Let's perform an example Assume you have just found a new stretch of DNA and you need to determine where to find an Open Reading Frame (ORF). An open reading frame starts with an atg (Met) in most species and ends with a stop codon (taa, tag or tga).Once the RNA has been transcribed, it travels from the DNA template to the ribosome on the endoplasmic reticulum to be translated for protein synthesis. Each 3 bases in the RNA sequence codes for 1 amino acid. As you may not be sure what position to start at when predicting what protein sequence may be produced by this code, you could start with one of 3 positions from either end of the RNA sequence. Thus there are 6 possible predicted protein sequences resulting from such a piece of code. These are known as the 6 possible reading frames. There are 3 forward frames and 3 reverse sense frames.
There are six possible interpretations, from right to left and left to right and with an offset of 0, 1 and 2. Biology WorkBench is a tool which allows you to enter DNA sequences and find the ORF which has the longest frame. Frame 1 start from left to right with zero offset5' TCAATGTAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATCCACT 3'
Note the atg which is a start codon and taa which is a stop codon Frame 2, offset 1S M * R A T R S S G P K F H P
tcaatgtaacgcgctacccggagctctgggcccaaatttcatccact
No start or stop codon Frame 3, offset 2Q C N A L P G A L G P N F I H
caatgtaacgcgctacccggagctctgggcccaaatttcatccact
No start or stop codon Frame 4, right to left zero offsetN V T R Y P E L W A Q I S S T
aatgtaacgcgctacccggagctctgggcccaaatttcatccact 47
One stop codon, no start codon Frame 5, right to left one offsetS G * N L G P E L R V A R Y I
agtggatgaaatttgggcccagagctccgggtagcgcgttacattga
One stop codon, no start codon Frame 6, right to left two offsetV D E I W A Q S S G * R V T L
gtggatgaaatttgggcccagagctccgggtagcgcgttacattga
The sixth ORF is the longest one. In "A First Look at ARFome: Dual-Coding Genes in Mammalian Genomes", Chung et al, show that dual coding genes are not as rare in mammals as initially expected.W M K F G P R A P G S A L H *
tggatgaaatttgggcccagagctccgggtagcgcgttacattga
Remember this paper which was quote-mined by Casey Luskin? The paper shows the following figure (click to enlarge) which is Figure 2 in the original paper) Notice how there is and ORF and an ARF, where ORF is the larger reading frame and ARF a subset, both ORF and ARF have a start and stop codon. Addition The ENCODE project proposes a new definition of geneCoding of multiple proteins by overlapping reading frames is not a feature one would associate with eukaryotic genes. Indeed, codependency between codons of overlapping protein-coding regions imposes a unique set of evolutionary constraints, making it a costly arrangement. Yet in cases of tightly coexpressed interacting proteins, dual coding may be advantageous. Here we show that although dual coding is nearly impossible by chance, a number of human transcripts contain overlapping coding regions. Using newly developed statistical techniques, we identified 40 candidate genes with evolutionarily conserved overlapping coding regions. Because our approach is conservative, we expect mammals to possess more dual-coding genes. Our results emphasize that the skepticism surrounding eukaryotic dual coding is unwarranted: rather than being artifacts, overlapping reading frames are often hallmarks of fascinating biology.
Mark B. Gerstein, Can Bruce, Joel S. Rozowsky, Deyou Zheng, Jiang Du, Jan O. Korbel, Olof Emanuelsson, Zhengdong D. Zhang, Sherman Weissman, and Michael Snyder What is a gene, post-ENCODE? History and updated definition Genome Res., Jun 2007; 17: 669 - 681.Figure 5. How the proposed definition of the gene can be applied to a sample case. A genomic region produces three primary transcripts. After alternative splicing, products of two of these encode five protein products, while the third encodes for a noncoding RNA (ncRNA) product. The protein products are encoded by three clusters of DNA sequence segments (A, B, and C; D; and E). In the case of the three-segment cluster (A, B, C), each DNA sequence segment is shared by at least two of the products. Two primary transcripts share a 5 untranslated region, but their translated regions D and E do not overlap. There is also one noncoding RNA product, and because its sequence is of RNA, not protein, the fact that it shares its genomic sequences (X and Y) with the protein-coding genomic segments A and E does not make it a co-product of these protein-coding genes. In summary, there are four genes in this region, and they are the sets of sequences shown inside the orange dashed lines: Gene 1 consists of the sequence segments A, B, and C; gene 2 consists of D; gene 3 of E; and gene 4 of X and Y. In the diagram, for clarity, the exonic and protein sequences A have been lined up vertically, so the dashed lines for the spliced transcripts and functional products indicate connectivity between the proteins sequences (ovals) and RNA sequences (boxes). (Solid boxes on transcripts) Untranslated sequences, (open boxes) translated sequences.
81 Comments
Bond, James Bond, Bornagain77 · 8 October 2007
Thanks for bringing this topic up PvM
But To give a little more background to the Complexity of Human Genome let's look at the ENCODE work:
In a group paper published in the June 14, 2007 issue of Nature and in 28 companion papers published in the June issue of Genome Research, the ENCyclopedia Of DNA Elements (ENCODE) consortium, which is organized by the National Human Genome Research Institute (NHGRI), part of the National Institutes of Health (NIH), reported results of its exhaustive, four-year effort to build a parts list of all biologically functional elements in 1 percent of the human genome. Carried out by 35 groups from 80 organizations around the world, the research served as a pilot to test the feasibility of a full-scale initiative to produce a comprehensive catalog of all components of the human genome crucial for biological function. The ENCODE consortium's major findings include the discovery that the majority of DNA in the human genome is transcribed into functional molecules, called RNA, and that these transcripts extensively overlap one another. This broad pattern of transcription challenges the long-standing view that the human genome consists of a relatively small set of discrete genes, along with a vast amount of so-called junk DNA that is not biologically active. The new data indicate the genome contains very little unused sequences and, in fact, is a complex, interwoven network. In this network, genes are just one of many types of DNA sequences that have a functional impact.
The revelation of a complex interwoven network is a major blow to evolutionists. Now bear in mind, this is only a “feasibility study” of 1% of the Genome. The interwoven complexity is sure to be multiplied exponentially as the effort extends to decipher the remaining 99% of the DNA. This preliminary study, of how DNA is actually encoded, clearly indicates that most, if not the entire 100%, of the DNA is “poly-functional”. Poly-functional simply means the DNA exhibits extreme data compression in its character. “Poly-functional” DNA sequences will exhibit several different meanings on several different levels. For instance, if you were to write a (very large) book similar to the DNA code, you could read many parts of the book normally and it would have one meaning, you could read the same parts of the book backwards and it would have another completely understandable meaning. Yet then again, a third equally coherent meaning would be found by reading every other letter of the same parts. A fourth level of meaning could be found by using a simple encryption program to get yet another meaning. A fifth and sixth level of meaning could be found in the way you folded the parts of the book into specific two and three dimensional shapes. Please bear in mind, this is just the very beginning of the mind bending complexity scientists are finding in the DNA code. Indeed, a study by Trifonov in 1989 has shown that probably all DNA sequences in the genome encrypt for up to 12 different codes of encryption!! No sentence, paragraph, book or computer program man has ever written comes close to that staggering level of poly-functional encryption we find in the DNA code of man. Here is a quote on the poly-functional nature of the DNA from renowned Cornell Geneticist and inventor Dr. John Sanford from his landmark book, “Genetic Entropy”:
There is abundant evidence that most DNA sequences are poly-functional, and therefore are poly-constrained. This fact has been extensively demonstrated by Trifonov (1989). For example, most human coding sequences encode for two different RNAs, read in opposite directions i.e. Both DNA strands are transcribed ( Yelin et al., 2003). Some sequences encode for different proteins depending on where translation is initiated and where the reading frame begins (i.e. read-through proteins). Some sequences encode for different proteins based upon alternate mRNA splicing. Some sequences serve simultaneously for protein-encoding and also serve as internal transcriptional promoters. Some sequences encode for both a protein coding, and a protein-binding region. Alu elements and origins-of-replication can be found within functional promoters and within exons. Basically all DNA sequences are constrained by isochore requirements (regional GC content), “word” content (species-specific profiles of di-, tri-, and tetra-nucleotide frequencies), and nucleosome binding sites (i.e. All DNA must condense). Selective condensation is clearly implicated in gene regulation, and selective nucleosome binding is controlled by specific DNA sequence patterns - which must permeate the entire genome. Lastly, probably all sequences do what they do, even as they also affect general spacing and DNA-folding/architecture - which is clearly sequence dependent. To explain the incredible amount of information which must somehow be packed into the genome (given that extreme complexity of life), we really have to assume that there are even higher levels of organization and information encrypted within the genome. For example, there is another whole level of organization at the epigenetic level (Gibbs 2003). There also appears to be extensive sequence dependent three-dimensional organization within chromosomes and the whole nucleus (Manuelides, 1990; Gardiner, 1995; Flam, 1994). Trifonov (1989), has shown that probably all DNA sequences in the genome encrypt multiple “codes” (up to 12 codes).
Dr. John Sanford (PhD in Genetics; inventor of the biolistic “gene gun” process! Holds over 25 patents! If you ate today you probably ate some food that has been touched by his work in manipulating the genetics of food crops!)
Though the ENCODE consortium is about to undertake the task of deciphering the remaining 99% of the humane genome, I firmly believe that they, and all their super-computers, are soon to be dwarfed by the sheer and awesome complexity at which that much required information is encoded into the three billion letters of the DNA code of man. As a sidelight to this, it takes the most powerful super-computer in the world an entire year just to calculate how a single 100 amino acid protein sequence will fold into a 3-dimensional shape from its 1-dimensional starting point. Needless to say, this impressive endeavor by ENCODE to decipher the entire genome of man will be very, very interesting to watch. Hopefully ENDODE’s research will enable doctors to treat a majority of the over 3500 genetic diseases (mutational disorders) that afflict man without having to fully understand that much apparent complexity in the DNA of man.
How's that for a Theistic prediction for ID?
PvM · 8 October 2007
It's neither a prediction nor relevant to ID. So let's address some of your misconceptions. These multiple coding levels in DNA are in many cases neither unexpected, nor a problem for evolutionary theory. Now I understand that complexity may seem to ID creationist to be an insurmountable problem, but that does not mean that these are problems for evolutionary theory.
For instance, the alternative splicing allows new proteins to be encoded without affecting the original protein. In other words, just like gene duplication, alternative splicing allows new information to be added to the genome. In fact, research already suggests some correlations between gene duplication and alternative splicing.
Gene duplication is not only an excellent source of new genetic information but also lies at the foundation of the evolution of scale free networks.
Scale free networks are both robust and highly evolvable. Sounds contradictory doesn't it. Science however has shown that contrary to 'common sense' the 'devil' is in the details.
Sanford's book is neither a landmark book nor particularly relevant and cut-and-pasting your comments does not help you case. Yes, in addition to these alternative reading and splicing, there are other ways to add information to the genome. Of course, you nor Sanford have really shown that this is a problem and I have shown in several comments and postings how these multiple levels of coding hardly need to be problematic.
Are you willing to discuss these findings or is this yet another hit and run posting?
Is that the Christian way to resolve these issue?
PvM · 8 October 2007
Venus Mousetrap · 8 October 2007
If I follow PvM's post correctly, the whole multiple codes stuff is perfectly consistent with evolution but NOT with ID. ID chaps are always inferring by analogy, particularly to human design and human programs - and humans don't write code like DNA. We write lines that have a single meaning. A blind process, however, that is simply picking up bits of code that it finds improves itself, would have no problem with picking up a dual coding system.
PvM · 8 October 2007
PvM · 8 October 2007
See addition to my original posting for ENCODE's perspective
Dan Gaston · 8 October 2007
tinyfrog · 8 October 2007
richCares · 8 October 2007
BornAgain77 identifies himself as a born again, therefore it is natural for him to lie and plagerize, that's what a good Christian does. Quite simple, really. Irember one christian that didn't lie, but he died.
PvM · 8 October 2007
Bond, James Bond, Bornagain77 · 8 October 2007
I respectfully disagree with you PvM,
Contrary to what you now seem to be claiming, Evolutionary thought was completely blindsided by the revelation that the genome carries very little unused sequences,,,for you to deny that this was/is very problematic to RM/NS is, to put it mildly, glossing over a severe mis-prediction of the Darwinian camp...Whereas, you well know, many prominent IDers predicted that the junk DNA would be found to have function! Indeed,,the level of complexity even surpassed many ID proponents predictions and really only fits into the specific Theistic predictions made for ID... As for myself, I remember very well being chastised by your guest on this very blog, last spring, for predicting that the genome would be found to have virtually 100% functionality!!! (I was pressed by one of your guest for a specific prediction that ID makes and I quoted 100% functionality!) I was vindicated in short order when the ENCODE paper came out a short while later.
Your are a good PR man with a lot of talent for spin PvM, and I'm sure you will find a way to deny that Intelligence is required to explain this complexity in the Genome.... But believe me when I predict this following prediction PvM...The complexity that will be found in the remaining 99% of the genome will far, far surpass in complexity what we are looking at right now!!!!!!! If you are a betting man PvM, this is sure money, so if I were you I would hedge my bets against any of your evolutionary predictions!!!! You don't want to be burned this badly again!
By the way...I'm not perfect by any means...Just forgiven!!!
Stanton · 8 October 2007
PvM · 8 October 2007
PvM · 8 October 2007
You claim I am a good PR person, and while I appreciate your flattery, the truth is that I am a far better science person. I try to familiarize myself with the science as well as the musings of ID. Based on the limited original contributions by you as well as some continued ignorant comments about evolution, I seem to be safe to conclude that your understanding of evolution is shaped by such sites as AIG and other anti-science sites. See the problem is not that AIG is anti-science, but rather that they like ID are trying to sell their nonsense as science. As such they make Christians look foolish and people will reject Christians' claims about their faith as foolish as well.
Is that what you have in mind? You have been forgiven and nothing else matters? Do you really believe that such a position serves God best?
Why not amaze yourself, others and God with a true attempt at educating yourself. And I am saying this in the nicest way since I am convinced that your ignorance is not by your own chosing. As an ex Young Earth Creationist, I used to be much like you, convinced by the righteousness of my fellow Christians, only to find out how I had been lied to.
Let's try this once more and see if you can learn or at least educate yourself. Explain how ID defines complexity, explain how ID defines 'design'.
Simple or at least important concepts and still I bet you have no idea how ID deals with them.
Stanton · 8 October 2007
PvM · 8 October 2007
PvM · 8 October 2007
David Stanton · 8 October 2007
BJ Bond wrote:
"By the way…I’m not perfect by any means…Just forgiven!!!"
NOT BY ME!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Henry J · 8 October 2007
rog · 8 October 2007
PvM,
You patience is Christian is scope. Thank you for your clear refutations of the sad troll BJB.
rog
PvM · 8 October 2007
Cedric Katesby · 9 October 2007
PvM, I'm curious about your YEC background.
I'd be interested to here what made you leave it behind.
Was there something specific that made you reject YECism or was it a slow process?
Did people around you react negatively to your rejection of YECism?
If this is covering old ground or it's too personal, then apologies in advance.
Toni Petrina · 9 October 2007
So, this breaks down the potential human intelligence analogy since most computer code is relatively straightforward and imperative, note interleaved and interpretative (in sense that same sequence can be read differently with different results)?
Than equivocation between human design and DNA is absolutely false?
Bond, James Bond: bornagain77 · 9 October 2007
Interesting references PvM
Of special note;
Eukaryotic phenotypic diversity arises from multitasking of a core proteome of limited size. Multitasking is routine in computers, as well as in other sophisticated information systems, and requires multiple inputs and outputs to control and integrate network activity.
Big glitch in reasoning in this remark,,as it is with all your other references,,,He PRESUMES that evolution is true and then goes about to prove it...This is clearly the practice of very bad science when he presumes the answer prior to investigation! I'm sure I don't have to remind you of the lack of evidence for beneficial mutations (Including your highly touted HOX genes!) If you can find some observational evidence showing the origination of complexity, instead of degradation of preexisting genomes of parent species, this might be more impressive for IDers!
I find his reference to computer programs very interesting...How many computer programmers do you think,,think it is possible for a computer program, that far, far surpasses in complexity any computer program written in man (Bill Gates), to arise by accident?
Not many I would think,,,But hey ..Like I said earlier you are very good at spin,,,so I'm sure you can sell it to the gullible!
By the way Stanton,,, Though I don't mean to sound rude to you,,,It is definitely not you that I am worried about receiving forgiveness from!!
Stanton · 9 October 2007
Given as how you are a smug, arrogant idiot, I have no reason to give you any forgiveness in the first place: in fact, I make it a point to dislike people who use their faith in God act like Godless assholes.
Can you explain why IDiots have not explained why pufferfish have survived and prospered so well without Junk DNA, or can you not find any sites to copy and paste from?
JM Ridlon · 9 October 2007
B,JB,BA77 said:
"I respectfully disagree with you PvM,
Contrary to what you now seem to be claiming, Evolutionary thought was completely blindsided by the revelation that the genome carries very little unused sequences,,,for you to deny that this was/is very problematic to RM/NS is, to put it mildly, glossing over a severe mis-prediction of the Darwinian camp…Whereas, you well know, many prominent IDers predicted that the junk DNA would be found to have function!"
Maybe he should read this paper:
Nobrega MA, et al. Megabase deletions of gene deserts result in viable mice. Nature 2004; 431:988-993.
This study deleted 845 thousand bases and 1.5 million bases from mESC (2). The deleted regions, known as "gene deserts" are devoid of protein coding sequences and are what has been referred to as "junk DNA". Thus, deleting these segments in the embryonic stem cell line will result in adult mice (if they survive) lacking these segments of the genome (homozygous deletions) in all of their cells. If these sequences are necessary for building and maintaining the adult mouse, these deletions should be lethal or greatly affect the phenotype compared to wild-type. The results, you ask? Well, the mice were "indistinguishable from wildtype littermates with regard to morphology, reproductive fitness, growth, longevity, and a variety of parameters assaying general homeostasis." They conclude, "these studies further support the existence of potentially 'disposable DNA' in the genome of mammals."
So, large stretches can be deleted without obvious phenotypic effects in mammals, at least mice. Also, saying that ""junk DNA" will be found to have some function" is different than predicting an actual function and discovering it. Also, in what way would functionality of "junk DNA" somehow provide evidence that we were supernaturally created?
Stanton · 9 October 2007
Bond, James Bond; bornagain77 · 9 October 2007
Ridlon and Stanton,
How much do you want to bet that genetic diversity and/or overall viability/fitness of the offspring of such "knockout mice" is indeed limited and noticeable as far as the diversity and viability/fitness that is present in the parent species? My bet is that it will definitely be less than the parent species!..For example, I could remove major portions of a car and still have a car that performed its basic functions, Yet it would suffer in other areas noticeable areas when rigorously tested!...Thus, this example is a lot different than proving that the genome that was removed is absolutely and totally useless in its overall fitness in life! Plus, as someone mentioned before, I'm enamored by ENCODE!
....The ENCODE consortium’s major findings include the discovery that the majority of DNA in the human genome is transcribed into functional molecules, called RNA, and that these transcripts extensively overlap one another....
Thus I have hard scientific evidence that the majority of the Genome does indeed have some type of unknown function! Whereas, you have a superfluous example (an example by the way, which actually may be a very useful diagnostic technique in studying the genetic diseases of man) in which you claim absolutely no function is present in genome, for large swaths of the genome were removed and BEHOLD THE MICE LIVE!!!) Excuse me for being underwhelmed by your evidence for the non-functionality of the genome!
David Stanton · 9 October 2007
BJ Bond wrote:
"By the way Stanton,,, Though I don’t mean to sound rude to you,,,It is definitely not you that I am worried about receiving forgiveness from!!"
Obviously!!!!!!
This is the problem with holier-than-thous. They lie and insult people deliberately, repeatedly and unrepentenly and then claim that their conscience is clear because God forgives them. Well BJ, I would be more than happy to forgive you if you would just respond to some of my questions. I would be more than happy to forgive even your immense ignorance if you at least showed the slightest inclination to read the real scientific literature. I would even be willing to forgive your arrogance and condescending tone if you were willing to engage in some meaningful conversation instead of cut-and-paste nonresponses. You claim that you don't mean to be rude, but how can such behavior reasonably be interpreted in any other way?
And by the way, I am not "Stanton". I am using the name "David Stanton" exclusively. This does not however imply that I disagree with the postings of "Stanton" in any way. It just means that I use one handle consistently, unlike yourself. And just for the record, using the name of someone with a lisence to kill and claiming divine forgiveness is almost as hypocritical as claiming that you have all of the answers and not even bothering to read the relevant literature.
JM Ridlon · 9 October 2007
"The ENCODE consortium’s major findings include the discovery that the majority of DNA in the human genome is transcribed into functional molecules, called RNA, and that these transcripts extensively overlap one another."
Reread the paper, there were something like 120 pseudogenes, 19% of which were expressed. Many RNA's were expressed, but whether they are indeed "functional" is another matter. This can not be determined from the ENCODE data.
Also, you were "underwhelmed" by this data? The mice didn't just live. I will repeat, "[the knockout mice]indistinguishable from wildtype littermates with regard to morphology, reproductive fitness, growth, longevity, and a variety of parameters assaying general homeostasis."
Bond then said: "For example, I could remove major portions of a car and still have a car that performed its basic functions, Yet it would suffer in other areas noticeable areas when rigorously tested!…"
The point of this study was that "major portions" were not removed. You can bet all you want, but the fact is that these mice appeared completely normal. In the end, this DNA was not necessary for a mouse to develop to adulthood and live a normal life.....it was "junk DNA".
JM Ridlon · 9 October 2007
I don't want to appear to be defending "junk DNA". I definitely think that we will be finding more and more functions, indeed some novel types of regulation. However, Bond is ignoring data to support his erroneous conclusion. Even if every base was found to be functional, this in no way provides any evidence for intelligent design, or for that matter evolution. The question is, how did this function arise? Unfortunately for Bond and other ID advocates, there are no credible tools by which one could establish whether ANYTHING is designed by a supernatural being. Your extraordinary claim will require extraordinary evidence.
Bond, James Bond; bornagain77 · 9 October 2007
Ridlon you stated:
Reread the paper, there were something like 120 pseudogenes, 19% of which were expressed. Many RNA’s were expressed, but whether they are indeed “functional” is another matter. This can not be determined from the ENCODE data.
Man,,You got to love this science stuff!...So are you really saying that the genome will actually be found to have pseudo-functionality????
Well, if you are, I firmly disagree. As I stated in my original post....
....Though the ENCODE consortium is about to undertake the task of deciphering the remaining 99% of the humane genome, I firmly believe that they, and all their super-computers, are soon to be dwarfed by the sheer and awesome complexity at which that much required information is encoded into the three billion letters of the DNA code of man. As a sidelight to this, it takes the most powerful super-computer in the world an entire year just to calculate how a single 100 amino acid protein sequence will fold into a 3-dimensional shape from its 1-dimensional starting point. Needless to say, this impressive endeavor by ENCODE to decipher the entire genome of man will be very, very interesting to watch....
So Mr. Ridlon my prediction is the exact opposite of yours....
But alas, We will both have to await future developments in the deciphering of the human genome. But in the mean time please keep saying over and over again "The majority of the Genome is useless...The majority of the genome is useless...The majority of the Genome is useless,,,and please do spread it all over the web ...Hey even publish some peer reviewed papers if you can....Because, believe me when I tell you this...The complexity that will be found in the remaining 99% of the genome will DEFINITELY far, far surpass in complexity what we are looking at right now!!!!!!!
raven · 9 October 2007
rog · 9 October 2007
BJB
DaveScot over at Uncommon Descent is clear that there is likely to be non-functional DNA and offers a theory.
DaveScot: "I still fail to see how ID predicts no junk DNA. Random mutation definitely happens and if it’s good at *anything* it’s good at producing unorganized, non-functional crappola. It can produce crap out of nothing and it’s even better at making crap out of stuff that wasn’t crap to begin with."
Also, from the Onion Test http://genomicron.blogspot.com/2007/04/onion-test.html
Why does the Onion need about 5 times the non-coding DNA that a human does?
rog
JM Ridlon · 9 October 2007
PvM · 9 October 2007
PvM · 9 October 2007
The term 'multitasking' is uses in much the same way as others have referenced the existence of multiple codes in the genome. Although Bond asserts that this was a surprise to evolutionists and that evolution cannot explain it, I have shown that both statements were erroneous.
In fact, as I have shown, alternative splicing is very similar to gene duplication in that an alternative splice can evolve without much impact to the original splicing.
So what is left for Bond to do? Take my challenge and explain how ID defines complexity and design?
Or run...
What would be the Christian response?
PvM · 9 October 2007
What we know is that about 1.5% of the genome is transcribed into proteins, that about 5% of the genome is under selection although this is based on reference sections being under neutral selection. ENCODE already found stretches of pseudogenes, and although the majority of DNA, not all, DNA is transcribed, there will always remain junk DNA.
That some junk DNA would have function or that non-protein encoding DNA would have a function were all evolutionary predictions and NOTHING was based on novel research or hypotheses from ID creationists
Erasmus, FCD · 9 October 2007
Hey, bornagain.
Show us some of that good tard you save for UD. I wanna see the fortyeleven reasons why materialism is dead and what theism predicted first.
Cause, uh, when you actually start making an attempt to discuss biology it's kinda sad and disappointing. Like watching a clown get beat up by a ninja. You should stick to your element.
C'mon, don't let me down old buddy. You can't buy that stuff in stores, and I bet there is a lot of chaps here who have never been exposed to that particular flavor of the Deep Tard.
Stanton · 9 October 2007
Mike · 9 October 2007
Careful. Just because you find an ORF doesn't mean that you have a transcript. Unless you have some RNA, and know which strand its coded on, you don't have jack. Take the sad, sad case of EPR-1, still messing up the database as accession # L26245. The author fished it out with sloppy probing, looked at it in the wrong orientation, and for years thought they had a gene for a cell surface receptor.
You folks, especially Bornagain, are getting way, way, ahead of yourselves. Ascribing a function to any particular stretch of DNA takes much more work than I see acknowledged here. Can't be done by computer. Best that can be done is prediction, most of which will be wrong. We have absolutely no idea how much of the mammalian genome is filler, or not, won't know for quite some time, and anyone who tells you they know is a fool, or lying.
CJO · 9 October 2007
PvM · 9 October 2007
JM Ridlon · 9 October 2007
Why are the IDers so against DNA not having function anyways? Is it the "God don't make no junk" line? This should be obvious to them that their designer does in fact make tons of junk...just look at all the failed human experiments for starters.
Henry J · 9 October 2007
Torbjörn Larsson, OM · 9 October 2007
Torbjörn Larsson, OM · 9 October 2007
JM Ridlon:
Yes, good design is an emotional question for many of IDCers. I think PvM refers to "perfect design" (100 % functionality) vs "intelligent design" (no priors, because no description of the designer).
But there is also a persistent belief among people like Behe that "information" (IDC sense, ie unspecified nonsense) is "preloaded". Behe admits to common descent, but he thinks the mechanism is a preloaded mechanism that evolution doesn't describe. (So no "macroevolution", again in IDC sense with "kinds" and all that unspecified nonsense.)
I don't think they envision any particular amount of non-functional DNA, as they probably think it is created by evolution. They must have some 100 % perfect code corrector for their preloaded mechanism, seeing that mutations wreak havoc in any sequence that evolution doesn't conserve. But as always, they don't want to put that to paper or test, because it could prove them wrong.
Henry J · 9 October 2007
Dale Husband · 9 October 2007
realpc · 9 October 2007
"humans don’t write code like DNA. We write lines that have a single meaning."
So, that's supposed to be an argument against ID? Because the intelligent universe is infinitely better than any human programmer, that means DNA must have just fallen together by chance? I am not able to follow the logic there.
Please, someone explain to me how these amazing programs get written by chance. Please don't say "given long periods of time and an infinity of parallel universes." I want a serious answer.
PvM · 9 October 2007
realpc · 9 October 2007
"If you are really interested in how real science explains these codes"
I am familiar with the standard explanations. They are ridiculous. Parallel universes, natural selection over millions of years. The same old tired BS.
PvM · 9 October 2007
Torbjörn Larsson, OM · 9 October 2007
PvM · 9 October 2007
Cedric Katesby · 10 October 2007
BJ Bond and RealPC on the same thread.
The gift that keeps on giving.
Henry J · 10 October 2007
PvM · 10 October 2007
ID is a gift that keeps on giving. One can bring up so much research to show that ID has no content compared to science.. Of course, IDists are conditioned to marvel that anytime a gap is filled, two new ones arise.
Venus Mousetrap · 10 October 2007
And realpc's question shows exactly why we don't want ID in science classes - the same reason that I don't ask six year olds to examine my teeth and replace my fillings.
I mean, this really is not difficult. I understood the very basic concept of evolution when I was sixteen and in school, and creationists can't manage even that? Frankly, the people who carry on this idiocy about evolution being 'random chance' should be ashamed of themselves - when they are corrected on it every single time they say it! I learned the first time - why can't they?
Under these circumstances it's difficult not to see creationists as dishonest - but we try, because we're the good guys. That's the only reason you get to debate in the first place - you know full well if the situation were the other way, you would not be so keen to teach the controversy. And this is not an empty claim. You see Uncommon Descent? Ever seen a good honest debate there? It's like Orwell City. If you want evidence of that, feel free to take a peek at After the Bar Closes.
realpc · 10 October 2007
I always say random mutations PLUS NATURAL SELECTION, PLUS SOME OTHER NONSENSE. But it's still basically chance throwing complex machinery together. Codes with different meanings depending on where you start or what direction you read them. Thrown together by chance. Yes, of course it seems obvious to you if you are determined to deny intelligence in nature. Sure, anything can happen by chance given infinite time and an infinite number of parallel universes. You can talk yourself into any kind of irrational nonsense. Creationists talk themselves into believing irrational nonsense, so why can't you?
Any human being who wants to believe something can talk him/herself into believing it. All evidence and logic can be easily swept aside by the desire to believe.
You Darwinists (or whatever you prefer to call yourselves these days) are every bit as irrational and unscientific as Christian Creationists.
PvM · 10 October 2007
Venus Mousetrap · 10 October 2007
You just said it again, realpc. Thrown together by chance. In your case you're a troll and just pretending stupidity to bait people (or you wouldn't repeat the nonsense about parallel universes, which isn't even slightly connected to evolution, after being corrected - and I note also, like all creationists, you didn't explain that point, you probably just threw it in there because it causes doubt), but sadly, genuinely stupid creationists also do this - even on UD, where the phrase 'chance worshippers' often appears. It's a strawman, no better than the stupid tornado-in-a-junkyard (but hey, don't take OUR word that ID is creationism recycled).
If you have an alternative explanation than 'creationists are too stupid to learn' or 'creationists are too dishonest to tell the truth', feel free to drop it here.
realpc · 10 October 2007
"the nonsense about parallel universes, which isn’t even slightly connected to evolution"
Of course it is. Parallel universes are used to explain how utterly unlikely things can nevertheless happen. The origin of life and the origin of new species are problems for MET. The parallel universe idea is used to explain away the origin of life. It had to happen, given an infinite number of universes. EVERYTHING had to happen, no matter how impossible.
And yes, the origin of life is a problem for MET. If you are claiming that intelligence is something generated by brains, and is not a property of nature in general, then you MUST believe life originated by chance. And if you have no plausible theory about how this could happen, then the contempt you express for ID is not justifiable.
PvM · 10 October 2007
PvM · 10 October 2007
Popper's Ghost · 10 October 2007
Popper's Ghost · 10 October 2007
Popper's Ghost · 10 October 2007
Cedric Katesby · 11 October 2007
RealPC is a very special person.
According to her, Science is really Art.
Claims to have a Phd in something or other.
Oh, and she likes 'negative theories'.
http://ambivablog.typepad.com/ambivablog/2007/09/not-random.html
Torbjörn Larsson, OM · 11 October 2007
Anna · 19 October 2007
Abiogenesis is chap 1 in a wholly natural evolution of life process. Evolutionists cannot be wholly credible unless they can demonstrate that abiogenesis is actually possible. I don't think that has been demonstated yet,though obviouly most evolutioninsts believe it is possible.Thus, at present, there is room for other theories. Evolutioninsts should not be so harsh and judgemental about people who are sceptical that something so bizarre and complex as life is a result of spontaneously forming self-reproducing proto-cell gradually mutating into a conscious, thinking, feeling person. And yes, people like realpc and bjb have a right to voice their beliefs, even if they are wrong, without being constantly belittled and insulted. They can read, they can write, i.e. they are not morons, and I see no reason for calling them liars, unless you guys possess supernatural psychic powers and can divine their true beliefs.
PvM · 19 October 2007
Henry J · 19 October 2007
Re "Evolutionists cannot be wholly credible unless they can demonstrate that abiogenesis is actually possible."
There was a time before which life dind't exist.
Life exists now.
Therefore life began in a place that had no life before that.
Q.E.D.
Henry
Anna · 19 October 2007
To: pvm. I was referring to ID, although there are others. For ex, DNA structure discoverer, Watson, I think, believes life was seeded by aliens, and I vaguely recall reading something about some sort of self-organization theory in some Santa Fe's institute. You probably know a lot more about this than I do. I am not a scientist(obviously), and though I always revered science and scientists, and had taken many courses in college, it is the ID/evolution contoversy that I only recently discovered existed, that now makes learning scientific facts exciting for me.
To Henry: what you say is logical, and yet can only be true if we exclude a priory (is this the right spelling?) the influence of some sort of "power" beyond our knowlege or comprehension.
The point that I learned from IDists that I found to be a very good one is that life by en large is a mystery. There is a lot we don't know. To the best of my knowledge life does not self-assemble under various laboratory conditions tried. Whether that's simply a temporary lack of success, or a result of an actual impossibility, sans the above mentioned "power", I have absolutely no idea. But it's fun to speculate.
Henry J · 20 October 2007
PvM · 20 October 2007
PvM · 20 October 2007
Torbjörn Larsson, OM · 20 October 2007
Glen Davidson · 20 October 2007
saher · 5 October 2008
welll it was a good article
. it has answered several of my questions but if u
plzzzz answer one of question ..plzzzzzzzzzzzzzz.
i shall really appreciate it .
what would u say about one gene one enzyme hypothesis????
doesnt this theory of multiple transcripts negate it???
was that one gene one polypeptide hypoyhesis wrong ???
a gene may form many mRnas i.e it can also form amny
polypepptides?????
plzzz plzzz reply as soon as possible on my E-mail
address.. plzzzz
Marissa26Sims · 11 June 2010
I strictly recommend not to hold back until you earn big sum of cash to order different goods! You should just get the personal loans or just auto loan and feel yourself free