doubled. In terms of Shannon, the amount has increased by a smaller amount (because this sequence is easily compressible).

If you then get

123456789123556789

There is a change in meaning and a change in information, including an increase in Shannon information because the sequence is less compressible than it was a moment ago.

Now replace all of the numbers with nucleotides and you'll find the exact same thing holds true.

If you add an entire copy of a gene, then you increase the information, especially the Shannon information.

What all this means, is that you are wrong. But that's not surprising to anyone who studies this stuff.

Atheistoclast · 24 January 2011

Oh, I'll try one more time. If you have 123456789 and then you have 123456789123456789 the amount of information has increased. In terms of meaning the amount has doubled. In terms of Shannon, the amount has increased by a smaller amount (because this sequence is easily compressible).
Well this "example" really demonstrates your profound idiocy and ignorance. The amount of information has not doubled in this case. Rather, the data has doubled. Information should never be confused with data. All you have done is to add redundancy to the number string. In data compression, one aims to achieve the minimum redundancy in order to convey all the necessary information. Please, do us a favor and not comment on things which you know so little. Stop embarrassing yourself.

Mike Elzinga · 24 January 2011

Atheistoclast said: Do you actually have anything useful to say other than ranting on about your phobia and paranoia regarding non-Darwinians?
Ah yes; the “phobias and paranoia about non-Darwinists.” Where have we heard that before? And what does it have to do with the fact that you have no understanding of even the most basic concepts in physics and chemistry; let alone all the issues you have with biology? That is why you mud-wrestle over published papers; you can’t cut it with the fundamentals. You've been nailed repeatedly and you attempt to avoid facing up to it by ignoring it. Forget the papers; you can't even impress on the most basic level.

OgreMkV · 24 January 2011

Atheistoclast said:
Hey, stupid! Your "problem" with evolution is exactly what we have said all along; evolution is by nature a gradual process in which preexisting features are modified to produce new features, like fish fins becoming amphibian legs. Only Creationists think life (or even new genes) must have arisen out of nothing.
Interesting. How exactly did a fish fin evolve into a tetrapod limb by way of a gradual process? At some point in this hypothetical transition you would have an organ that was neither good as a fin nor as a functioning leg. In other words, the intermediate stage would be useless. It is a bit like the "apeman" ancestor who can neither walk fully upright nor can he knuckle-walk and brachiate. He is just a maladapted freak who is neither human nor ape. The fact is that the core information in the genome is not merely derived from pre-existing function, as APFIII clearly is. Where did the conserved protein domains that form the backbone of countless gene families come from? Your ignorance and personal gullibility can never be used as an argument in support of evolutionism.
Wait, are you or are you not a creationist... I can't remember what you've said on the subject, but this is a classic bit of misinformation. It's wrong and if you don't know it, then you are too dumb to be writing scholarly research (not that I'm sure you're writing that now). Let me ask you... of tetrapod organisms, how many of them have humerous, a radius, and an ulna? Oh wait, all of them. I'm going to suggest a book that you are scared to read. Gaining Ground: The Origin and Evolution of Tetrapods by Jennifer A. Clack. I would suggest starting with Chapter 5: "The First Feet: Tetrapods of the Famennian" and continue with Chapter 6: "From Fins to Feet: Transformation and Transition". There are 19 pages of reference papers and I insist that you read each and every one (cause you are so big into papers and all) and then explain why each and every one is wrong. Once you've done that, let me know and then we'll talk about your ridiculous contention about 'half a fin' or whatever. You surely are aware that these arguments have all been dealt with and that they are wrong. SO, do please try again. I note that you haven't suggested a way to differentiate between an organism that evolved via natural selection and one that evolved via artificial selection. Once you can do that, then the rest of your arguments might have some value... but I doubt it.

mrg · 24 January 2011

Atheistoclast said: Stop embarrassing yourself.
I say again: if you've really got some earth-shaking revelations here, why are you spending all your time trolling the internet to squabble with nobody in particular instead of trying to reach people who count? My conclusion is that you don't care about reaching anyone who counts and prefer to spend your time squabbling with nobody in particular.

John Vanko · 24 January 2011

"No, it isn't. Natural selection has the ability to tweak and tinker, optimize and compensate but not to create from scratch. Modification of existing genetic information is generally limited and only ever results in a closely related function."
Actually, Yes, It Is. Natural Selection doesn't "create from scratch." (That would be "hopeful monsters" no?) It doesn't need to. It "creates" by the accumulation of an uncountable, and unrecorded (in the fossil record at least) small steps. You accept Integral Calculus? The Area is the Sum of the Infinitesimally Small Parts? A fin becomes an arm, or a wing, or a flipper (think Cetacean). Deal with it, or tell us how Newton was wrong.

Mike Elzinga · 24 January 2011

Atheistoclast said: Well this "example" really demonstrates your profound idiocy and ignorance. The amount of information has not doubled in this case. Rather, the data has doubled. Information should never be confused with data. All you have done is to add redundancy to the number string. In data compression, one aims to achieve the minimum redundancy in order to convey all the necessary information. Please, do us a favor and not comment on things which you know so little. Stop embarrassing yourself.
So, given the expression - Σpilnpi, what values of pi maximize this expression and what does it mean? This is an example of a basic concept you can’t handle.

OgreMkV · 24 January 2011

Atheistoclast said:
Oh, I'll try one more time. If you have 123456789 and then you have 123456789123456789 the amount of information has increased. In terms of meaning the amount has doubled. In terms of Shannon, the amount has increased by a smaller amount (because this sequence is easily compressible).
Well this "example" really demonstrates your profound idiocy and ignorance. The amount of information has not doubled in this case. Rather, the data has doubled. Information should never be confused with data. All you have done is to add redundancy to the number string. In data compression, one aims to achieve the minimum redundancy in order to convey all the necessary information. Please, do us a favor and not comment on things which you know so little. Stop embarrassing yourself.
By your definition of information, I guess your correct. But I use the correct definition of information. It still doesn't change anything. Anyone can see that the there were 9 things and now there are 18 things. Again, according to Shannon, this is only a minor increase because its easily compressible. Tell me 'clast. Which has more information according to Shannon, a recording Obama's State of the Union Address or the same length of white noise?

Mike Elzinga · 24 January 2011

OgreMkV said: Tell me 'clast. Which has more information according to Shannon, a recording Obama's State of the Union Address or the same length of white noise?
This is really getting funny. All this information laid out right in front of him and he doesn’t see. This guy has been nailed with a railroad spike and he doesn’t even know it.

mrg · 24 January 2011

Mike Elzinga said: This guy has been nailed with a railroad spike and he doesn’t even know it.
He's just makin' noise. The facts don't matter, as long as he can keep on makin' noise.

Atheistoclast · 24 January 2011

Mike Elzinga said:
OgreMkV said: Tell me 'clast. Which has more information according to Shannon, a recording Obama's State of the Union Address or the same length of white noise?
This is really getting funny. All this information laid out right in front of him and he doesn’t see. This guy has been nailed with a railroad spike and he doesn’t even know it.
Yeah, all you can offer is stupid and asinine talk. Put up or shut up, Mikey.

Flint · 24 January 2011

Again, I'm reminded of a Molly Ivins column I read long ago. Seems something escaped from a military base in Colorado, killing thousands of sheep where they stood just downwind of the base boundary. Naturally the ranchers were angry, and wanted restitution.

So they held a meeting with military representatives. The meeting was held in a house near where many sheep died, so all attendees had to negotiate past the rotting corpses to reach the house, and the smell was so bad they had to wear masks.

"So, what's the problem?" asked the military spokesmen? (This was, like, a hint).

"You've killed thousands of our sheep", the ranchers replied. "We need to be reimbursed for them, or we will go broke."

"Sheep?", the military people responded. "What sheep? We don't see any sheep. We don't know what you're talking about."

And that was the end of the meeting. An exquisite example of what happens when evidence encounters doctrine or policy. The ranchers were armed with mere evidence. They never stood a chance. To them, evidence mattered. And now we're over 20 pages into a thread illustrating that, like the ranchers, we simply CAN NOT LEARN that evidence is irrelevant. After literally HUNDREDS of responses consistently showing otherwise, we have learned nothing.

And ironically, we pride ourselves on learning from the evidence!

Atheistoclast · 24 January 2011

Tell me 'clast. Which has more information according to Shannon, a recording Obama's State of the Union Address or the same length of white noise?
Is this supposed to be some trick question, Ogre? If I give you two copies of the NY Times, are you twice as well informed as a result of reading both of them? Consider the recipient at the other end of the communication channel: CLAST IS A GENIUS! Ok message understood. CLAST IS A GENIUS! Ok, we heard you the first time. CLAST IS A GENIUS! You have already said that twice! CLAST IS A GENIUS! For crying out loud, shut up!

Mike Elzinga · 24 January 2011

Atheistoclast said: Yeah, all you can offer is stupid and asinine talk. Put up or shut up, Mikey.
So are you going to answer the question? It’s pretty basic; and we will know. Bluster isn't going to do it for you.

mrg · 24 January 2011

Flint said: Again, I'm reminded of a Molly Ivins column I read long ago. Seems something escaped from a military base in Colorado, killing thousands of sheep where they stood just downwind of the base boundary.
OK, I know you're just funning here, but something like this did happen:
On 13 March 1968, an F-4 Phantom strike aircraft flew a test mission over the Dugway Proving Ground in Utah with chemical dispensers containing VX. One of the dispensers wasn't completely emptied during the test, and as the F-4 gained altitude after its bombing run, VX trickled out in a trail behind the aircraft to drift into Skull Valley, north of the proving ground, and settle over a huge flock of sheep. 6,000 sheep were killed, and the incident provoked national attention at a time of high public political unrest and suspicion of the government.
http://www.vectorsite.net/twgas_2.html

Mike Elzinga · 24 January 2011

Flint said: And ironically, we pride ourselves on learning from the evidence!
LOL! Brilliant, Flint. And with that, I have to head out on some errands. LOL!

mrg · 24 January 2011

"VX", incidentally, is a "persistent" nerve agent. Instead of evaporating, it sticks around on objects to make them toxic for a long time.

Flint · 24 January 2011

This is probably the event Ivins was talking about. She did relate that there was a meeting, and she did relate that (according to the ranchers) the military simply denied everything. Molly Ivins described the "designated military denier" who (she said) can look you straight in the eye, deny you are even there, and sincerely believe it.

What I'm seeing here is an interminable illustration of Dawkins' observation that there is no sensible limit to what the human mind is capable of believing, against any amount of contrary evidence. The only question is, how many head-bangers will fill how many pages with contrary evidence before (if ever) they understand what "any amount" actually means.

mrg · 24 January 2011

Flint said: This is probably the event Ivins was talking about. She did relate that there was a meeting, and she did relate that (according to the ranchers) the military simply denied everything.
I would bet that at the outset there were some very stressed-out government people who had no idea of what they dared say. The facts did become known, but I would greatly doubt the folks in the hotseat were immediately forthcoming. Of course, they were more forthcoming than our visitor is ever likely to be.

OgreMkV · 24 January 2011

Atheistoclast said:
Tell me 'clast. Which has more information according to Shannon, a recording Obama's State of the Union Address or the same length of white noise?
Is this supposed to be some trick question, Ogre? If I give you two copies of the NY Times, are you twice as well informed as a result of reading both of them? Consider the recipient at the other end of the communication channel: CLAST IS A GENIUS! Ok message understood. CLAST IS A GENIUS! Ok, we heard you the first time. CLAST IS A GENIUS! You have already said that twice! CLAST IS A GENIUS! For crying out loud, shut up!
So are you going to answer the question 'clast? I guess not. And yes, according to Shannon, two copies of the New York times has more information than one. QUIT THINKING ABOUT THE MESSAGE... I mean, are you really this misinformed? The message has nothing to do with it. Two copies of the New York Times takes twice as much to send, unless you compress them, and then the instructions for decompressing will take a fraction of the whole, which means that, yes. According to Shannon, two copies of the New York Times has more information. Humorously, the same applies to DNA. If an organism has multiple copies of a gene... guess what? They produce MORE of that protein. Duh. Of course, one or more of the copies is free to mutate without affecting the rest... which is the whole point of this damn conversation (or whatever it is). BTW: Answer the question, which has more information a 30 minute audio speech or a 30 minute batch of white noise (Shannon Info please)?

OgreMkV · 24 January 2011

mrg said:
Flint said: This is probably the event Ivins was talking about. She did relate that there was a meeting, and she did relate that (according to the ranchers) the military simply denied everything.
I would bet that at the outset there were some very stressed-out government people who had no idea of what they dared say. The facts did become known, but I would greatly doubt the folks in the hotseat were immediately forthcoming. Of course, they were more forthcoming than our visitor is ever likely to be.
If it was a secret test, it's likely that the people sent to the ranch didn't have a clue what was going on. Since they can't confirm or deny something they weren't involved with, they maintain nothing happened.

mrg · 24 January 2011

OgreMkV said: If it was a secret test, it's likely that the people sent to the ranch didn't have a clue what was going on. Since they can't confirm or deny something they weren't involved with, they maintain nothing happened.
Well, they probably had a clue because chemical weapons tests and the like were what Dugway was all about. But at the outset they likely didn't have more than a clue. I am sure echoing through the back of their heads was the thought of what would have happened if the Phantom had flown over a town. Though Dugway was sited in an isolated region, for good reasons.

phantomreader42 · 24 January 2011

Mike Elzinga said:
Atheistoclast said: Yeah, all you can offer is stupid and asinine talk. Put up or shut up, Mikey.
So are you going to answer the question? It’s pretty basic; and we will know. Bluster isn't going to do it for you.
This moron would sooner eat his own children than offer a meaningful answer to any question. I proved that ten pages ago, though I wasn't the first or the last.

phantomreader42 · 24 January 2011

OgreMkV said:
Atheistoclast said:
Tell me 'clast. Which has more information according to Shannon, a recording Obama's State of the Union Address or the same length of white noise?
Is this supposed to be some trick question, Ogre? If I give you two copies of the NY Times, are you twice as well informed as a result of reading both of them? Consider the recipient at the other end of the communication channel: CLAST IS A GENIUS! Ok message understood. CLAST IS A GENIUS! Ok, we heard you the first time. CLAST IS A GENIUS! You have already said that twice! CLAST IS A GENIUS! For crying out loud, shut up!
So are you going to answer the question 'clast? I guess not. And yes, according to Shannon, two copies of the New York times has more information than one. QUIT THINKING ABOUT THE MESSAGE... I mean, are you really this misinformed? The message has nothing to do with it. Two copies of the New York Times takes twice as much to send, unless you compress them, and then the instructions for decompressing will take a fraction of the whole, which means that, yes. According to Shannon, two copies of the New York Times has more information. Humorously, the same applies to DNA. If an organism has multiple copies of a gene... guess what? They produce MORE of that protein. Duh. Of course, one or more of the copies is free to mutate without affecting the rest... which is the whole point of this damn conversation (or whatever it is). BTW: Answer the question, which has more information a 30 minute audio speech or a 30 minute batch of white noise (Shannon Info please)?
So, clast either has to admit he's wrong about a duplicate string increasing information (and we all know he'd die before doing that), or offer a coherent definition of information other than Shannon's (and the very idea of a coherent definition of anything is anathema to his cult). So he's just going to babble bullshit until he asphyxiates himself. He's incapable of doing anything else.

Flint · 24 January 2011

If it was a secret test, it’s likely that the people sent to the ranch didn’t have a clue what was going on. Since they can’t confirm or deny something they weren’t involved with, they maintain nothing happened.

And of course, you would expect the military to carefully select people who knew nothing about the test, to go explain it to the victims. Sheesh. That this never happened was a policy decision. If there's anything the military does without thought, it's classify everything they can get their hands on. This is considered "safe". But lest my point be lost in the speculation, we are dealing (or at least we think we are addressing) someone who has decided not to understand as a matter of POLICY. Which has nothing to do with evidence. We should all be made to write 100 times on the blackboard every day "Conclusions not based on evidence cannot be altered with evidence." We are all barking up the wrong tree here. We should be thinking in terms of drugs, or shock therapy, or lobotomy. There is no avenue to the problem via the written word. NONE.

mrg · 24 January 2011

I think about two years ago, creobots were still catching people a bit flat-footed with their "information-complexity" bafflegab. They're not any more. People who have heard it before don't just know it's bogus, they know specifically why it's bogus.

Atheistoclast · 24 January 2011

QUIT THINKING ABOUT THE MESSAGE... I mean, are you really this misinformed? The message has nothing to do with it.
The message represents the information content. Destabilization of cyclin D1 message plays a critical role in cell cycle exit upon mitogen withdrawal http://www.nature.com/onc/journal/v24/n6/full/1208299a.html
According to Shannon, two copies of the New York Times has more information.
Dear, oh dear. Can't tell the difference between data and information.

Atheistoclast · 24 January 2011

mrg said: I think about two years ago, creobots were still catching people a bit flat-footed with their "information-complexity" bafflegab. They're not any more. People who have heard it before don't just know it's bogus, they know specifically why it's bogus.
Here is one such paper authored by a "creobot". The digital code of DNA
The discovery of the structure of DNA transformed biology profoundly, catalysing the sequencing of the human genome and engendering a new view of biology as an information science. Two features of DNA structure account for much of its remarkable impact on science: its digital nature and its complementarity, whereby one strand of the helix binds perfectly with its partner. DNA has two types of digital information — the genes that encode proteins, which are the molecular machines of life, and the gene regulatory networks that specify the behaviour of the genes.
http://www.nature.com/nature/journal/v421/n6921/full/nature01410.html Enjoy.

mrg · 24 January 2011

Atheistoclast said: Here is one such paper authored by a "creobot".
Look guy, I'm not a scientist, I'm not a biologist, in fact I'm a nobody. If I was to tell you my name, you could look around for as long as you liked, the only answer you'd get is: "Who the hell is that?!" I'm absolutely nobody of any importance. If I drop dead tomorrow, history will go on without a blip. That being the case, if I tell you that I wouldn't take you seriously if you tried to tell me about the weather, there's no reason for you to care whether I take you seriously or not. But on the other side of the same coin, even if I agreed with everything you say it would be of no importance. So again ... if you've got something important, why aren't you trying to sell your ideas to people who count instead of squabbling with nobody in particular? Since that's what you're doing, there's no doubt that you don't have anything to sell and you just like to squabble. That's OK by me. I'll be perfectly happy to call you a silly person, or at least until I get bored with it.

Rob · 24 January 2011

Atheistoclast,

What is your definition of information? Be specific.

What is your definition of data? Be specific.

If you offer no definitions, I call BS.

Flint · 24 January 2011

DNA has two types of digital information — the genes that encode proteins, which are the molecular machines of life, and the gene regulatory networks that specify the behaviour of the genes.

This seems fairly straightforward. There is a hierarchy operating here. The "worker behavior" makes the proteins, and the "manager behavior" tells the worker what to do, and how much to do, and when to do it. And it's useful to regard these as distinct, different functions. No need to insert any confusion about the meaning of "information" here at all, and I think the authors were less clear about what's going on than they could have been by using such an ambiguous term.

Stuart Weinstein · 24 January 2011

Atheistoclast said:
Sorry, that's wrong. The string: "198540981641756490256098259" probably does not convey any meaning to you, yet it is information.
It doesn't have to convey meaning or a message to me - but it does have to convey it to something or somebody.
How do you determine whether or not a string conveys information to something? Gawd you're a sloppy thinker. If I give you a string what test can you perform to determine whether it means something to something or somebody? And if the proposed test can't, *meaning* is useless as the basis for an information metric. Now, super slow serves up this chestnut...
How do you define information if it has no meaning or value - how do you distinguish it from random noise
You do understand that in the Shannon measure, random or white noise has the highest information content. Because you need the most bits to specify it. Doesn't that just bake your noodle? Please show where in the Shannon-Weaver measure is meaning or value quantified...

DS · 24 January 2011

Atheistoclast said: Interesting. How exactly did a fish fin evolve into a tetrapod limb by way of a gradual process? At some point in this hypothetical transition you would have an organ that was neither good as a fin nor as a functioning leg. In other words, the intermediate stage would be useless.
You do know that many intermediate forms have been discovered don't you? You do know that this shows that tetrapods actually did evolve from fish don't you? You do know that the genetic evidence is conclusive in this regard don't you? You do know that the developmental evidence is conclusive in this regard don't you? You do know that the same is true for humans don't you?
DS said: Hox genes definitely arose by duplication, after which they absolutely underwent divergence. Indeed, this has been a major mechanism behind the evolution of all of the diversity of body forms seen throughout the animal kingdom. This one example absolutely demolishes the hypothesis that gene duplication is not important in the evolution of novel functions. There are literally thousands of papers on this topic, here are a few to get the atheist guy started: Brooke et. al. (1998) The parahox gene cluster is an evolutionary sister of the hox gene cluster. Nature 392:920-922. McClintock et. al. (2001) Consequences of hox gene duplication in the vertebrates: An investigation of zebrafish paralogous grouped genes. Development 128(13):2471-2481. Lynch et. al. (2006) Adaptive evolution of hox gene homeodomains after cluster duplications. BMC Evolutionary Biology 6:86-94.
Once you have read the papers you can answer these questions: 1) Did hox genes arise by duplication? 2) Dis hox genes diverge? 3) Did hox genes take on new functions? I can keep asking as many times as needed. Until you address this evidence you will not be taken seriously. But then again, you don't seem to have been able to convince anyone of anything anyway. Oh well, at least while you are wasting your time here you are not working on your "research projects".

Scott F · 24 January 2011

Atheistoclast said:
According to Shannon, two copies of the New York Times has more information.
Dear, oh dear. Can't tell the difference between data and information.
My dear Clast, of course two copies of the New York Times have more information. If I got two copies of the New York Times in my mail box, I would have two new pieces of information that I would not have had if I had received only one copy of the newspaper: 1) My neighbor also gets the New York Times; 2) He didn't get his today. Since we seem to have it wrong, what distinction do you draw between "data" and "information"? Please use your own words rather than a link. A simple link doesn't prove that you know what is contained in the link. I would prefer to hear your thoughts on the subject. Thank you for your participation.

OgreMkV · 24 January 2011

Rob said: Atheistoclast, What is your definition of information? Be specific. What is your definition of data? Be specific. If you offer no definitions, I call BS.
He won't dare do that (as phantom has mentioned). If he defined these two, then he couldn't say that I was using them incorrectly (I'm not, but he doesn't know that). 'clast, you have lost on an epic scale. You can't answer even basic question about your notions. How on Earth does your crap get past peer-review? Oh wait, it's a freebie peer-review... no hard question, no questions about the data, no questions about conclusions, and no one to point out where you are wrong and were other research crushes yours. Must be nice to not have to seal with all that crap. To bad it makes your work look like my 4-year-old's. Ah well... get around to defining data, if you like. Go ahead and explain how you can tell the difference between an organism that was artificially selected and one naturally selected. And do explain those annoying Hox genes. You might also read up on... well... science (especially information theory and paleontology).

Dale Husband · 24 January 2011

Atheistoclast said: Interesting. How exactly did a fish fin evolve into a tetrapod limb by way of a gradual process? At some point in this hypothetical transition you would have an organ that was neither good as a fin nor as a functioning leg. In other words, the intermediate stage would be useless.
You are even dumber than I thought. LOL! Ever heard of mudskippers?
It is a bit like the "apeman" ancestor who can neither walk fully upright nor can he knuckle-walk and brachiate. He is just a maladapted freak who is neither human nor ape.
Try googling "Oliver the 'Humanzee'", you idiot! He was actually an ordinary chimp that happened to be able to walk upright, just as our pre-human ancestors would have done. Yet he was a perfectly functioning animal in all other respects.
The fact is that the core information in the genome is not merely derived from pre-existing function, as APFIII clearly is. Where did the conserved protein domains that form the backbone of countless gene families come from?
All genes (and protiens) are made from parts of DNA (and amino acids), which are in turn made from atoms.
Your ignorance and personal gullibility can never be used as an argument in support of evolutionism.
Look who's talking! You haven't made a credible argument here yet, and we have just been laughing at you like hyenas.

Stanton · 24 January 2011

Scott F said:
Atheistoclast said:
According to Shannon, two copies of the New York Times has more information.
Dear, oh dear. Can't tell the difference between data and information.
My dear Clast, of course two copies of the New York Times have more information. If I got two copies of the New York Times in my mail box, I would have two new pieces of information that I would not have had if I had received only one copy of the newspaper: 1) My neighbor also gets the New York Times; 2) He didn't get his today. Since we seem to have it wrong, what distinction do you draw between "data" and "information"? Please use your own words rather than a link. A simple link doesn't prove that you know what is contained in the link. I would prefer to hear your thoughts on the subject. Thank you for your participation.
An even better analogy would be if a cook had two copies of a cake recipe, and made one cake per copy. And then one day, without the cook seeing or knowing, the cook's assistant made some changes to one of the copies, scribbling out cinnamon, milk chocolate, and all purpose flour, and replacing them with cardamom, dark chocolate and cake flour. And boom, we have two different cakes the next time the cook uses his two recipes. On the other hand, something tells me that Atheistoclast is going to refuse to understand this analogy, and, instead, vomit up some pseudoscientific gobbledegook, and use some racial against me because I'm not worshiping him for being some mediocre iconoclast-wannabe.

SWT · 24 January 2011

Rob said: Atheistoclast, What is your definition of information? Be specific. What is your definition of data? Be specific. If you offer no definitions, I call BS.
According to his Complexity paper,
Although the nucleotide sequences in DNA are commonly understood to carry/convey biological "information" [28], a precise scientific delineation for the term in the context of genetics is often found to be lacking. Therefore, it is impossible to test any hypothesis regarding the creation of new genetic information without offering at least a conceptual definition of what information means and what the criterion is for identifying it. In Shannon’s theory [29] of communication, information is termed the "reduction in uncertainty," where entropy is the measure of any stochastic dependencies -- the greater the level of uncertainty that exists in a particular situation, the less likely it is to predict the behaviors and outcomes because of the presence of random noise. Therefore, information is that which denotes a degree of determinism in a known relationship, although this would also have to involve a large measure of contingency to permit as many possible combinations to be conveyed. In the framework of molecular biology, information would refer to the inherent functionality of gene products: i.e., how they interact with the biochemical environment in which they operate. Therefore, I have decided to define any gain in exonic information as: "The qualitative increase in operational capability and functional specificity with no resultant uncertainty of outcome." The two parts of the statement are complementary, because an appreciably great degree of specificity is required to reduce any uncertainty and problems regarding behavior and effect: this is especially true in the case of enzymes that catalyze only particular reactions, and to the exclusion of all others.

Dale Husband · 24 January 2011

Atheistoclast said: READ THE PAPER! READ THE PAPER! READ THE PAPER! READ THE PAPER! READ THE PAPER! READ THE PAPER! READ THE PAPER! *IT HELPS TO READ THE PAPER* I AM REFERRING TO THE CHENG PAPER, IDIOT!
If you really want us to read it, COPY AND PASTE THE ENTIRE PAPER HERE, YOU DAMNED HEMORRHOID!

Stanton · 24 January 2011

Although Atheistoclast has repeatedly offered to email us his crummy paper, I don't think it will do any difference.

After all, he's pulled out your typical Creationist appeals to ignorance and incredulity, like the moronic "what good is half a limb," and he's also demonstrated that the real reason why so many editors shun him is because he's an asshole who uses racial slurs on anyone who disagrees with him.

Dave Wisker · 25 January 2011

This is why editors hate him--(his banning letter ffpm the editor of Evolutionary Biology:
This is actually quite a well written and cogent piece and I have to say that I agree with many things that you say here that are not about biology. The problem is that the entire argument about natural selection is deeply flawed. You mistake rhetoric for logic when it comes to arguing against a mechanistic view of evolution. I think that you also mistake belief in particular mechanisms (i.e. natural selection) with a materialistic view of nature. Evolutionary biologists including myself are quite open to the fact possibility that natural selection is not as important as people generally think or that other processes may be at work in evolution in important ways. The literature is full of arguments to that effect and you seem to have read enough of that you should realize that. What I and most scientists are not open to is the idea that showing that a particular mechanism is less important means that there must be divine intervention in the history of life. Here, two world views clash in ways that are impossible to adjudicate within science much less with scientific peer review. Natural selection as a mechanism has withstood intense scientific scrutiny over the past century and a half. That being said, the average evolutionary biologist today probably ascribes less explanatory power to it today than Darwin did in his. Materialistic evolutionary theory, however, is increasingly coherent despite this relative downplaying of natural selection. That is because a materialistic view of evolution is not dependent on a particular mechanism. Even if you did present a coherent argument against natural selection, which I don't believe you do, it would not be an argument for creationism. That is an intellectual leap that has nothing to do with logic or science. Even if we had no good mechanistic explanation for evolution, as a scientist, I would look for mechanistic explanations for our observations about the diversity and history of life. If I simply threw my hands up and said i can't explain this, it must be divine intervention, then I've ceased to be a scientist. This is why your papers are not acceptable here in Evolutionary Biology. There is no scientific debate about creationism versus evolutionary theory. There is a cultural discourse on this topic that does not have a foundation in science. Evolutionary biology is a scientific journal. If you call the assumption that natural phenomena have materialistic explanations an ideology, then yes we do have that ideology. So does pretty much every other journal in science. So, please do not submit any more essays or papers to evolutionary biology as it is now very clear that you have an ideology that falls into creationism or intelligent design. We will not review them and I will not read any more of them. It will simply waste your time to submit more papers like this. The next paper you submit will not get to my desk and will simply be rejected at the editorial office, so there is really no point preparing any further submissions. Any response from you to this decision will not be read or answered. I'm sorry to be harsh with this, but your persistence in submitting papers, your emails demanding review and explanations for decisions and the alarmingly caustic phone message that you left on my voicemail leads me to be very direct in this.

Dave Lovell · 25 January 2011

Atheistoclast said:
According to Shannon, two copies of the New York Times has more information.
Dear, oh dear. Can't tell the difference between data and information.
I would say that in laymans' terms, the information is what would be required to unambiguously regenerate the data. Do you concur? If you wish to extend the term "information" to somehow include something related to the purpose or meaning of the data, (which cannot by your definition ever be increased by mere chance, but only by the application of "intelligence") you need to provide the data/information to unambiguously define the extended meaning in such a way that everybody would agree on the amount of "Clastomation" in a set of data. For example, last week's winning lottery numbers contain almost the same amount of information as next week's? Do you think next week's have more "Clastomation". Certainly they are considerably more useful.

Atheistoclast · 25 January 2011

You are even dumber than I thought. LOL! Ever heard of mudskippers?
Yeah...they have fins and not legs. Indeed, I would contend that the mudskipper shows the impossibility of the fin to pod transition because it needs its fins when it returns to water. They also need their fins with which to "skip" on land. As I say, I haven't seen any evidence that there ever existed half fin - half pod structures that would not have been useful at all. I suppose you are also going to bring up the "lungfish" next time round?
Try googling "Oliver the 'Humanzee'", you idiot! He was actually an ordinary chimp that happened to be able to walk upright, just as our pre-human ancestors would have done. Yet he was a perfectly functioning animal in all other respects.
Trust you to bring up a circus trick animal. Shows how much you know or care about science. Chimpanzees cannot walk upright as we do - they cannot lock their knees in place. Bonobos can typically walk upright for a short distance before they get tired and have to return to knuckle-walking. http://www.arkive.org/bonobo/pan-paniscus/video-06a.html They don't have the pelvis, spine, inner ear, humeral-femural index, feet and many other features that make obligate bipedalism possible. So, we are *obligate* bipeds whereas chimps and bonobos can only do so for short periods of time. They prefer to knuckle-walk and brachiate.
All genes (and protiens) are made from parts of DNA (and amino acids), which are in turn made from atoms.
You don't say? Where did the *specific* arrangement of amino acids in these molecules come from? Trial and error?
Look who's talking! You haven't made a credible argument here yet, and we have just been laughing at you like hyenas.
Yes...I bet you sound just like a hyena.

Atheistoclast · 25 January 2011

Rob said: Atheistoclast, What is your definition of information? Be specific. What is your definition of data? Be specific. If you offer no definitions, I call BS.
Data is a quantity of objects/symbols that can *represent* information but which may still contain no information. This is because information is fundamentally a qualitative "substance". It conveys something of value or utility as part of an exchange of communication. For example, your hard drive may hold up to 100 Gigabits of data but it may nonetheless have no information content. It could just contain a random sequence of binary digits. Likewise the nucleotides in DNA would be meaningless stretches of chemicals except for the fact that they are specifically arranged to convey *information* pertinent to the functionality of the cell. The question is: who or what specified this information? It is crucial to the debate on evolutionary origins.

OgreMkV · 25 January 2011

SWT said:
Rob said: Atheistoclast, What is your definition of information? Be specific. What is your definition of data? Be specific. If you offer no definitions, I call BS.
According to his Complexity paper,
Although the nucleotide sequences in DNA are commonly understood to carry/convey biological "information" [28], a precise scientific delineation for the term in the context of genetics is often found to be lacking. Therefore, it is impossible to test any hypothesis regarding the creation of new genetic information without offering at least a conceptual definition of what information means and what the criterion is for identifying it. In Shannon’s theory [29] of communication, information is termed the "reduction in uncertainty," where entropy is the measure of any stochastic dependencies -- the greater the level of uncertainty that exists in a particular situation, the less likely it is to predict the behaviors and outcomes because of the presence of random noise. Therefore, information is that which denotes a degree of determinism in a known relationship, although this would also have to involve a large measure of contingency to permit as many possible combinations to be conveyed. In the framework of molecular biology, information would refer to the inherent functionality of gene products: i.e., how they interact with the biochemical environment in which they operate. Therefore, I have decided to define any gain in exonic information as: "The qualitative increase in operational capability and functional specificity with no resultant uncertainty of outcome." The two parts of the statement are complementary, because an appreciably great degree of specificity is required to reduce any uncertainty and problems regarding behavior and effect: this is especially true in the case of enzymes that catalyze only particular reactions, and to the exclusion of all others.
Ah yes, I understand now. The first bolded statement is correct. The second bolded statement (immediately following the first) is wrong. It is an assertion that you made up and has no basis in reality. Again, thanks for playing.

eric · 25 January 2011

Atheistoclast said:
According to Shannon, two copies of the New York Times has more information.
Dear, oh dear. Can't tell the difference between data and information.
Shannon's work is focused on transmitting data without loss, regardless of what that data may "mean." If you string out the characters in two copies of the NYT, it takes some number of bits to transmit this data. Then it takes one or more extra bits to specify how many times to repeat it. If you do not include those extra bits specifying the number of repeats, the signal you transmitted will not exactly resemble the original, so you will have lost information. Specifically, you will have lost information on the number of copies the original, transmitted signal contained. The number of repeats is information. In biology, it can be critical information, because number of repeats can control the amount of a protein produced. If the original recipe for a human calls for 2 units of a histone, but you only get 1 unit because your DNA didn't contain the right number of histone-building repeats, the result could be catastrophic. Repeats matter in biology. Lastly, even the number of copies of a NYT is important, real-life, honest-to-god information. A paper-deliverer can't decide how big a vehicle they need without knowing the amount of copies they will be delivering. The NYT can't decide how much paper or ink to buy without knowing number of copies. Advertisers can't decide how much an ad in the paper is worth without knowing distribution - i.e. number of copies purchased. And so on. Real-life, important decisions depend on the number of copies of the NYT. You'd have to be an idiot not to call it information.

fnxtr · 25 January 2011

Atheistoclast said: The question is: who or what specified this information? It is crucial to the debate on evolutionary origins.
(headdesk) The parents that lived long enough to breed.

OgreMkV · 25 January 2011

Atheistoclast said:
Rob said: Atheistoclast, What is your definition of information? Be specific. What is your definition of data? Be specific. If you offer no definitions, I call BS.
Data is a quantity of objects/symbols that can *represent* information but which may still contain no information. This is because information is fundamentally a qualitative "substance". It conveys something of value or utility as part of an exchange of communication. For example, your hard drive may hold up to 100 Gigabits of data but it may nonetheless have no information content. It could just contain a random sequence of binary digits. Likewise the nucleotides in DNA would be meaningless stretches of chemicals except for the fact that they are specifically arranged to convey *information* pertinent to the functionality of the cell. The question is: who or what specified this information? It is crucial to the debate on evolutionary origins.
Why are those your definitions and why don't you just use the same defintion that everyone uses. I could argue, and win, that everything is data according to your definition. These words I'm typing are representations of my thoughts, not my thougths themselves. Since they don't mean anything to you, 'clast', they don't contain any information for you. You definitions are meaningless. I'll stick to the standard defintions, thanks. The scientific revolution will not be led by you. Your second sentence is just plain wrong. Information IS NOT meaning. I don't know how you can quote Shannon and still not understand this. If I send an encrypted file over the internet, I am still sending information. There will be uncertaintity if it is sent over a noisy channel. Have you ever heard of a checksum? It's a method to determine if the recipient got what the sender sent. And yes, I can think of times when one would want to send white noise (i.e. purely random information) over a line AND make sure that purely random information was recieved exactly as sent. The fact that you cannot understand this just means you don't know anything about information theory or its use in the world. Third statement: white noise, random bits, are information. Just because you think they are random doesn't mean that they do not carry information. Random does not equal no information. You are confusing meaning and information... again. Fourth statement... no. You are confusing information and meaning... again. Twice in one post. Wow. The information in the DNA is the sequence. Again, that information can change without changning the meaning (i.e. the protein coded for). There are also ways of changing the meaning without changing the DNA. You have not addressed these issues, which means you don't know nearly enough about Biology. Finaly question... no intelligent agent did. There are perfectly natural, physical explanations for the formation of RNA, DNA, how they work, why they work, and what they do. You must know this, but your ideology blinds you to it. If you think that there is a designer, then please provide evidence that it exists. Here are some questions that you must answer. What is the difference in complexity between a designed thing and a non-designed thing? How does one measure complexity (values, units, and process)? What values in 2 indicate design? Why? What values in 2 indicate non-design? Why? That'll do for now. We can hit the other ones later. Hey, why don't you head over to the forum, since we're pretty OT here at this point?

DS · 25 January 2011

DS said: Hox genes definitely arose by duplication, after which they absolutely underwent divergence. Indeed, this has been a major mechanism behind the evolution of all of the diversity of body forms seen throughout the animal kingdom. This one example absolutely demolishes the hypothesis that gene duplication is not important in the evolution of novel functions. There are literally thousands of papers on this topic, here are a few to get the atheist guy started: Brooke et. al. (1998) The parahox gene cluster is an evolutionary sister of the hox gene cluster. Nature 392:920-922. McClintock et. al. (2001) Consequences of hox gene duplication in the vertebrates: An investigation of zebrafish paralogous grouped genes. Development 128(13):2471-2481. Lynch et. al. (2006) Adaptive evolution of hox gene homeodomains after cluster duplications. BMC Evolutionary Biology 6:86-94. Once you have read the papers you can answer these questions: 1) Did hox genes arise by duplication? 2) Dis hox genes diverge? 3) Did hox genes take on new functions? I can keep asking as many times as needed. Until you address this evidence you will not be taken seriously.
Still no answers eh genius? Ignoring an entire field of science isn't going to fool anyone. SInce you seem incapable of answering I'll answer for you. The answer to all three questions is yes, which you would know if you had read the papers. You lose. And of course this isn't the only example. Gene duplication has played a major role in the evolution of nearly every gene family, including hemoglobin genes, ribosomal genes, histone genes, olfactory genes, etc. Try as you might, you will never be able to come up with excuses for a all of these. Just give it up already. Evolution is real, deal with it.
Atheistoclast said: The question is: who or what specified this information? It is crucial to the debate on evolutionary origins.
Random mutations are acted on by natural selection, thus producing a functional genome which is capable of development and reproduction. That is where the information comes from. Now why don't you answer your own question for us? Where do you think the information comes from? Since your publication record is so great you surely must know. Unless you provide an alternative, then mutation and selection remains the best explanation. Now do make sure your alternative is scientific old chap. Would't want any ghosts in the machine now would we? You're going to publish this, remember?

DS · 25 January 2011

Ogre wrote:

"That’ll do for now. We can hit the other ones later. Hey, why don’t you head over to the forum, since we’re pretty OT here at this point?"

Seconded. We have now moved past the point of arguing about gene duplications. From here it will just degrade into GODDIDIT crap. THe moderators has been generous for the last twenty pages. I see no reason to clutter up the thread any further with off topic nonsense about ghosts and witches conjuring DNA out of their orifices. If this guy wants to continue the conversation, he can take it to the bathroom wall, or ATBC.

Oh well, at least he tried to discuss science for a while. That's a step up around here compared to IBIGOT and Kris.

eric · 25 January 2011

Slight variation on everyone else's response to Atheistoclast's 'what specified the information':

Mutation produces a wide variety of different information in different individuals. Selective processes then do the specification. If a tiger kills and eats you before you could reproduce, natural selection has done the specifying. If you can avoid the tigers but no one wants to have sex with you, sexual selection has done the specifying. If our alien overlords abduct and sterilize you, artificial selection has done the specifying.

In terms of human evolution, I will continue to discount the latter until you show us evidence of alien overlord breeding programs. The mere presence of 'information' in the genome is not evidence of alien overlords, since there are at least two other selection processes that could account for it.

SAWells · 25 January 2011

There's the germ of an interesting point here. It looks like 'clast imagines that evolution can only tinker with functional proteins, and there's some fundamental gap between simple precursor organic molecules and even the simplest functional protein. This harks back to a rather traditional, vitalist conception about matter: that matter is essentially inert.

But we who know anything about physics and chemistry know that matter isn't essentially inert. Every molecule does something- can react with something. There is no essential gap between base matter and functional proteins.

This is why 'clast keeps repeating that "evolution can only tinker" and imagines he's making a point. "Just tinkering" can get you all the way from the simplest precursor organic molecules to the most beautifully specific functional protein, because there are no fundamental gaps anywhere on the way.

RBH · 25 January 2011

SAWells said:This is why 'clast keeps repeating that "evolution can only tinker" and imagines he's making a point. "Just tinkering" can get you all the way from the simplest precursor organic molecules to the most beautifully specific functional protein, because there are no fundamental gaps anywhere on the way.
Which is, of course,descent with modification, which is what evolution is.

mrg · 25 January 2011

SAWells said: "Just tinkering" can get you all the way from the simplest precursor organic molecules to the most beautifully specific functional protein, because there are no fundamental gaps anywhere on the way.
You actually see this in machine design: Beech Bonanza was a single-engine civil lightplane. Modify to twin engines, get Twin Bonanza. Redesign to more capacious fuselage, uprate engines, get Queen Air. Change from pistons to turboprops, get King Air. Stretch and change to tee tail, get Super King Air. Stretch again, get Beech 1900 airliner. Raise the roof of the Beech 1900 so people can stand up, get the Beech 1900D airliner. So you might say the Beech 1900D isn't a "new design" but it almost certainly doesn't have a single component left in it from the Bonanza. Of course, all analogies between biology and machine design are basically creorobotic, but the point is that evolution works by the "incremental change" model, not the creationist "clean sheet of paper" model.

OgreMkV · 25 January 2011

http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=4d3eec405f2756ae;act=ST;f=14;t=7199

This thread is open and unused. It would be a fine place to discuss 'clast.

I would suggest you put the relevant parts of your paper (if you don't mind) or you could PM it to those interested (so it doesn't break out on the web).

Then we could really discuss it and use graphs and pictures and such... unlike this comment only thread.

mrg · 25 January 2011

RBH said: Which is, of course,descent with modification, which is what evolution is.
Hey RBH, you're pretty good about closing down threads that go on too long. I suggest this one is well into diminishing returns and needs to go to the ATBC? We need to set up an "Athiestoclast" thread there. If he wants to be humored, no problem in humoring him.

mrg · 25 January 2011

Boy howdy, I went over to ATBC to set up an Atheistoclast thread and RBH had already beat me to it.
Now THAT's service!

RBH · 25 January 2011

mrg said: Hey RBH, you're pretty good about closing down threads that go on too long. I suggest this one is well into diminishing returns and needs to go to the ATBC? We need to set up an "Athiestoclast" thread there. If he wants to be humored, no problem in humoring him.
I set up such a thread here. I'll close comments on PT and encourage folks to go there to continue.

Rob · 25 January 2011

Atheistoclast, I get to call BS anyway. You have developed your own inconsistent and contradictory definitions.
Atheistoclast said:
Rob said: Atheistoclast, What is your definition of information? Be specific. What is your definition of data? Be specific. If you offer no definitions, I call BS.
Data is a quantity of objects/symbols that can *represent* information but which may still contain no information. This is because information is fundamentally a qualitative "substance". It conveys something of value or utility as part of an exchange of communication. For example, your hard drive may hold up to 100 Gigabits of data but it may nonetheless have no information content. It could just contain a random sequence of binary digits. Likewise the nucleotides in DNA would be meaningless stretches of chemicals except for the fact that they are specifically arranged to convey *information* pertinent to the functionality of the cell. The question is: who or what specified this information? It is crucial to the debate on evolutionary origins.