Dembski Finds the Transcript

Posted 12 November 2005 by

William Dembski finally managed to find the transcript of Shallit's testimony. Since I've been correct on predicting his behavior all the way along so far, I've taken another stab at it at Dispatches from the Culture Wars. Update: Holy cow, I missed this the first time. Yesterday I asked the rhetorical question, would Dembski continue to embarrass himself in this situation regarding Shallit's testimony? Well, we have our answer. Not only is he continuing to embarrass himself, he's digging the hole even deeper. He's now compounding his dishonesty with an attempt to erase the past. He has now deleted all three of his previous posts where he made the false claim that Shallit had been pulled from testifying by the ACLU because his deposition was an "embarrassment" and a "liability" to their case, even after one of those posts got almost 100 comments in reply to it. There's no word so far on whether he will change his name to Winston Smith. This really is dishonest behavior, there's no two ways about it. Clearly, Dembski's world is one in which he thinks he can rewrite history and no one will notice. I'm dying to hear how his toadies will defend this behavior. It's not defensible on its own, so they can only attempt to distract attention away from it with a tu quoque argument or pointing fingers at others. So let's hear what they have to say. Salvador? O'Brien? DonaldM? Let's hear you defend this dishonest and Orwellian behavior. And tell us again how it's evolution that undermines ethics and morality while you're at it. Update #2: Oh, here's Dembski's latest on the subject, in a comment responding to being asked what happened to the previous posts on the subject:
The previous postings were a bit of street theater. I now have what I needed. As for responding to Shallit and his criticisms, I have been and continue to do so through a series of technical articles under the rubric "The Mathematical Foundations of Intelligent Design" --- you can find these articles at www.designinference.com. The most important of these is titled "Searching Large Spaces." Shallit has indicated to me that he does not intend to engage that body of work: http://www.uncommondescent.com/index.php/archives/155.
A bit of street theater? Okay, let me see if I understand this. Dembski engaged in a bit of "street theater" - meaning "told a lie" - to get a copy of the transcript that he could have gotten two months ago because it's been publicly available all along? And now instead of admitting to the lie, he's just erasing the evidence of it? Okay, let's call a spade a spade here. Dembski is a lying scumbag with no regard for the truth whatsoever. Period. Just when you think he's hit rock bottom, Dembski begins to tunnel.

470 Comments

Andrea Bottaro · 12 November 2005

Hilariously, Dembski has now deleted all his previous posts on Shallit "embarassing himself", and in his new post he doesn't even acknowledge that he got to the transcript only after days of whining the ACLU, the NCSE, and Shallit himself were hiding it (this while people kept telling him it was freely available, if he just looked for it). Not a word of apology, not an acknowledgment. The guy just cracks me up.

Steve S · 12 November 2005

Someone should ask Salvador Cordova what he thinks of Dembski in light of this dishonest behavior.

My guess is he'll think something like "Bill Dembski is a sexy genius", if his previous sycophancy is any indication.

Did anybody save the Dembski posts before he deleted them? Or do we need to look in Google Cache?

Throwaway Comment · 12 November 2005

Sin of pride.

'Rev Dr' Lenny Flank · 12 November 2005

I hear it goeth beofre a fall.

wad of id · 12 November 2005

google cache:

http://64.233.167.104/search?q=cache:Aat6Dkz7FZwJ:www.uncommondescent.com/index.php/archives/438+site:uncommondescent.com+shallit&hl=en
http://64.233.167.104/search?q=cache:CQJL7DqBdnEJ:www.uncommondescent.com/index.php/archives/439+site:uncommondescent.com+shallit&hl=en

save those pages for posterity.

Sir_Toejam · 12 November 2005

bets on whether Sal will decide to post in this thread?

John · 12 November 2005

> google cache:

Cool. I just printed the pages into PDF.

By the way:

http://web.archive.org/web/*/www.uncommondescent.com/index.php/archives/438

"We're sorry, access to http://www.uncommondescent.com/index.php/archives/438 has been blocked by the site owner via robots.txt."

F'n coward.

Sir_Toejam · 12 November 2005

Dembski begins to tunnel

...like a naked mole rat. one wonders if he tunnels far enough, whether he will find where he really belongs.

John · 12 November 2005

BTW, I think someone should download the whole blog.

Sir_Toejam · 12 November 2005

hell, dembski's claims border on liable, much more so that whats-his-face's claims against Scott.

I wonder if Shallit will sue him?

naw, that's a pussy attitude reserved for IDiots like dembski et. al.

Rich · 12 November 2005

Dembski's revisionist history is no new thing. Didn't he promise to put a timestaped webpage after his next cunning ruse? URL, anyone.

The great irony is of the course that the Fig Newton of information theory who can tell us how to find go.....intelligence in the design of things can't find a publically available document on the web. I eagerly await his next book, "finding your arse with both hands, a guide for christians".

Sir_Toejam · 12 November 2005

lol. don't doubt he would write just such a book if he thought it would make him some bucks. It's all he's about.

Andrew Mead McClure · 12 November 2005

Someone should ask Salvador Cordova what he thinks of Dembski in light of this dishonest behavior.

Prediction: The next spin from the Dembski camp will be that this entire situation is somehow the panda's thumb's fault, because they are "obsessed" with him. Dembski is the poor, abused victim of a bunch of vindictive, obsessive internet stalkers, who just refuse to leave Dembski in peace to perform his important personal work of making false and damaging statements in writing about another public figure.

pipilangstrumpf · 12 November 2005

Street theatre is good description of the entire intelligent design debate.

Sir_Toejam · 12 November 2005

btw, a synthesis of BD's lies would be a good thing to post on any open reviews of his books. He obviously lives on book incomes and grants from DI, so why not encourage folks to stop sending him money?

or would that be like trying to convince folks to stop sending Pat Robertson money?

PaulC · 12 November 2005

This reminds me of that scene in My Cousin Vinny:
Mona Lisa: Don't you wanna know why Trotter gave you his files? Vinny Gambini: I told you why already. Mona Lisa: He has to, by law, you're entitled. It's called disclosure ...
It's actually funnier, considering the deposition was made by his side in the trial. Wouldn't TMLC give him a copy? He could have got it any number of ways without resorting to "street theater" (i.e., lies, baseless accusations, and whining).

Russell · 12 November 2005

He obviously lives on book incomes and grants from DI, so why not encourage folks to stop sending him money?

I'm not completely clear on your point. Surely you're not suggesting that the DI would cut off grant support for dishonesty, lack of integrity, sleaziness, or anything else this whole exchange highlights? Heck. Those are minimum qualifications to get a DI grant in the first place.

Mark Perakh · 12 November 2005

In his latest post regarding Shallit's deposition Dembski refers to his "technical" articles on the so-called "mathematical foundation of intelligent design." He asserts that these articles respond to Shallit's critique. This is not true. As far as I know, there are so far three such articles. One of them was dated many years back, so it obviously could not in any way respond to Shallit. The other two - one introducing an allegedly novel measure of information which Dembski dubbed Variational Information or something like that (but which in fact is a well known for over 40 years Renyi divergence of the second order), and the other about a search for a small target in a large search space - contain nothing that can be construed as a response to Shallit's critique. This reference to his other articles as allegedly responding to Shallit is just one more display of Dembski's habitual tactics of evasions and distracting maneuvers instead of a decent response to critique. Besides Shallit, Dembski has never responded in a substantial way to many other critics of his output (and I am just one of such critics)- instead he resorted to supercilious and dismissive remarks - so this most recent story about Dembski supposedly being unable to locate Shallit's deposition adds little to what is known about his concept of honesty anyway. There is ample material documenting Dembski's often unethical behavior both on this blog and on Talk Reason (see here)

R.O. · 12 November 2005

I'm dying to hear how his toadies will defend this behavior. It's not defensible on its own, so they can only attempt to distract attention away from it with a tu quoque argument or pointing fingers at others. So let's hear what they have to say. Salvador? O'Brien? DonaldM? Let's hear you defend this dishonest and Orwellian behavior.

— Ed Brayton
I responded to you here

Mike Walker · 12 November 2005

The banner across the home page of William Dembski's current employer, the Southrn Baptist Theological Seminary, begins "For the Truth...". I guess it all depends on what the meaning of "Truth" is... And perhaps Dembski should reread a speech made by the president of his institution, Albert Mohler, to remind himself of the standards to which he is (supposedly) being held accountable to:
Core Values [T]here are many "core values" behind such a God-centered mission. For instance, the seminary wants its students to have a passion for the Great Commission. It also wants its students to maintain personal integrity and to have God-honoring families. -- Personal integrity. "We as an institution must take responsibility to make certain that those who serve here, teach here, lead here and govern here ... know that that is a non-negotiable expectation," he said. "Nothing will destroy a ministry ... so immediately ... than a default in personal integrity."
Not surprising that ID is in such bad shape, is it? But then, I'm not really sure Dembski is there for any higher moral purpose than to perpetuate his self aggrandizing career after being hounded out of Baylor. This is what he said back then:
The position at Southern Baptist may look like a step backward, Dembski said, but it really just requires a different tack. "I see it as a very strategic move in terms of getting my ideas and the conception that I have of science and theology into the mainstream, that is, through people who are very much like-minded,"
Frankly, I doubt he cares one iota how his personal antics reflect on his employers. So long as the paychecks keep coming.

Sir_Toejam · 12 November 2005

I'm not completely clear on your point. Surely you're not suggesting that the DI would cut off grant support for dishonesty, lack of integrity, sleaziness, or anything else this whole exchange highlights? Heck. Those are minimum qualifications to get a DI grant in the first place.

lol, true, butmy point is, there are other ways to cut off his money supply - check out all those books he has published. posting the facts behind his dishonesty in public reviews about his books could go a long way towards convincing a would be book buyer to think twice about purchasing. it's easy enough to post a synopsis of who dembski really is in public reviews at amazon, for example. Dembski has been pulled from just about every official DI function recently, including depositions in Kansas and Dover. It's become readily apparent that BD's prime motivation at this point is just to make a living from the poor suckers who buy his books. why not encourage him to make a living in a more reputable way?

Mike Walker · 12 November 2005

R.O., this is nothing to do with whether or not Dembksi has the right to ban posters with dissenting viewpoints. It's a question of whether Dembski is even capable of admitting he had ever made a mistake.

I've met this kind of person in my own life, and what I've seen borders on the pathalogical. They just can't do it. They evade, cover up, deny, make excuses, trivialise... anything to avoid saying the words "I was wrong".

Every. Single. Time. Dembski has been shown to be incorrect about something he has gone way way out of his way to employ one of these tactics. He's simply incapable of owning up to his mistakes.

He does all his loyal ID acolytes or the ID movement in general any favours with this behaviour. But to be honest, I see no chance of him changing since this pathology appears to be rooted too deep in his personality.

Sir_Toejam · 12 November 2005

just a general point...

Dembski's whole attack against Shallit is EXACTLY the same strategy used by DI folks in general, it's just a form of projection I like to call "the mirror strategy", also known from elementary school days as, "I know you are, but what am I". All he did was preempt the discussion about his being pulled from testimony (first in Kansas and now Dover), by accusing his opponents of exactly the thing he himself is most representative of. That is, being an embarrasment.

Sir_Toejam · 12 November 2005

I responded to you here

lol. yeah, uh, your response is to say "no comment". congratulations.

Ardsnard · 12 November 2005

Slightly but not entirely OT: Seeing as my accounts and comments at Dembski's blog get deleted faster than I can make them (due no doubt to excessive civility and a desire for open intellectual discussion that is so fatal to a good blog conversation), I'll post here. Trying to deal with Dembski is an exercise in frustration. This is in response to Ben Z, comment #4, asking whether or not Dembski answers his critics: http://www.uncommondescent.com/index.php/archives/480#comments

My comment:
"I present these two links for you to decide for yourself whether or not Dembski answers his critics. I think the answer is pretty clear. Go read em!

In this first link, read the second comment. That is my personal experience with Dr Dembski.
http://pharyngula.org/index/weblog/comments/carl_zimmer_speaks/#comments

This second one just popped up a few days ago, and parallels my experience nicely.
http://groups.google.com/group/talk.origins/browse_thread/thread/4e5fd9969e110739/5ab009b3eedd12af#5ab009b3eedd12af

Oh, and Hi Panda's Thumb!

PvM · 12 November 2005

Why would anyone 'respond' to Dembski or comment on his papers, allowing him to revise 'history'? Dembski's approach of 'using critics' has been well documented.
If and when Dembski gets something published in a respectable peer reviewed journal, it will be the time and place to show what's wrong with his arguments this time around.

R.O. · 12 November 2005

yeah, uh, your response is to say "no comment".

Essentially, yes.

Sir_Toejam · 12 November 2005

BD's behavior left you speechless?

Alan Fox · 12 November 2005

This "paper" (it's a PDF but the content is small!) is touted by Dembski as a response to Professor David Wolpert's "Jello" critique. The only reference to Wolpert is

Wolpert and Macready (2005) generalize this set-up but don't add anything fundamentally new to it.

How is this a response?

BlastfromthePast · 12 November 2005

On an earlier post, a couple of links were given. I found this interesting little bit of information on one of the posts there:

"A common confusion is between the expert witness statement and the deposition. What is available at the NCSE is the expert witness statements (for all expert witnesses in the case)."

Are you perhaps confusing the expert witness statement--given by Shallit to the ACLU attorneys weeks before Dembski's deposition, with the deposition taken from Shallit by the TMLC weeks after Dembski's deposition?

BlastfromthePast · 12 November 2005

It's actually funnier, considering the deposition was made by his side in the trial. Wouldn't TMLC give him a copy? He could have got it any number of ways without resorting to "street theater" (i.e., lies, baseless accusations, and whining).

— Paul C
Dembski has explained on his blog that he can't get a copy from the TMLC because the case is still in the court system, and judges and courts looked badly on these sorts of things. I'm not a lawyer, so I don't know how factual these statements are, but it seems both sensible and consistent with the kinds of things I've heard lawyers say over the years. There are facts and explanations out there. Isn't that a good place to start on all this?

Alan Fox · 12 November 2005

Blast

Here is the link to Shallit's deposition taken from Dembski's blog. You appear to be the one who is confused. Have a read and all will become clear.

Sir_Toejam · 12 November 2005

Blast being confused is a perpetual state for him. pointing out actual facts will not alleviate his condition. there is no cure.

BlastfromthePast · 12 November 2005

The only reference to Wolpert is

Wolpert and Macready (2005) generalize this set-up but don't add anything fundamentally new to it.

— Alan Fox
How is this a response?

From your citation, here's the end of the first paragraph:

One approach is to limit the fitness functions(see Igel and Toussaint 2001). Another, illustrated in David Fogel's work on automated checker and chess playing (see, for instance, Chellapilla and Fogel 1999 and Fogel et al. 2004) and, more recently, given a theoretical underpinning by David Wolpert and William Macready (2005), is to limit optimization problems to search spaces consisting of agents that play competi-tively against one another. In this brief note, I focus on the latter attempt to get around the force of No Free Lunch.

Apparently the whole paper is a response.

BlastfromthePast · 12 November 2005

Blast being confused is a perpetual state for him. pointing out actual facts will not alleviate his condition. there is no cure.

— Sir Toejam
All I get from you is invective. How about some facts.

MaxOblivion · 12 November 2005

The facts are the deposition have been available as a matter of public record for a long time, dembski saying

"Dembski has explained on his blog that he can't get a copy from the TMLC because the case is still in the court system, and judges and courts looked badly on these sorts of things."

Was a lie to cover up for his own ineptitude.

This is proven by his deletion of his court system assertion and other threads on his blog to cover up and bury the truth.

PvM · 12 November 2005

Read the facts and do not let Dembski's contortions confuse you. His 'explanations' are just not that credible given the facts.

Hint: These documents are public records

Sir_Toejam · 12 November 2005

ok - here's you go, Blast. the discussion here is about Dembski lying about:

-why shallit was not allowed to testify
-the fact that his deposition was a matter of public record
-the fact that Dembski quickly removed all traces of his accusations once he received a copy of the Deposition, and calling all his previous posts "theatre".

right, so now that we have thoroughly (and unecessarily, pardon me) established that you have no clue what's going on, can i continue with my invective?

you really are dumb as a box of hammers

happy now?

Sylas · 12 November 2005

What Dembski is now linking on his blog, and for which he is "soliciting comment", is a deposition; not an argument or a statement of position. Bear in mind the nature of a deposition. It is a question and answer session, under oath, with an attorney who is looking for stuff to refute in you trial. It is not a statement, or an argument. There are many basic rules to follow when you are being deposed. You should be completely honest. But you should not try to make any argument. You are just there to answer the questions, which you should do honestly. But nothing else. The idea is not to persuade the attorney with your answers or to make a case. That comes at trial; and whatever happens, the attorney deposing you will be arguing against you when it comes to the trial. The deposition is a fishing expedition to help him prepare a case for trial. It's going to be easy to troll through a deposition and spin various questions and answers in various ways. Both sides can do this; but if the participants in the deposition did their job well, then you won't find the arguments all set out clearly in the deposition, for either side. I've read the deposition, and I think Shallit handled it well. There is nothing there that he would find embarrassing, and the record shows plainly that the defendants did not want to see him on the stand. THAT is the important refutation for Dembski's absurd spin. Dembski speculated that Shallit was withdrawn as a witness because the plaintiffs felt his deposition had made him a liability. The truth is
  • Dembski was the one withdrawn, and this made Shallit's rebuttal inadmissible.
  • It was the defendants who tried to keep Shallit off the stand, with a formal submission to the court that claimed Shallit's involvement would give the plaintiffs and unfair advantage.
  • It was the plaintiffs who made Shallit's deposition part of the public record, by submitting it attached to a brief saying we want to go to trial.
  • The judge never formally ruled against Shallit's involvement, citing an oral agreement that he would be reserved only for rebuttal. If Dembski's expertise had been made into part of the argument at trial, Shallit's rebuttal was ready in the wings.
  • In my opinion the defendant lawyers come across as quite clueless in the deposition. In the deposition you don't want to try and help them be anything else; the real test is to come at trial. For the most part Shallit does not make the error of volunteering extra information to bring the TMLC up to speed on the issues. Cheers -- Sylas

    RBH · 12 November 2005

    Ed wrote
    So let's hear what they have to say. Salvador? O'Brien? DonaldM? Let's hear you defend this dishonest and Orwellian behavior.
    And Steve S suggested
    Someone should ask Salvador Cordova what he thinks of Dembski in light of this dishonest behavior.
    No need to ask Salvador. We did the same thing on ARN: deleted a whole multi-post thread that he had started in which he was being embarrassed. He and Dembski are an excellent pair. RBH

    Sir_Toejam · 12 November 2005

    Is gay marriage legal where Dembski resides?

    csadams · 12 November 2005

    RBH: "No need to ask Salvador. We did the same thing on ARN: deleted a whole multi-post thread that he had started in which he was being embarrassed. He and Dembski are an excellent pair."

    ??? Did you mean "He" instead of "We?"

    RBH · 12 November 2005

    Um, yeah, "He did". Love that preview!

    RBH

    PaulC · 12 November 2005

    Sir_Toejam wrote:
    lol. yeah, uh, your response is to say "no comment".
    C'mon, give Robert "proud to be ignorant of computational number theory" O'Brien a little credit for not denying his status as Dembski's "toadie."

    Sir_Toejam · 12 November 2005

    serious question:

    do you think their faces get all red and they curl their hands into fists when we laugh at them for being so silly?

    I do.

    R.O. · 12 November 2005

    C'mon, give Robert "proud to be ignorant of computational number theory" O'Brien a little credit for not denying his status as Dembski's "toadie."

    I do deny that, actually. So sorry to disappoint.

    R.O. · 12 November 2005

    I should have attributed that to "Paul C," not Toejam.

    Sir_Toejam · 12 November 2005

    I do deny that, actually. So sorry to disappoint.

    how can you disappoint us by saying exactly what we expected you to say? In fact, why do you think anything you do would "disappoint" us in any way, for that matter? Dembski certainly doesn't disappoint. We expect a certain behavior from him; it's been documented MANY times. In fact, rather than disappoint, folks like Dembski and yourself are so predictable as to very valuable. Keep it up.

    Ed Brayton · 12 November 2005

    Blastfromthepast wrote:
    Dembski has explained on his blog that he can't get a copy from the TMLC because the case is still in the court system, and judges and courts looked badly on these sorts of things.
    Dembski is full of crap. Depositions, unless sealed for some reason (and this one is not), are entirely a matter of public record. That doesn't mean someone has to post them to the internet, of course, but it means that any member of the public can request a copy of it and get one. They are owned, as it were, by the court reporter who took the deposition and this is how they earn their money. They are paid by one side or the other to take the deposition and then they are paid by others who want it for a copy of that transcript. Judges and courts not only don't "look badly" on that sort of thing, they have longstanding procedures set up specifically to allow public access to documents like that. Dembski just didn't wanna go through the trouble or spend the money. Or do a little looking to find out that it was, in fact, available online the entire time.

    lutsko · 12 November 2005

    I think it is sad that Dembski is so dishonest. I have posted comments a couple of times on his website - perfectly polite and slightly, but not particularly, challenging - and they have always been deleted. I do not think that design is necessarily unscientific - his chessboard analogy is a good one and if we found something that, after a long period of time, no one could imagine being produced by an evolutionary pathway, then we could entertain "design" as a possibility. But the fact that Dembski, and i presume the rest of the "design" community, refuse to engage in honest, open discussion means that no one will take them seriously even if they really had a point.

    Sir_Toejam · 12 November 2005

    if we found something that, after a long period of time, no one could imagine being produced by an evolutionary pathway

    don't you think that would more reflect limits in our own imaginations, than on reality? Not for the first time, i give you Darwin Himself:

    To suppose that the eye with all its inimitable contrivances for adjusting the focus to different distances, for admitting different amounts of light, and for the correction of spherical and chromatic aberration, could have been formed by natural selection, seems, I freely confess, absurd in the highest degree. When it was first said that the sun stood still and the world turned round, the common sense of mankind declared the doctrine false; but the old saying of Vox populi, vox Dei, as every philosopher knows, cannot be trusted in science. Reason tells me, that if numerous gradations from a simple and imperfect eye to one complex and perfect can be shown to exist, each grade being useful to its possessor, as is certainly the case; if further, the eye ever varies and the variations be inherited, as is likewise certainly the case; and if such variations should be useful to any animal under changing conditions of life, then the difficulty of believing that a perfect and complex eye could be formed by natural selection, though insuperable by our imagination, should not be considered as subversive of the theory.

    R.O. · 12 November 2005

    how can you disappoint us by saying exactly what we expected you to say?

    I forgot you are clairvoyant.

    In fact, why do you think anything you do would "disappoint" us in any way, for that matter?

    I was being facetious. Whether or not I disappoint the folks here does not concern me; your opinions (excepting Russell's) and a dime would not get me a gumball from a gumball machine.

    Dembski certainly doesn't disappoint. We expect a certain behavior from him; it's [sic] been documented MANY times. In fact, rather than disappoint, folks like Dembski and yourself [sic] are so predictable as to very [sic] valuable. Keep it up.

    I'll try.

    Sir_Toejam · 12 November 2005

    In fact, i have always found discussion about the evolution of the eye to be most instructive. Here is an excellent source that reviews many aspects of this: http://www.origins.tv/darwin/eyes.htm certainly not the only reference, but an interesting one. after many years of study in evolutionary biology myself, I can only agree wholeheartedly with the author's statement:

    Darwin would be amazed to learn how well his ideas have been and continue to be vindicated by the evidence.

    Note that's EVIDENCE, not hyperbole.

    lutsko · 12 November 2005

    Dear Sir_Toejam
    I am a physicist and no fellow-traveler with the ID crowd. On the other hand, I cannot rule out the logical possibility of naturalistic design: after all, its not unthinkable that some day we can ourselves create artificial organisms. I therefore do not think it heretical to allow for the possibility that some sort of "design inference" could be justified and I do not think that appeals to authority rule it out. Although I do not agree with the "reasoning" of Demnski and his crowd, I do think it is healthy to have honest skeptics nipping at the coat tails of scientists - god knows we are used to them in physics. Thus my comment that I think it sad that Dembski et al are not honest in their critisims.

    Sir_Toejam · 12 November 2005

    I was being facetious

    are you sure?

    Steve S · 12 November 2005

    Comment #56750 Posted by Throwaway Comment on November 12, 2005 01:33 PM (e) (s) Sin of pride.

    Couldn't resist remembering this classic bit from the simpsons:

    Rod Flanders: Well, those folks from the senior center sure will love that peach tree we planted. I wish we could see their happy faces. Ned Flanders: Ahh! Sin of pride, Roddy. Rod: I'm sorry! Ned: Ahh! Sin of regret!

    R.O. · 12 November 2005

    Dr. Lutsko:

    I see you are a UF alumnus. Welcome to the discussion.

    Sir_Toejam · 12 November 2005

    I do think it is healthy to have honest skeptics nipping at the coat tails of scientists

    show me an honest supporter of ID as real science, and I'll show you a Nigerian banker who wants your email address. Physics or biology, you know what science requires for a theory to be developed, and that real scientists NEVER reject out of hand a hypothesis actually based on testable predcitions. I think you perhaps forget the value of the scientific method to begin with. By definition, we can't include the supernatural in a scientific theory. likewise, the idea that there could be a supernatural cause for something is not excluded either. It simply isn't testable. As a physicist, you also know the value of the scientific method, both currently and historically. Even if god himself came to earth and produced a pocketful of miracles for us, it would not invalidate the value of the scientific method in explaining observable phenomenon. However, I'm sure if god decided to stick around and contol everything that happens in the world in a demonstrable fashion, then science would no longer be necessary at all, would it?

    Sir_Toejam · 12 November 2005

    I see you are a UF alumnus. Welcome to the discussion.

    er, i think we are still waiting on you to actually participate substantially in said discussion. ready yet?

    Sir_Toejam · 12 November 2005

    oops replace substantially with substantively.

    R.O. · 12 November 2005

    are you sure?

    Yes, I am. Are your psychic impressions suggesting otherwise? If so, you might want to get a new psicrystal.

    R.O. · 12 November 2005

    er, i think we are still waiting on you to actually participate substantially in said discussion. ready yet?

    You first.

    Sir_Toejam · 12 November 2005

    it's not on me to do so, the request was extended to yourself by others first. Your response was "no comment".

    i am still waiting.

    lutsko · 12 November 2005

    Dear Sir_Toejam,
    I find you to be a bit touchy. I think I am quoting when i say that, in regard to god(s), "i have no need of that hypothesis". Purely hypotherically, couldn't we - or any other scientifically sophisticated culture - produce a "designed" organism from scratch or by genetically engineering an existing organism? And couldn't said orgamism then defy explanation via evolution to future human or non-human scientists and thus make a "design inference" justifiable and indeed true? Before you label me a closet troll, let me again say that i do not believe design has any role in modern biology or highschool science and that i am not trying to set up a "gotcha". But I do think it disengenuous to claim that design cannot, in principal, be a reasonable hypothesis.

    Heathen Dan · 12 November 2005

    Unbelievable dishonesty! And this is the first time I ever heard of a "street theater defense". Has he any scruples?

    R.O. · 12 November 2005

    If Bill was in error, he should acknowledge his error. Better?

    ag · 12 November 2005

    Robert O'Brien who signs now as R.O. can't respond at this time on the substance of the discussion - he must be very busy teaching Dr. Rachev about Kantorovich metrics; when he is done with Rachev, his next task will be explaining Kantorovich metrics to PT denizens as he promised to do a long time ago. So, don't bother him with questions. Great minds need concentration.

    Steve S · 12 November 2005

    Sir Terriblename, what do you want R.O. to say? There's no exculpatory defense for Dembski's dishonesty in this situation. To his credit, R.O. isn't even trying to make one.

    Sir_Toejam · 12 November 2005

    produce a "designed" organism from scratch or by genetically engineering an existing organism

    of course. the difference being that we are a rather well defined quantity, and much is known about our mechanisms of producing such, and those mechanisms are easy to elucidate and test. we know nothing about any mechanism of any "intelligent designer", so we can't ever test any predictions. any idea that you can look at an organism in nature and say that any part of it is "irreducibly complex" and so MUST be designed is entirely subjective. Just like those who thought the eye was such a structure. hence the reason i posted the Darwin reference. If i take a look at a baby monkey and find it "cute", wouldn't you be able to just as easily find someone who thought it "ugly"? looking for "design" in nature (other than artifacts of human "design") will ALWAYS be an entirely subjective endeavor. as a physicist, would you say that the amazing assembly of subatomic particles that constitute your average atom is a product of design? i was a long way from labeling you anything, so don't go down that road.

    Sir_Toejam · 12 November 2005

    Sir Terriblename, what do you want R.O. to say? There's no exculpatory defense for Dembski's dishonesty in this situation. To his credit, R.O. isn't even trying to make one.

    hey, he was the one who said he WAS participating in the discussion, not me :)

    PvM · 12 November 2005

    And couldn't said orgamism then defy explanation via evolution to future human or non-human scientists and thus make a "design inference" justifiable and indeed true?

    — lutsko
    The problem is with the design inference approach which is based on elimination of all chance and regularity hypotheses while not proposing any hypothesis of its own. In other words, the design inference is basically the null hypothesis here.

    R.O. · 12 November 2005

    Robert O'Brien who signs now as R.O. can't respond at this time on the substance of the discussion - he must be very busy teaching Dr. Rachev about Kantorovich metrics; when he is done with Rachev, his next task will be explaining Kantorovich metrics to PT denizens as he promised to do a long time ago. So, don't bother him with questions. Great minds need concentration.

    There is nothing I could teach my mentor about the Kantorovich metric or any other aspect of probability metrics.

    Sir_Toejam · 12 November 2005

    If Bill was in error, he should acknowledge his error. Better?

    hey, now you're participating! let's see... please qualifiy "If bill was in error" for me, please.

    Steve S · 12 November 2005

    True, he claimed he responded.

    This event reminds me that we need a Best Of section on the front of PT. So if new people want the lowdown on Bill Dembski, Mike Behe, etc, they can get, say, the best 10 posts about those guys.

    lutsko · 12 November 2005

    Dear Sir Toe_jam,
    (I do not know how to do the fancy quotes so i will content myself with adressing responses to you.)
    I agree with you that the method used by the DI crowd is completely subjective and, hence, worthless. However, as a purely intellectual point, it is not outside the realm of possibility that one could prove, in a mathematical sense, that it was impossible to reach a particular genetic sequence from existing, or hypothesised previous sequeneces, via natural selection or any other known evolutionary mechanism. This would always leave open the possibility of some unkown mechanism, but it would also make design by some culture a respectable hypothesis. No?

    Sir_Toejam · 12 November 2005

    gees, wouldn't that get about 90% filled by Sal's posts? i think they reflect on dembski about as well as facts do.

    Steve S · 12 November 2005

    I'm going to email Salvador. We need his input on this matter.

    PvM · 12 November 2005

    However, as a purely intellectual point, it is not outside the realm of possibility that one could prove, in a mathematical sense, that it was impossible to reach a particular genetic sequence from existing, or hypothesised previous sequeneces, via natural selection or any other known evolutionary mechanism. This would always leave open the possibility of some unkown mechanism, but it would also make design by some culture a respectable hypothesis. No?

    — lutsko
    In what sense 'respectable'? You are basically arguing that a design hypothesis is not different from 'we don't know'? So what makes the 'design hypothesis' respectable, especially if the design hypothesis does not propose much of anything.

    BlastfromthePast · 12 November 2005

    Here is the link to Shallit's deposition taken from Dembski's blog. You appear to be the one who is confused. Have a read and all will become clear.

    — Alan Fox
    Thank you for the link. (And, by the way, I wasn't confused; I just had a little catching up to do.) I've read the deposition in its entireity. From page 150 on, and for about twenty more pages, yes, the deposition is a little embarassing. Shallit is made to seem like he has no substantive arguments against Dembski, save one; and that one is, more or less, trivial. Dembski's characterization is not completely unfounded. Please don't respond until you've read the deposition. Thank you.

    Matt · 12 November 2005

    lutsko,

    Welcome to the discussion. For the record, I don't think you're a closet troll.

    I think your point is extremely valid, and worth considering: the possibility certainly exists that we could be the creations of a naturalistic intelligence. In fact, the possibility exists that we are the creations of one or more supernatural intelligences.

    It's important to realize, though, that this is not what the ID debate is about. ID is not the assertion that life was likely to have been designed. It is the assertion that we can objectively demonstrate that it is so that life was designed. The tools ID proposes as design detectors, however, turn out to be nothing beyond assertions (couched in formalistic mathematical or philosophical jargon) of "purposeful arrangements of parts" or criticisms of the incompleteness of our current evolutionary theory.

    ID also suffers from a more significant problem. If (as ID claims) it is impossible in principle for something as complex as life to emerge through naturalistic processes, then we are left with an appeal to supernatural causation. This presents a particular problem for our concept of science, for if you allow yourself to appeal to the supernatural in one instance, there is nothing stopping you from appealing to it ever after. And the supernatural is simply not accessible to scientific investigation, even if (like the Kansas Board of Education or Alvin Plantinga) ouy redefine science to mandate the supernatural's inclusion.

    I hope you stick around. The invective around here can get a little tiresome, but I think we could use some thoughtful questioners challenging our own presentations of the debate.

    -Matt

    lutsko · 12 November 2005

    Dear PvM,
    I think that new hypothesis are accepted, despite being an argument from ignorance, when existing hypothesis fail to explain the facts. Even the proposal of a new evolutionary mechanism can be described as an argument from ignorance ("The existing mechanisms do not explain the facts so i propose the new mechanism ..."). The scientific tests are whether or not it predicts new phenomena and whether or not a simpler (in a particular sense) hypothesis is available. I agree that design will almost always seem the least-simple alternative. But there is no doubt we can imagine ourselves in a world "tainted" by the genetic engineering of some previous culture and therefore not truely explained by evolution. In fact, just to stir things up, let me propose the possibility of a world with designed organisms that can, also, be explained by evolution.

    Alan Fox · 12 November 2005

    Please don't respond until you've read the deposition. Thank you.

    — Blast
    I read through it (admittedly quickly) before posting. The defence attorney takes some well-trodden paths (see PT previous threads) over the Ruse email, the Trotter prize etc, to discredit Shallit, as he is obliged to do. We can speculate on what would have happened if Professor Shallit had been allowed to testify (had the defence not objected) or indeed Dr. Dembski (had he not withdrawn) but why, if his ideas have merit, doesn't Bill adress Shallit, Perakh, Wolpert, Elsberry on the subsantive points they make?

    Alan Fox · 12 November 2005

    Bother. address, substantive. Sorry hit post before spell check

    Sir_Toejam · 12 November 2005

    lutsko: if you wish, you can follow the kwickxml formatting instructions in the post a comment window. for example, to quote someone, you put the text "quote" (without the quotation marks) enclosed in angle brackets at the begining of what you want to quote, and then do the same at the end, but put this "/quote" in the angle brackets. "

    " it is not outside the realm of possibility that one could prove, in a mathematical sense, that it was impossible to reach a particular genetic sequence from existing, or hypothesised previous sequeneces, via natural selection or any other known evolutionary mechanism"

    " well, technically, NOTHING is outside the realm of possibility. I could also prove that any particular configuration of the solar system on any given day to be mathematically impossible as well. However, I'm not sure i see the value in doing so. I still think you are mixing the subjective with the objective. However, i do catch your point that if something came along that was distinctly impossible to explain via modern evolutionary theory, we would need to expand the theory to encompass it. It could certainly be that our current understanding of natural phenomena is just as limited as Newton's was when compared to current quantum theory. However, we have discovered nothing in 150 years to indicate this to be so. do you disagree? Unlike the transition from Newtonian to relativistic mechanics, which was rather radical, would you characterize the development of quantum theory out of relativistic mechanics in the same vein? In science, we use all available methods to test observable phenomenon. Perhaps you think that evolutionary theory exhibits such gaps that could be compared to those of newtonian mechanics, and that with more technology we will somehow answer those "gaps"? If so, then i suggest you take another look at the literature in evolutionary biology. the kinds of gaps that led to the replacement of newtonian mechanics with relativity just don't exist in evolutionary biology. If anything, the tens of thousands of experiments demonstrating the efficacy and predictive power of current evolutionary theory only serve to make my point. It's extremely improbable that observable phenomena that appear to disagree with current evoltuionary theory will serve to replace it entirely. It is far more likely, as it has when kin selection, horizontal gene transfer, etc., etc., challenge current evolutionary theory, that these things will be incorporated into the theory, rather than replace it. The predictive power of evolutionary theory has only grown as we have increased our level of understanding, and the level of technology available to test new hypotheses. Just as likely, we will not find observable phenomena that will "invalidate" current quantum theory, but rather as we discover new things, the theory will expand to encompass them, until such time as it's predictive power is somehow shown to be of no more value. that's how science works, yes? we don't simply assume there is "something" out there that will completely invalidate the current value and predictive value of theories, do we. Nope, scientific theories "evolve" just like organisms in nature, until they have no more predictive value whatsoever. even the example you present would not invalidate the predictive value of evolutionary theory, now would it? no more than me being able to mathmematically demonstrate an impossiblity in quantum theory. in fact, aren't mathemetical predicitons from quantum theory basically how we test the predictive value of the theory to begin with??

    Matt · 12 November 2005

    lutsko,

    I disagree that all attempts to propose a new hypothesis are "arguments from ignorance". An argument from ignorance is one in which a conclusion is assumed to be true simply because it has not been proven false. New hypotheses are accepted (or should be) because they better account for the evidence than do the old hypotheses.

    This is related to the fallacy of the false dilemma. ID proponents assume that by poking enough holes in evolutionary theory, they have sufficient warrant for ID.

    ID is proposing an unknown mechanism (rather, it is proposing no mechanism -- see Behe's cross examination) to account for evidence that (it is said) the mechanisms of modern evolutionary theory have not yet accounted for. (And ID is not merely saying that evolutionary biology has failed; it's saying that evolutionary biology cannot in principle succeed.)

    -Matt

    MaxOblivion · 12 November 2005

    This would always leave open the possibility of some unkown mechanism, but it would also make design by some culture a respectable hypothesis. No?

    Dear lutsko, An inconsistency or an unknown in science does not justify a design hypothesis. This is the age old creationist God of Gaps argument the belief that when there is a gap in knowledge we must invoke a supernatural aka god aka ID hypothesis. As repeated multiple times for ID to have any more credibilty than the Flying Spaghetti Monster it needs to provide a testable and predictive assertion something it simply cannot do.

    MaxOblivion · 12 November 2005

    Futhermore whilst relativistic and quantum mechanics can be considered a Kuhn Paradigm shift, they were not accepted just because they were different than the status quo, but better than the status quo. Better in the sense they could predict, be tested and were useful.

    ID on the otherhand is different but so is FSM, the key fact is that ID doesnt predict, cant be tested and isnt useful.

    Sir_Toejam · 12 November 2005

    max - gotta use < brackets instead of [ to enclose your markups

    Sir_Toejam · 12 November 2005

    lol. i mean angle brackets (shift of comma and period) instead of square brackets.

    sorry.

    PvM · 12 November 2005

    Dear PvM, I think that new hypothesis are accepted, despite being an argument from ignorance, when existing hypothesis fail to explain the facts. Even the proposal of a new evolutionary mechanism can be described as an argument from ignorance ("The existing mechanisms do not explain the facts so i propose the new mechanism ...").

    — lutsko
    But ID does not propose any new mechanisms, it sees the absence of explanations as evidence for its own strength.

    The scientific tests are whether or not it predicts new phenomena and whether or not a simpler (in a particular sense) hypothesis is available. I agree that design will almost always seem the least-simple alternative.

    In that case 'we don't know' seems to be a simpler alternative. Remember that ID is not inferred from a positive argument "present day evolutionary mechanisms do not explain X", let me explain how 'design' can explain X. No positive hypotheses are being proposed. Let's say that we have shown that known mechanisms/chance have a probability of < 10^-150 to explain a particular event, why should we accept that the probability of design is somehow higher? What limits, predicts the probability of design? You yourself seem to argue that design always remains a possibility.

    But there is no doubt we can imagine ourselves in a world "tainted" by the genetic engineering of some previous culture and therefore not truely explained by evolution. In fact, just to stir things up, let me propose the possibility of a world with designed organisms that can, also, be explained by evolution.

    Sure, evolution can explain all and design may still be a possibility or not. So unless we find some independent evidence, such as plausible designers or as we detect design in real science, using means, motives and opportunities. Just proposing that designers created life but it is indistinguishable from evolutionary processes may be philosophically interesting but it does not explain much scientifically. In other words, one needs more than just the possibility... Or we should accept 'we don't know' rather than 'design' as the default explanation.

    PvM · 12 November 2005

    I've read the deposition in its entireity. From page 150 on, and for about twenty more pages, yes, the deposition is a little embarassing. Shallit is made to seem like he has no substantive arguments against Dembski, save one; and that one is, more or less, trivial. Dembski's characterization is not completely unfounded.

    It's a 'little embarassing', 'not completely unfounded'... talking about grasping at straws here. Remember that Shallit is a rebuttal witness, and until Dembski has presented his case, there is little incentive to 'give away the store'.

    Sir_Toejam · 12 November 2005

    btw, i thought we were talking about DEMBSKI here, not shallit.

    you can post on debmski's blog where he has an area all set up for your commentary on Shallit's deposition, Blast. However, any substantive comments based on fact will surely be deleted.... oops, then you have nothing to worry about. forget i mentioned it.

    MaxOblivion · 12 November 2005

    The funny thing is proposing designers created life that is indistinguishable from evolutionary processes reduces dembki to nothing more than a Nominalist that has nothing at all to do with empirical science. Apparently Dembski is a distinguished Philospher and should understand these undergraduate concepts.

    But then again for someone who abuses Kuhn to such an extent its no surprise.

    Swoosh · 12 November 2005

    Lutsko says:

    Although I do not agree with the "reasoning" of Demnski and his crowd, I do think it is healthy to have honest skeptics nipping at the coat tails of scientists - god knows we are used to them in physics.

    I say:

    Well, I partially agree with you. Especially when its directed by rational opposition and followed up with a healthy resultant dialectic--you know, science. Alas, I'm sure you agree that we can't always expect rationality to be the nutrient in the soil of the competition. As you say, physics has its share of loonies keeping the physicists on their toes, and yeah, that's probably a good thing.

    But to call the antics of the creo gallery "honest skeptics nipping at the coat tails" is a serious distortion. To have anything similar to what the evolutionary biologists are dealing with, physicists would be up against one of the most powerful religions in the world trying every dirty trick in the book to teach Genesis creation in equal standing with astronomy class. "Seven days, are you nuts!?!?!" You'd have to drag some of your best minds away from the lab and into court every couple decades to deal with this crap in an increasingly hostile political landscape. Everything the physicists say makes good sense to them, because they are educated but the public at large seems to get it less and less as the decades roll on.

    So while I agree with you in spirit, there really is no comparison. Ask yourself this: if the creationists win the fight against biological evolution, which scientific discipline is next in line?

    Sir_Toejam · 12 November 2005

    hmm. not sure i would ever use the words "dembski" and "distinguished" in the same sentence, but that's just me.

    MaxOblivion · 12 November 2005

    Yeah sorry, i forgot to put the quotes around 'distinguished'. I considered the obvious letter substition to Dumbski, but thats way too easy.

    Sir_Toejam · 12 November 2005

    letter substition to Dumbski, but thats way too easy

    lol. you should have seen how mad dembski got the first time that was done on PT. In fact, another member of DI came over to PT to defend him, calling it "not clever beyond measure", iirc, which tended to then be attached to the end of every witticism we threw at dembski as a "qualifier" for several months. like this: note that i don't consider the use of word 'distinguished' in quotation marks when referring to Dembski to be clever beyond measure.

    Rich · 12 November 2005

    D*mbski is my personal favourite.

    Sir_Toejam · 12 November 2005

    in fact, now that i think back, the whole "dumbski" debacle was related to yet another of Dembski's Dishonesties (TM)

    ben · 12 November 2005

    Well, he's certainly distinguished himself as a dishonest, pseudo-intellectual twit.

    Jaime Headden · 12 November 2005

    in Comment #56832, by Sir_Toejam:

    "show me an honest supporter of ID as real science"

    All skepticism is healthy, but when couched in terms including Nigerian bankers and arguments from incredulity, which apparently are a dime a dozen, we get into pissing matches, not science. Science, based on data, but depend only on data and not personal belief. One can actually support, as Dr. Lutsko suggested, any so called "improbable" theory and still be doing science, as long as one is DOING science. Instead, we are heading down the long and damning road of the argumentum ad hominem and congratulating ourselves for our insight. Sins of pride, indeed.

    "However, I'm sure if god decided to stick around and contol everything that happens in the world in a demonstrable fashion, then science would no longer be necessary at all, would it?"

    Since when did one have to support continual creation and designing to support initial creation and design?

    Sir_Toejam · 12 November 2005

    Since when did one have to support continual creation and designing to support initial creation and design?

    that wasn't the argument. the argument is, if there were other mechanisms demonstrable to explain observable phenomena, like a physical deity that snaps his fingers to make changes and shows all how it's done, then why would we even need science. What is the function of science in your mind? maybe then your argument might be a bit clearer. i think you are conflating arguments here. Lutsko did not even suggest any theory, let alone an improbable one.

    Steve S · 12 November 2005

    We all hang out here and get toxic doses of creationism*, so when someone like Lutsko comes by who isn't deeply familiar with the ID Project, and doesn't know how foul and malevolent it is, we perhaps overreact.

    _________________________________________
    *The FDA recommends a maximum limit of 300 milliTards of creationism per year. On Panda's Thumb we get 1700--2000 milliTards. It doesn't affect mortality, but it does increase clinical signs of rage.

    Sir_Toejam · 12 November 2005

    who's overreacting? don't you find lutsko's premise a bit disturbing, coming from a physicist?

    got nothing to do with ID biases, I find his singular evidentiary inferences to be disturbing all on their own.

    I never implied he was a troll, tho.

    Steve S · 12 November 2005

    Myself, I use a TLD badge provided from Panda's Thumb's Creationism Exposure Safety department. It's very unobtrusive, and every quarter, you can see how many milliTards of creationism you were exposed to.

    Sir_Toejam · 12 November 2005

    The FDA recommends a maximum limit of 300 milliTards of creationism per year

    lol., well, you do have a point there. I think I'm up to over 900 milliTards. fair enough, if folks feel i'm coming off too heavy handed, i'll back off and let others play in the sandbox.

    Jaime Headden · 12 November 2005

    We are fortunate in this day a Google world can allow us to never permanently destroy all digital data, or at least that which Google's webcrawlers can find. So, Google's caches maintain that Dembski's words are immortal, at http://66.102.7.104/search?q=cache:Aat6Dkz7FZwJ:www.uncommondescent.com/index.php/archives/438++site:www.uncommondescent.com+Dover+Shallit&hl=en

    Steve S · 12 November 2005

    don't you find lutsko's premise a bit disturbing, coming from a physicist?

    No, because I was around physicists for 5 years at NCSU and Lutsko is coming at Intelligent Design in a very familiar way to me. He has heard some comments by Intelligent Designers and he is thinking abstractly about the problem of deducing design. He is not saturated in the real Intelligent Design movement as we are. It doesn't scare me because it strikes me as the kind of initial feeling-out process that smart people do with ideas. I have no doubt that when he becomes more familiar with the specifics of the ID movement, he will reject it scornfully.

    Steve S · 12 November 2005

    And I didn't mean to single out you, Sir Terriblename, I generally agree with your comments (though I think you've occasionally misunderstood me in the past) I just didn't want Lutsko to get a bad impression of Panda's Thumb the moment he shows up. People like us are so close to the problem, and familiar with the force of ignorance supported by ID, that we have hair triggers.

    Sir_Toejam · 12 November 2005

    and i agree with your (and lutsko's) assesment that I'm getting a bit too touchy these days.

    I'm just gonna take a breather and come back after i do something a bit more productive ;)

    cheers

    Steve S · 12 November 2005

    One example is, I knew a physics grad student at NCSU who heard about the moon landing skeptics. And so he thought about it, and at first came up with a list of conditions which would imply that they were right. And he analysed the radiation, and the physics of landing on the moon, and such details, and initially actually said he thought these skeptics might have a point. Eventually, he realized that the case against the moon landings depended on a much more unlikely set of conditions, than the truth, and dismissed the skeptics. I remember this event because after he made the case for how the skeptics could be right, some wag pointed out that the proffered scenario was so complicated, and involved so much work, that "it would be easier just to go to the damn moon and be done with it."

    Steve S · 12 November 2005

    The thing I have to keep remembering is, for every malevolent jerk like Dembski, there are 1000 Cordovas and Wagners, people who just don't get it, but really are trying to do what they think is right. That keeps me from getting too mean. Though occasionally something happens so offensive, I start instantly channelling Great White Wonder, and have to talk myself down.

    Steve S · 12 November 2005

    BTW, Sir Terriblename, you are invited to the Waterloo Party, which shall be a night of drinking and celebrating, to take place the weekend the Dover verdict is issued.

    Jaime Headden · 12 November 2005

    Sir_Toejam wrote:

    "that wasn't the argument. the argument is, if there were other mechanisms demonstrable to explain observable phenomena, like a physical deity that snaps his fingers to make changes and shows all how it's done, then why would we even need science."

    And that point was made after the post I replied to you in, not by you, so I was arguing on what YOU said. After all, you had already implied that there is no honest support of ID, and this itself was an unproven, biased slur against particulars, not a scientific statistical assessment of the data presented (if I am wrong, show me). This is why I used the comment regarding the argumentum ad hominem, and also why I included an reference to Dr. Lutsko's earlier comment.

    "What is the function of science in your mind? maybe then your argument might be a bit clearer."

    Investigation, seeking knowledge, and doing so with the minimum of bias allowable in a system. But then, P. D. Medawar wrote in 1969 that "Innocent, unbiased observation is a myth." Science must be observed, it cannot be done without an operator to examine any output, and to get an output, you require an input. To test a theory, for example, you require not only the theory (input), but how to observe it (input), criteria of observation (input), and so forth. All of which can be biased by eliminating options another may include. By rejecting a potential outcome -- e.g., carbon-dating is correct -- one ends up with a biased result: carbon-dates are crap.

    "i think you are conflating arguments here."

    I think I am arguing about what YOU said, and read an earlier comment from Lutsko that fed into my reply that, as far as I saw in my biased viewpoint, mattered into what I wrote.

    "Lutsko did not even suggest any theory, let alone an improbable one."

    Why would he have needed to explicate a particular theory to remark on how to theorize and collect data? My use of the term improbable, also in quotes, was to bring attention to this thread of thinking I have described in this post, that people bring their biases to the table to "discuss" their opinions about data, not to clinically assess the data itself (which Ed Brayton, Mark Perakh and others HAVE done with less vitriol).

    For the record, while it is possible Toejam may beleive otherwise by now, my initial look into the data has brought me to the opinion that intelligent design is wrapped up creationism, I can only argue FROM the data, and not my opinion. I am, apparently, agnostic in the nature of God, and have sought only to seek science for it's ability to distill data, rather than support my own theories or opinions, and since I work in biomechanics to at least some degree, with evolutionary biology to a larger degree, I am directly involved in determining how processes develop and relate to one another. So this philosophy of input and output matters implicitly, which is why one needs to have an open outlook and not locking oneself into Plato's Cave and throwing away the cross-shaped key.

    Steve S · 12 November 2005

    Also invited is Lenny Flank (hey Lenny, I was born in Lake City, and lived there for 20 years), professor Steve Steve, who I think might hit it off with my Pookie Bear and get a little lovin down by the fire, and any and all PT regulars and irregulars, creationists excepted.

    BlastfromthePast · 12 November 2005

    but why, if his ideas have merit, doesn't Bill adress Shallit, Perakh, Wolpert, Elsberry on the subsantive points they make?

    — Alan Fox
    These probability spaces are multidimensional and highly complex--it's hard to get a mental picture of what it all looks like. And, so, it's entirely possible that Wolpert, et. al, aren't quite getting what Dembski is saying (or, trying to say) and Dembski is not doing a good enough job of communicating it, yet realizes that, nonetheless, their arguments are wrong and then decides not to take the time to correct it. Just a theory. By the way, I have a letter to the editor in on Perakh's article in the Skeptical Inquirer. To me his logic is all wrong.

    Andrew Mead McClure · 12 November 2005

    These probability spaces are multidimensional and highly complex---it's hard to get a mental picture of what it all looks like. And, so, it's entirely possible that Wolpert, et. al, aren't quite getting what Dembski is saying (or, trying to say) and Dembski is not doing a good enough job of communicating it, yet realizes that, nonetheless, their arguments are wrong and then decides not to take the time to correct it. Just a theory.

    "If you're too stupid to see how right I am, it's not my fault." Hm. I could have sworn I've seen someone use that exact line of argument before to avoid explaining themselves... now where was it? Oh yes, now I remember.

    'Rev Dr' Lenny Flank · 12 November 2005

    This would always leave open the possibility of some unkown mechanism, but it would also make design by some culture a respectable hypothesis. No?

    No. Sir Billy Ockham's Razor would come into play. To invoke the actions of a designer, one would need to (1) show us what the designer did, specifically, and (2) what mechanisms it used to do whatever the heck it did. If it ain't needed, it ain't needed. (shrug)

    'Rev Dr' Lenny Flank · 12 November 2005

    By the way, I have a letter to the editor in on Perakh's article in the Skeptical Inquirer. To me his logic is all wrong.

    I'm sure he stays up at night worrying what you think about it, Blast. (yawn)

    morbius · 13 November 2005

    Comments on some statements by Dr. Lutsko:

    I do not think that design is necessarily unscientific - his chessboard analogy is a good one and if we found something that, after a long period of time, no one could imagine being produced by an evolutionary pathway, then we could entertain "design" as a possibility.

    Entertaining something as a possibility is always an option but that doesn't make it "scientific". "design" isn't scientific because it isn't a causal explanation.

    I cannot rule out the logical possibility of naturalistic design

    Logical possibility or impossibility has nothing to do with empirical epistemology.

    it is not outside the realm of possibility that one could prove, in a mathematical sense, that it was impossible to reach a particular genetic sequence from existing, or hypothesised previous sequeneces, via natural selection or any other known evolutionary mechanism.

    Some people seem to think that "anything's possible" is a deep philosophical insight, but actually it's empty and pointless. That something is "not outside the realm of possibility" is an incredibly weak statement; who cares, when no one has in fact offered such a proof? But I would go further: such a proof isn't possible, because "natural selection or any other known evolutionary mechanism" is not well enough specified to be amenable to mathematical proof. Deductive proofs require every single detail to be nailed down unambiguously. So your statement is incorrect, such a proof is not within the realm of possibility -- no possible string of mathematics can be a proof that some genetic sequence cannot evolve "via natural selection". Don't forget that "natural selection" includes things like cosmic radiation and meteor strikes. What sorts of rearrangements of the genome by any possible physical cause might be provably impossible, hmmm? Really, the claim is quite silly.

    Even the proposal of a new evolutionary mechanism can be described as an argument from ignorance ("The existing mechanisms do not explain the facts so i propose the new mechanism ...").

    And a marriage proposal can be described as an argument between lovers, but it isn't. Your quote simply isn't an example of an argument from ignorance; it isn't an argument at all. An argument involves an inference, and a proposal is not an inference. It's a bit hard to make out your intent here. You seem to be arguing that it's no strike against ID for it to be an argument from ignorance because evolutionary biologists employ arguments from ignorance all the time. But an argument from ignorance is a fallacy; it would not be good thing to discover that evolutionary biologists employs fallacies all the time. Rather than vindicating ID, that would be a tu quoque argument -- another fallacy. I think you're being the opposite of touchy; you're trying too hard to find some grounds for a legitimate design argument. But your generosity is misdirected.

    morbius · 13 November 2005

    Reconsidering this:

    But I would go further: such a proof isn't possible, because "natural selection or any other known evolutionary mechanism" is not well enough specified to be amenable to mathematical proof. Deductive proofs require every single detail to be nailed down unambiguously. So your statement is incorrect, such a proof is not within the realm of possibility --- no possible string of mathematics can be a proof that some genetic sequence cannot evolve "via natural selection". Don't forget that "natural selection" includes things like cosmic radiation and meteor strikes. What sorts of rearrangements of the genome by any possible physical cause might be provably impossible, hmmm? Really, the claim is quite silly.

    One might argue that, by this logic, ToE is unfalsifiable. But falsification need not be deductive; precambrian rabbit fossils aren't logically inconsistent with ToE. Ok, so instead of a deductive proof, perhaps it could be proven that evolution of some genetic sequence was incredibly unlikely -- as unlikely as precambrian rabbit fossils. Such a proof would falsify ToE. But all this says is that it is within the realm of possibility that the ToE could be falsified, which is not news. Certainly no such proof has been presented. Even if ToE were falsified, that would not imply "design" -- that is an argument from ignorance. And "design" is not an alternative to ToE -- such an alternative would require a theory of design, and such a theory would have to be more plausible than ToE. We would have to calculate the probability that such a designer exists and designed the genetic sequence, and compare that to the probability calculated by the (conceivably possible) statistical proof of unlikely evolution. I won't say that such a theory of design isn't possible -- that would be an argument from ignorance -- but the burden rests with those who argue for design, and the burden is immense.

    morbius · 13 November 2005

    Another point:

    his chessboard analogy is a good one

    It's "good" as a debating point because it's very misleading and rests on widespread misunderstanding of the nature of physical law, due to confusion with human law. Suppose that we didn't know the rules of chess and examined a large number of positions from chess games with the intent of determining them. It' quite reasonable to think that we could fully determine the rules of chess from examining enough positions. But suppose we had never seen a position that had been reached by en passant capture, so we had never hypothesized such a rule. Then we do see such a position. Do we conclude that it could not have been reached by following the rules? We shouldn't, because the rules aren't prespecified, they are inferred. To put it another way, they are descriptive, like physical laws, not prescriptive, like human laws. Dembski's analogy depends upon taking the rules of chess as being prescribed, rather than being inferred. When we observe a "position" in the physical world, a phenomenon not predicted by existing theory, we revise the theory to encompass all observation, we don't throw up our hands and declare the new observation illegal, miraculous, designed, etc. Hmmm ... perhaps Dembski's chessboard analogy is good, after all, to illustrate the error in design reasoning.

    shiva · 13 November 2005

    So BillD calls his missteps street theatre? He is giving that lively and rich art form a bad name. We have better term in Hindi to describe this sort of behaviour - nautanki.

    morbius · 13 November 2005

    Dembski simply confirmed that he's a clown.

    Andrew Mead McClure · 13 November 2005

    One might argue that, by this logic, ToE is unfalsifiable. But falsification need not be deductive; precambrian rabbit fossils aren't logically inconsistent with ToE. Ok, so instead of a deductive proof, perhaps it could be proven that evolution of some genetic sequence was incredibly unlikely --- as unlikely as precambrian rabbit fossils. Such a proof would falsify ToE. But all this says is that it is within the realm of possibility that the ToE could be falsified, which is not news. Certainly no such proof has been presented.

    I suppose the thing to do is keep a firm distinction in mind between the concepts of scientific and mathematical proof. Mathematical proof is more difficult to do, but once you have done it is much stronger. Scientific proof is weaker, but it can also reason about a much larger class of objects. Perhaps, if one is willing to look at things a bit abstractly, we could say that scientific proof can disprove positive statements, but it can't so much prove negative statements. The statement "all animals have hair" can be disproven by producing a turtle. However the statement "there does not exist a planet which is a giant flat disc rotating on the back of a giant space turtle"... science would be at somewhat of a loss to prove or disprove that one. The most we can do is present an argument such a thing would be terribly unlikely. Mathematical proofs, meanwhile, can prove statements like "there exist no rational roots of 2" beyond question. However the mathematical concept of a proof would be at somewhat of a loss to reason much of anything meaningful about turtles.

    David Wilson · 13 November 2005

    In the original post
    William Dembski finally managed to find the transcript of Shallit's testimony. ..
    Interestingly, the copy of Shallit's deposition that Dembski has finally managed to lay hold of is not a copy of the one that's posted on the NCSE web site. As a couple of commenters have noted on Dembski's blog, pages 74 to 77 of the deposition are missing from his copy, while the one posted on the NCSE web site is complete. Coincidentally, pages 74 to 77 are one of the few places in the Deposition where Thompson's questions manage to stray into relevance, thus giving Shallitt the opportunity to make a few telling points about the worthlessness of the concept of specified complexity. Was the omission a chance accident resulting from blind naturalistic forces, or was some sort of designing intelligence involved? Dembski himself has so far failed to comment on it. With such high-powered IT experts as Dave Scot on their team, I'm sure the IDer's will manage to get hold of the NCSE's complete copy any decade now, so there doesn't seem to be much point in continuing to be coy about its location (Shallit's deposition is in the file APPENDIX III Tab O.pdf).

    Andrew Mead McClure · 13 November 2005

    As a couple of commenters have noted on Dembski's blog, pages 74 to 77 of the deposition are missing from his copy, while the one posted on the NCSE web site is complete. Coincidentally, pages 74 to 77 are one of the few places in the Deposition where Thompson's questions manage to stray into relevance, thus giving Shallitt the opportunity to make a few telling points about the worthlessness of the concept of specified complexity.

    Heavens to Betsy, so they are. That's about the funniest conclusion this entire thing could possibly have. Who's embarrassed of what now?

    Andrew Mead McClure · 13 November 2005

    P.S. Just to warn-- something is buggy about David Wilson's link just above my post here. Maybe the NSCE website doesn't like deeplinking or something, a lot of websites don't. As of the time of this post, if you follow Mr. Wilson's link above you will not be able to download the deposition (every link on the page will return a 404). However if you begin at the NSCE's top-level Kitzmiller documents page and navigate to the "APPENDIX III Tab O.pdf" file from there, you will correctly be able to download. So if you experience problems try doing that.

    David Wilson · 13 November 2005

    In comment #56935
    P.S. Just to warn-- something is buggy about David Wilson's link just above my post here. ....
    Sorry about that. Although I did check that the link worked before posting, I didn't realise that there might be a problem downloading the file, and I didn't check that.
    However if you begin at the NSCE's top-level Kitzmiller documents page and navigate to the "APPENDIX III Tab O.pdf" file from there, you will correctly be able to download. So if you experience problems try doing that.
    Alternatively, if you click on the "back" link at the top of the list of files, that will take you up two directories. From there, clicking on "2005_08_08_Brief_Opp_SJ" and then on "APPENDIX III" gets you back to the directory with the deposition in it, and it then becomes downloadable (at least it did for me).

    John · 13 November 2005

    > We are fortunate in this day a Google world can allow us to never permanently destroy all digital data, or at least that which Google's webcrawlers can find. So, Google's caches maintain that Dembski's words are immortal, at http://66.102.7.104/search?q=cache:Aat6Dkz7FZwJ:...

    You are wrong. Google cache expires eventually.

    David Wilson · 13 November 2005

    In comment #56933
    Coincidentally, pages 74 to 77 are one of the few places in the Deposition where Thompson's questions manage to stray into relevance, thus giving Shallitt the opportunity to make a few telling points about the worthlessness of the concept of specified complexity. Was the omission a chance accident resulting from blind naturalistic forces, or was some sort of designing intelligence involved?
    Oops. On re-examining the deposition more carefully, I find that the "telling points" I was referring to occur on pages 78 to 81 not on pages 74 to 77. All Shallitt does on these latter pages is go through parts of Dembski's expert testimony and indicate points on which he considered he could offer an expert opinion. Thus there is no basis at all for my insinuation that Dembski might have omitted these pages to avoid embarrassment, and I apologise to him for having made it.

    Chris Lawson · 13 November 2005

    To lutsko, I am willing to give the benefit of the doubt to you as a physicist who has just stumbled into the matter and whose interest has been piqued. However, you have made some points that cry out for a response. Following in the footsteps of others, here's my take:

    1. There is no way of mathematically proving that an evolutionary step is impossible. You can try to estimate its probability, but even then you might find you have underestimated the chances if you treat evolution as a progression of base pairs in a fixed sequence. If you learn a little about evolution and genetics, you will be surprised at the number of mechanisms that can lead to evolutionary change, such as gene duplications and chromosomal dysjunctions and viral insertions and transposons, and so on and so on. It is not as easy as it sounds to estimate the probability of a given gene sequence evolving, let alone "disprove" it mathematically.

    2. Even if you could mathematically prove that a certain set of genetic code could not have arisen by standard evolution, that does not prove intelligent design. It simply proves that there is a gap in our knowledge of evolution. And even if you could prove that evolution was not the mechanism, you still haven't ruled out some other naturalistic phenomenon. This is no different, in physics terms, to the incompatibility of Maxwell's equations and Newtonian physics. Physicists didn't deduce that an intelligent designer kept pushing electrical fields around. They tried to find a solution. Lorenz got in first with a mathematical adjustment, but it wasn't until Einstein that we got an explanatory theory to match the Lorenz contraction. Likewise, if intelligent design wants to be seen as a science it cannot be satisfied with finding flaws in evolutionary theory, or even with methodological naturalism. It has to come up with *positive* testable hypotheses. Lorenz derived a formula for contraction derived from the ether theory. Einstein found a better theory that dispensed with ether and was consistent with the Lorenz contraction. Hundreds of scientists constructed experimental to test relativity. Nobody said "Maxwell's equations are inconsistent with Newton's, therefore my Theory of Intelligent Light is correct by default." Now imagine the Theory of Intelligent Light being given equal time to Maxwell's equations and Newtonian physics in American schools in the 1880s because a bunch of powerful preachers said "teach the controversy"...

    3. There are many flaws in evolutionary theory -- you only have to read a few issues of NATURE or SCIENCE to see genuine points of disagreement between theorists and real mysteries that remain unexplained. Given these flaws, it is easy to come up with examples of findings that appear to contradict standard evolutionary theory published in respected scientific journals. So you don't even need to construct artificial mathematical proofs of evolution's shortcomings. All you need to do is to read the literature. IDists see these as marketing tools ("A Theory in Crisis"). But real scientists see these flaws as opportunities to make exciting discoveries. They try to develop new theories and new testable hypotheses to extend our knowledge. They don't throw up their hands and say, "What happened in the Cambrian explosion? Who knows? Obviously it must have been God. We might as well cancel all our research into phylum differentiation."

    Ron Okimoto · 13 November 2005

    *The FDA recommends a maximum limit of 300 milliTards of creationism per year. On Panda's Thumb we get 1700---2000 milliTards. It doesn't affect mortality, but it does increase clinical signs of rage.

    Creationism is like vitamin C the LD 50 is so high that it isn't likely that anyone will ingest those levels. After a certain amount most people just piss it out of their system. The real problem is in retention and utilization. Without the ability to fully utilize creationism you end up with cases like the Dover School board. Some of them have bathed in creationism through their entire lives, but due to mishaps in physiology or accidental damage they can't assimilate it and get anything useful out of it. Due to cortical damage, inborn errors like microencephaly, or environmental filters like fingers in their ears, very little of creationism is retained in its active form. This can result incompetent behavior, as was observed in Dover, but is more likely to result in the Bovine Herd Syndrome. In this syndrome the affected have to be led around by a ring in their nose, by those not as affected and willing to take advantage of the less fortunate. Guys like Bonsell and Buckingham seem to have full retention of creationism and this led to their immoral behavior and their part in the Bovine Herd Syndrome observed, as they led the less fortunate around in Dover. So, the real reason for the suggested FDA limit is so that people that can fully assimilate creationism do not reach the levels where they might be tempted join organizations like the Discovery Institute so that they can take advantage of the less fortunate. There doesn't seem to be a vital physiological requirement for creationism, and obvious negative side effects. Ron Okimoto

    Brian · 13 November 2005

    I haven't read through all of the comments on here (so if this is repetitive, please excuse me), but isn't it ironic that Dembski calls calls Shallit obsessive and an internet stalker in the meanwhile Dembski has put so much effort into "exposing" Shallit. I disagree that Shallit is obsessive for questioning Dembski, but Dembski "should" be able to see the obsessiveness in his actions. I mean, he even admitted that, "The previous postings were a bit of street theater. I now have what I needed."

    Doesn't that statement reflect that of an obsessive, stalking fool who repeats his actions until one gets what he so dearly needs?

    Brian

    lutsko · 13 November 2005

    Your reactions to honest questions are quite interesting. FWI, I am not a neophyte but have followed this issue for years: my interest in biology was first piqued when Dawkin's Self Gene and Wilson's Sociobiology came out and I have read extensively since then.

    To Chris in particular, you say:
    "1. There is no way of mathematically proving that an evolutionary step is impossible."

    Really? Putting aside the question of whether anyone can issue such a catagorical statement, what if a sequence was found in the junk part of a chromosone of some organism which gave pi to a 100 digits in binary coding? Granted, that would not be a "mathematical proof" per say, but you get the point. And, despite your categorical statement, a mathematical proof may be unlikely, but is not beyond the realm of imagination.

    I mean, be real. I am certainly not advocating ID in any form and I think Dembski is a poor, deluded figure, but the underlying question is not completely stupid, however improbable and I am surprised at the alarmed reactions my original post elicited.

    To return to my point: personally, if pi where found encoded in a genome, my conclusion would only be that it proved there was life elsewhere in the universe but i would have little doubt that that life evolved by natural mechanisms.

    Norman Doering · 13 November 2005

    Steve S wrote: "We all hang out here and get toxic doses of creationism*, so when someone like Lutsko comes by who isn't deeply familiar with the ID Project, and doesn't know how foul and malevolent it is, we perhaps overreact."

    A reasonable excuse, but this has got to be one of the worst threads I've read on Panda's Thumb for evolutionary arguments no matter what the excuse. It really is a petty pissing contest.

    However, the humour isn't bad at all.

    KL · 13 November 2005

    Norman Doering wrote:

    "A reasonable excuse, but this has got to be one of the worst threads I've read on Panda's Thumb for evolutionary arguments no matter what the excuse. It really is a petty pissing contest."

    I agree, and to be honest, all the mathematical/philosophical/logical arguments were WAY over my poor spinning head. The American public doesn't deal with things on that level. The ID issue can be dealt with in plain terms: Science is science and ID proponents cannot "play" unless they follow the rules like everyone else. (I don't expect the NBA to change its requirements so that I, female and 5'1", can play with the Bulls) Scientific theories are not challenged or replaced in the high school science classroom or university lecture hall.

    Oh, well, on the other hand, there needs to be a forum for pissing contests, too! =)

    Keith Douglas · 13 November 2005

    I guess I shouldn't be surprised, but I am, though not so much over Dembski's behaviour, but rather that of his followers. I.e., that he still has some.

    I wish I knew how to make these people go away. I read somewhere years ago that if you can persuasively promote pseudoscience youv'e got it made (cf. Freud). I guess Dembski is an example ... In some ways his case is worse, since Freud didn't get much influence in political matters.

    PaulC · 13 November 2005

    this has got to be one of the worst threads I've read on Panda's Thumb for evolutionary arguments no matter what the excuse.
    Maybe that's because such arguments are off topic in this thread. The point is really about Dembski's dishonesty as demonstrated once again. Note that Lutsko's first comment addressed this, although he was quickly driven off topic (I assume for giving favorable mention to any example of Dembski's). I think it's too much to expect high quality out of reactive digressions. You're lucky if you get it from unmoderated comments that stick to the point.

    jscase · 13 November 2005

    Lutsko,

    It seems to me that as in much of this evolution controversy people are using the same words to mean different things. The resaon Dembski and all are able to get so much traction is that they use the trappings of objective science to pursue a political end. In standard science this just isn't done - everything starts with the assumption of honesty. Every so often someone is discovered having cooked the data to get the desired result, with disastrous consequences to his/her career. So we don't really have the tools within science to address someone who doesn't particularly care where the evidence leads, because his goals are different. It's about politics, not science.

    The distinction can be seen in the way that on Dembski's blog there are posts about whether Eugenie Scott is an atheist, and a transcription of Bush's veteran's day speech.

    I agree that if you get a few graduate students together and consume several beers, it's perfectly reasonable and even scientific to start pondering "What if an alien lifeform or supreme being poked our DNA to make our brains so big?" But, the scientific response is to wake up with a headache and go back to teasing out the little bits of truth under our microscopes.

    The discussions here at PT are really all about the politics, not the science. At least PT doesn'thave discussions about Dembski's religion.

    k.e. · 13 November 2005

    Dear Lutsko
    I don't know how up to date you are on

    ".....not beyond the realm of imagination"

    Watching your thought process is like watching the beginning of (a) man bootstrapping a creation Myth. The greater the knowledge he has the more sophisticated it gets.

    Some physicists seem to have the peculiar habit of thinking they can see into the mind of God. And theistic religion relies so much on this that as one wag put it
    "religion ? isn't that a branch of physics?"

    http://www.firstthings.com/ftissues/ft9508/davies.html

    Of course those "insights" are metaphysical musings empty of meaning except for those who's received wisdom is theistic and useful only in self worship (prayer) but when hooked to Fundamentalism (the rigid interpretation of Gen1.and Gen2. - the imagined collective history of the Jewish people which for some passes as religion) fueled with insecurity and and a schizophrenic detachment from reality and "Identity Politics{Look it up)" ...provide a dangerous cocktail, Think:- the death of world science as it was then and arguably the death of Islam around 1000 years ago, Germany 1933, Sept 11.

    For a better insight into why we are the way we are, a tour thru man's Myths with J. Cammpbell will give much richer insights than any scientist will and doesn't require any supernatural twiddling, get hold of "The Hero With A Thousand Faces".

    http://www.jcf.org/

    Religion comes from the Latin word for "That which binds us together" some would argue the contrary of course however faced with problems of fundamentalism in their own ranks, the collective sane center are finally getting around to cross faith/culture dialog to try and head off the clash of horizons and the rise of fundamentalism. Look up "one world religion"

    You may already be aware of your fellow physicist Sokal who heroically debunks pseudoscience and metaphysics
    if not then read the first 3 pages of
    (Right click and download this next line).
    http://www.physics.nyu.edu/faculty/sokal/pseudoscience_rev.pdf
    The top page is here.
    http://www.physics.nyu.edu/faculty/sokal/index.html#impostures

    For more info on information theory and its applicability to Biology have a look at this.
    http://www.hubertpyockey.com/

    Hope that helps.

    JS Narins · 13 November 2005

    Dear Mr Brayton,

    I object to your use of the word scumbag. I think that word, to have the proper punch, should be reserved for people with actual power, like politicians and CEOs, especially the latter.

    Careful and judicious use of language, even the slurs, is important.

    PaulC · 13 November 2005

    Dembski's deletion of some pages only compounds his idiocy. He's crossed the line from calculated deception to what looks like a pathological inability to tell the truth to save his life. (He may have crossed it long ago, but I have only been following him since his mention in an NYT story last August.) I can't even figure out what he is trying to accomplish beyond maintaining the loyalty of whatever deluded folks get all their information from his blog.

    My guess is that Dembski found the deposition after Elsberry's comment at Dispatches made it clear that the transcript could be found at NCSE. My reason for assuming so is that this comment caught my own interest, and I was able to find it after some google searching.

    But it should also be said that it's been known at least since Oct. 31 that a PDF copy was available for emailing. Ed Brayton commented that he received such a file in email. It's also been stated repeatedly that it is part of the public record and available through the standard means of obtaining court records. My stake in the matter was too small to do this, but this would not be true of Dembski.

    Dembski could have obtained it any number of ways, so his claim of "street theater" makes absolutely no sense. We're to accept the following as explanation? 'I discovered I might have to get off my tush, use a telephone, ask my legal contacts, or (gasp!) pay a nominal fee to obtain this part of the public record. Therefore, I am entitled to lie, accuse, contradict myself, and whine over the internet as part of my guerilla "street threater" strategy to get someone else to do my work for me. After all, if google can't find it, it doesn't exist.'

    Hey, is anyone sure Dembski really exists? The strategy of dissembling for weeks on the Internet to obtain a document available by simple means offline doesn't make a lot of sense for a human being, but it is consistent with an advanced bot.

    John · 13 November 2005

    Offtopic: if anyone needed more evidence that ID is creationism, here it is http://www.iscid.org/papers/deJong_EvolutionExperience_051005.pdf

    R.O. · 13 November 2005

    Ah, the do-nothing parasites, er, I mean, philosophers have arrived to tell physicist Lutsko and the rest of us what science is really about. I am reminded of the following aphorism I came up with:

    Those who can do. Those who can't become philosophers of the discipline in question.

    'Rev Dr' Lenny Flank · 13 November 2005

    Those who can do. Those who can't become philosophers of the discipline in question.

    Or teach theology in some obscure corner of the country. After having been booted out of their previous job.

    theonomo · 13 November 2005

    There is something encoded in the genome that is a lot more remarkable than pi to 100 digits.

    Sir_Toejam · 13 November 2005

    Creationism is like vitamin C the LD 50 is so high that it isn't likely that anyone will ingest those levels. After a certain amount most people just piss it out of their system.

    damn, that must be my problem. I just need to drink more beer so i can piss this stuff out of my system.

    PvM · 13 November 2005

    To Chris in particular, you say: "1. There is no way of mathematically proving that an evolutionary step is impossible." Really? Putting aside the question of whether anyone can issue such a catagorical statement, what if a sequence was found in the junk part of a chromosone of some organism which gave pi to a 100 digits in binary coding? Granted, that would not be a "mathematical proof" per say, but you get the point. And, despite your categorical statement, a mathematical proof may be unlikely, but is not beyond the realm of imagination.

    — lutsko
    Your example may eliminate chance but does it eliminate regularity? I'd say that finding pi to a hundred digits by itself would not prove that an evolutionary step is impossible. For instance, we see fibonacci sequences in nature, prime numbers in prey-predator cycles etc.

    Stephen Elliott · 13 November 2005

    OK so Doctor Dembski makes several false statements, accuses someone of incompetence, claims documents have disappeared and then, when caught lying; passes it all off as street theatre.

    Not only that, but this sort of behaviour is normal from the main ID proponents. Yet I have yet to see a media article that reports these shenanigans when dealing with the ID/Evo issue (except those Dover reports).

    How is this possible?

    Is nobody on the Evo side pointing to these tactics?

    Just wondering.

    Mike Walker · 13 November 2005

    Dembski could have obtained it any number of ways, so his claim of "street theater" makes absolutely no sense. We're to accept the following as explanation? 'I discovered I might have to get off my tush, use a telephone, ask my legal contacts, or (gasp!) pay a nominal fee to obtain this part of the public record. Therefore, I am entitled to lie, accuse, contradict myself, and whine over the internet as part of my guerilla "street threater" strategy to get someone else to do my work for me. After all, if google can't find it, it doesn't exist.'
    Even if Dembski was being honest about his post hoc explanation of "street theater", it simply falls into the pattern of behaviour typically used by psuedoscientists. They find it much easier to fire off questions and insinuations, goading their opponents into doing all the work for them, than to do an honest day (or even hour) of work themselves. Also, note that the "street theater" excuse had two purposes. First, it was a cover up for his own incompetance and second, it was a insinuation meant to convey that he somehow managed to pull one over on his enemies by making them do all the leg work. I said it before... pathological behaviour. Nothing is *ever* going to get through to this guy. Ever.

    Sir_Toejam · 13 November 2005

    Ah, the do-nothing parasites, er, I mean, philosophers have arrived to tell physicist Lutsko and the rest of us what science is really about.

    You should take your assumptions and general lack of wit and head back to your blog, RO. many of us here actually DO science. overgeneralizations by you aside, I for one have been gainfully employed doing science for many years. My own specialties are in ontogenetic color change in fishes, and shark behavior/biology, not that i would even have needed to do ANY research at all to attack the flaw in logic in lutsko's argument. Did you think because Lutsko said he was a physicist that THAT makes him more of a scientist than someone who works in the bilogical sciences? give it up, man, you aren't witty, and you can't even deal with the fact that your hero (Dembski) is a liar. Ever plan on answering my question to you (see many posts up): let's see... please qualifiy "If bill was in error" for me, please.

    Wesley R. Elsberry · 13 November 2005

    I've read the deposition in its entireity. From page 150 on, and for about twenty more pages, yes, the deposition is a little embarassing. Shallit is made to seem like he has no substantive arguments against Dembski, save one; and that one is, more or less, trivial. Dembski's characterization is not completely unfounded. Please don't respond until you've read the deposition. Thank you.

    — BlastFromThePast
    In Shallit's deposition, from p.150 to 170, Shallit was asked various questions about whether pointing out that Dembski is not a scientist or not a renowned mathematician has no bearing upon the truth value of Dembski's arguments. And Shallit answered that these do not go to the truth value of the arguments. However, if one also reads Shallit's expert report, one will find that Shallit directly addresses the arguments that Dembski makes, as well as Dembski's qualifications. Shallit produced a rebuttal report, and that report had two aims: to demonstrate that Dembski's claims to competence as an expert were overblown, and to show that the specific arguments made by Dembski were problematic. Most readers of English would be able to distinguish these two purposes. Certainly, it seems that Thompson did. His line of questioning was aimed specifically at establishing that even if Dembski's claims to expertise were fantasies, that it would not *necessarily* mean that his arguments themselves were wrong. That would have to be established separately. What doesn't come out in the deposition in the pages "Blast" refers to is that Shallit also worked over the arguments themselves, at least so far as mathematics and computer science are concerned (except that something of Shallit's argument on Dembski's "Law of Conservation of Information" did appear in those pages. It's more than a bit disingenuous to term that "trivial"; Dembski certainly is on record as taking pains to respond to at least one online critique of that "Law", which is more than he does for most criticism. But perhaps "Blast" meant that Shallit's criticism in that regard was "trivial". Testifying that the claim that there is a "Law of Conservation of Information" is incorrect is not "trivial"; it is directly counter to the original claim.)

    Sir_Toejam · 13 November 2005

    I have nothing against whoever lutsko is, but when a physicist presents such mental masturbation as this, I find it almost necessitates a very critical response.

    There is plenty enough confusion about how science works out there already, without scientists themselves using extremely artificial constructs to try and elucidate issues that don't really exist.

    there are places for mental masturbation about scientific evidence and theory, but this is supposed to be a thread about Dembski's dissembling and lies, and is really an inappropriate place for that type of discussion.

    I would suggest to lutsko that he start a thread in the "after the bar closes" area if he wants to actually explore this avenue of thought.

    Mike Walker · 13 November 2005

    How is this possible? Is nobody on the Evo side pointing to these tactics? Just wondering.
    Well, we are... :) And I believe the good folks at the NCSE are taking notice. Frankly a spat over blogs and depositions, though highly indicative of a pathological pattern of behaviour, is not likely to garner much attention from the news media. (In fact, this really is small potatoes considering what's going on in politics today. What is important is to get people like Dembski and Behe up on to the witness stand where it is much harder to hide behind half-truths, obfuscation and revisionist history. At the very least Dembski is laying down a paper trail that he's going to find very hard to erase in the future. He dodged a bullet at the Dover trial, but it will catch up to him eventually (not that he will even notice when it does!).

    morbius · 13 November 2005

    "1. There is no way of mathematically proving that an evolutionary step is impossible." Really? Putting aside the question of whether anyone can issue such a catagorical statement, what if a sequence was found in the junk part of a chromosone of some organism which gave pi to a 100 digits in binary coding? Granted, that would not be a "mathematical proof" per say, but you get the point.

    Yes, we get the point that you have just agreed with what you pretend to disagree with, and that you can't spell "per se". Sheesh.

    Sir_Toejam · 13 November 2005

    Your reactions to honest questions are quite interesting

    care to qualify that remark?

    morbius · 13 November 2005

    Your example may eliminate chance but does it eliminate regularity? I'd say that finding pi to a hundred digits by itself would not prove that an evolutionary step is impossible.

    What we have here is someone coming up with an phenomenally implausible scenario just to try to make the point that evolution can be mathematically disproved, and then admitting that it doesn't mathematically disprove evolution. By Lutsko's probabilistic standard, we can mathematically "disprove" his scenario. After the distinction between "disproved" and "unlikely" has been carefully drawn by myself and others, frankly, I can't tell the difference between what Lutsko is doing and trolling. He says "Your reactions to honest questions are quite interesting" -- I think this reaction belies the claim of honesty. It certainly belies good faith.

    Norman Doering · 13 November 2005

    Stephen Elliott wrote: "... this sort of behaviour is normal from the main ID proponents. Yet I have yet to see a media article that reports these shenanigans ..."

    Oh, they report on similar shenanigans, like that comment about standing up for Jesus and then claiming ID is not about religion. What they don't report on is Dembski's blog.

    And you're right. The behavior is common, but not exclusively IDian, it's human, all too human and more common than any of us want to admit.

    Sir_Toejam · 13 November 2005

    I mean, he even admitted that, "The previous postings were a bit of street theater. I now have what I needed." Doesn't that statement reflect that of an obsessive, stalking fool who repeats his actions until one gets what he so dearly needs?

    I think perhaps Dembski confused "childlike" and "childish", opting for the latter behavior as being the pathway to glory.

    Sir_Toejam · 13 November 2005

    What they don't report on is Dembski's blog.

    That wasn't his point, Norman, and you know it since you actually enclosed his actual point in the segment you chose to quote.

    morbius · 13 November 2005

    There is something encoded in the genome that is a lot more remarkable than pi to 100 digits.

    Well said. Lutsko's example sums up as "Suppose we found something in the genome incredibly unlikely to arise by evolutionary processes; then it would be incredibly unlikely that it arose by evolutionary processes". He acknowledges that this wouldn't be a mathematical proof, but says we should "get the point" and makes the categorical claim that such a proof is "within the realm of possibility" as if his example somehow supported the claim, and after it has been explained by several people why it isn't, and their reasoning isn't challenged. That too is "remarkable" -- and rather sad.

    lutsko · 13 November 2005

    Sir Toejam,

    How am I suppose to qualify my remark? I really do not know what you are getting at. In any case, here are a few remarks:

    First, I agree - this discussion has wandered off-topic and may be better continued somewhere else.

    Second, one man's "mental masturbation" is another man's "thought experiment".

    Third, and example of what I consider interesting is morbius, if i understand his last comment correctly, accusing me of being what i explicitly deny - namely, some sort of proponent of ID.

    Fourth, I am a naturalist, period. But i think that people who are defending any position do us all a dis-service by making dogmatic, unsupported, categorical statements like "ID is not science" or "such and such could never be proven". True, "god of the gaps" arguments are not science, but the basic question being asked is legitimate - could there be "design" and how would you detect it? I do not think Dembski or Behe or the others have advanced the solution of these problems one iota, but that is a different matter.

    Well, anyways, I am not sure that replying accomplishes much since we do not have any real disagreements. I actually, started with a fairly innocuous comment about how I thought it a shame that Dembski was so dishonest and the lack of honest critics and got dragged into this conversation by replies to the effect that honest criticism was impossible which just seems like nuts to me.

    jim

    Norman Doering · 13 November 2005

    Sir_Toejam wrote: "That wasn't his point, Norman."

    It wasn't?

    Well, maybe I missed the point, but I thought the point was that the media was not reporting on ID shenanigans. That's not true. During the Dover case there was a lot of reporting on similar shenanigans -- like trying to hide the creationist roots of ID -- and that's why those guys were voted out before the case was judged.

    I don't think the public even knows Dembski has a blog.

    Dembski gets very few comments, far fewer than Panda, and those are mostly from his syncophant regulars.

    It's one of those little facts that make this whole thread a petty pissing contest.

    morbius · 13 November 2005

    Third, and example of what I consider interesting is morbius, if i understand his last comment correctly, accusing me of being what i explicitly deny - namely, some sort of proponent of ID.

    Nowhere did I accuse you of being a proponent of ID. This slander has been your approach from the very beginning, when you responded to STJ "I am a physicist and no fellow-traveler with the ID crowd". Not only ID proponents are intellectually dishonest trolls.

    Norman Doering · 13 November 2005

    lutsko wrote: "... the basic question being asked is legitimate - could there be "design" and how would you detect it?"

    I agree, that's a legit question. It has been discussed at length in other threads -- but they're closed now.

    I also agree, this isn't the right thread for that topic.

    If you want to take that question to another thread or forum, let me know and tell me where. I might show up.

    morbius · 13 November 2005

    if i understand his last comment correctly, accusing me of being what i explicitly deny - namely, some sort of proponent of ID.

    I've looked over my comments to see which one Lutsko could conceivably have interpreted this way, since he didn't bother to say, and seems to forget that others might be posting comments at the same time he is -- an odd lapse for a modern physicist. The best candidate seems to be "we get the point that you have just agreed with what you pretend to disagree with". But that refers, not to ID, but to "There is no way of mathematically proving that an evolutionary step is impossible". So no, Lutsko doesn't understand my comment correctly, in fact he doesn't seem to have bothered to read or comprehend what I or anyone else wrote.

    Stephen Elliott · 13 November 2005

    Well, anyways, I am not sure that replying accomplishes much since we do not have any real disagreements. I actually, started with a fairly innocuous comment about how I thought it a shame that Dembski was so dishonest and the lack of honest critics and got dragged into this conversation by replies to the effect that honest criticism was impossible which just seems like nuts to me.

    — lutsko
    I was also surprised at some of the animosity on this site when I first started to visit. Stick around though. You will see in time why many posters here are so testy. Imagine if Physics was under the same sort of attack that Biology is. How would you feel if an organised group of people was using the media, courts and pr to get the controversy taught in high school Physics classes. Once you have seen the antics of the ID crowd; the way they try to get their scientific theory pushed into science classes: without actually presenting a scientific theory or producing any experimental evidence etc. You will then (almost certainly) be inclined to cut the biologists some slack.

    Sir_Toejam · 13 November 2005

    I don't think the public even knows Dembski has a blog. Dembski gets very few comments, far fewer than Panda, and those are mostly from his syncophant regulars. It's one of those little facts that make this whole thread a petty pissing contest.

    Norman, you don't read well, do you? his point was that the media has done little to show the same level of dissembling in "the main ID proponents", not the school board of dover. He wants the media to do a better job of covering the general behavior and strategic approach utilized by DI, for example, that exhibits the same level of dissembling and dishonesty specific to Demski. he was only using Dembski as a specific case in point, not expecting the media to necessarily focus on Dembski himself. clearer?

    Sir_Toejam · 13 November 2005

    moreover, characterizing the entire criticism of lutskos commentary as a "pissing match" is disingenuous at best.

    Just because you don't understand the arguments involved, doesn't make it a pissing match.

    I personally have no problems in continuing lutsko's tract in another thread, where it could officially become a "pissing match" if that is the desire.

    morbius · 13 November 2005

    The basic question being asked is legitimate - could there be "design" and how would you detect it?

    That categorical claim (anyone else catch the whiff of hypocrisy?) is highly debatable, when the nature of "design" is unspecified. To date, "design" has only been defined in the negative: "not evolved". So the question becomes "Could there be the absence of evolution and how would you detect it?" The question is "legitimate" in the sense that you won't be arrested for making it, but it doesn't have much legitimacy beyond that.

    Ben · 13 November 2005

    could there be "design" and how would you detect it?"

    Offhand, by trying to find some solid evidence for design that hasn't been refuted many times over, by demonstrating that you don't have a fundamentalist Christian agenda, and publishing any possible evidence for design you can find in the appropriate media.

    Norman Doering · 13 November 2005

    Sir_Toejam wrote: "Norman, you don't read well, do you?"

    Ummm... you don't think the writers of "Of Pandas and People" are some of the "main ID proponents"??

    You said: "...his point was that the media has done little to show the same level of dissembling in "the main ID proponents", not the school board of dover."

    My example was from main proponents, the school board paid the price.

    Maybe you're the one who doesn't read well?

    Now I'm in a pissing contest.

    Stephen Elliott · 13 November 2005

    he was only using Dembski as a specific case in point, not expecting the media to necessarily focus on Dembski himself. clearer?

    I believe I am being deliberately miss-understood. TY for the support though.

    morbius · 13 November 2005

    I was also surprised at some of the animosity on this site when I first started to visit.

    Some animosity is natural when people tell lies like "got dragged into this conversation by replies to the effect that honest criticism was impossible". Here's the comment from STJ that "dragged" Lutsko into the conversation:

    if we found something that, after a long period of time, no one could imagine being produced by an evolutionary pathway don't you think that would more reflect limits in our own imaginations, than on reality? Not for the first time, i give you Darwin Himself: [...]

    Lutsko responded to this by dodging the question, constructing strawmen:

    I am a physicist and no fellow-traveler with the ID crowd. On the other hand, I cannot rule out the logical possibility of naturalistic design: after all, its not unthinkable that some day we can ourselves create artificial organisms. I therefore do not think it heretical to allow for the possibility that some sort of "design inference" could be justified and I do not think that appeals to authority rule it out. Although I do not agree with the "reasoning" of Demnski and his crowd, I do think it is healthy to have honest skeptics nipping at the coat tails of scientists - god knows we are used to them in physics. Thus my comment that I think it sad that Dembski et al are not honest in their critisims.

    Then his next post accused STJ of "being touchy". And so it goes. Reminds me of someone else from a recently closed thread about an op-ed in the LA Times.

    CJ O'Brien · 13 November 2005

    morbius:
    Hmmm ... perhaps Dembski's chessboard analogy is good, after all, to illustrate the error in design reasoning.
    And not just the chessboard, but Mt. Rushmore, SETI... I can't think of an analogy that D*mbski has propped up in his "popular" writings that doesn't work better as an argument against design.

    But, bring it up and you're "not dealing with the technical aspects of [his] work"

    And if you do deal with those aspects, a la Shallitt, then you're a stalker and the spew of lies that come out in WAD's defense are "street theater." Well, I walked out of the show, Bill, and I want my money back.

    Sir_Toejam · 13 November 2005

    Second, one man's "mental masturbation" is another man's "thought experiment".

    uh, hmm. i would have thought you realized the two mean the same thing.

    True, "god of the gaps" arguments are not science, but the basic question being asked is legitimate - could there be "design" and how would you detect it? I do not think Dembski or Behe or the others have advanced the solution of these problems one iota, but that is a different matter.

    That wasn't the position i was addressing, it was the lack of a fundamental scientific approach to the issue that were inherent in your thought experiment to begin with, and which you failed to address. I think the distinction comes from the fundamental difference between a human designer, which i agreed would be easily tested for since we already have the precursory information necessary to do so, and a supernatural designer, which there is no way to scientifically test for. if you wish to continue this any further, i again highly suggest you take it to the after the bar closes area: http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?act=SF;f=14

    Norman Doering · 13 November 2005

    morbius wrote: "That categorical claim (anyone else catch the whiff of hypocrisy?) is highly debatable, when the nature of "design" is unspecified."

    I agree. In order to talk about design you have to talk about motive, goals, methods, tools, and such. You really can't deal with it in the abstract.

    It leads you to thinking things like "God had a purpose for creating AIDS."

    Would anyone like to switch the context of that kind of disscussion and take it to this forum:

    After the Bar Closes
    http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?act=SF;f=14

    http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=43776201eece4a11;act=ST;f=14;t=38

    Think about how you might tell an artificially designed virus from a naturally evolved one.

    Stephen Elliott · 13 November 2005

    Then his next post accused STJ of "being touchy". And so it goes. Reminds me of someone else from a recently closed thread about an op-ed in the LA Times.

    I think lutsko is very different from the guy you are referring to. lutsko, I believe is genuinely thinking things through. Whereas the other fella was wanting to lead a sorty against ID and gain publicity, possibly increasing book sales.

    morbius · 13 November 2005

    I think lutsko is very different from the guy you are referring to. lutsko, I believe is genuinely thinking things through. Whereas the other fella was wanting to lead a sorty against ID and gain publicity, possibly increasing book sales.

    I wasn't referring to their goals, but rather their approach toward reasoning and debate. However, at least Lutsko did engage the responses he got, even as he mischaracterized them. Frankly, I suspect that he's a lot better at "thinking things through" than what he has displayed here. When someone says that X isn't possible, there is surely a better response than "Really? Consider this example ... true, it's not an example of X, but you get the point."

    morbius · 13 November 2005

    Second, one man's "mental masturbation" is another man's "thought experiment".

    uh, hmm. i would have thought you realized the two mean the same thing. I'm with Lutsko on this; he just said that they are the same thing, but that different people have different opinions as to their value. IMO and experience, thought experiments can have great value in both philosophy and science -- they worked for Einstein, for example.

    Cubist · 13 November 2005

    [W]hat if a sequence was found in the junk part of a chromosone of some organism which gave pi to a 100 digits in binary coding?

    — lusko
    Any 50-nucleotide sequence gives 100 binary digits of pi in binary coding (four nucleotides, hence 1 nucleotide = 2 bits, yes?). Since nucleotides aren't themselves binary digits, you need to have some sort of protocol for translating nucleotides into binary digits. Thus, given any 50-nucleotide sequence, what bit-string it translates to is determined by the particular translation protocol you use. And since there is no One True Nucleotide-to-Bits Translation Protocol, there is nothing to stop anybody from curve-fitting concocting a one-shot, special-purpose translation protocol that yields any one given desired bit-string from any one arbitrary nucleotide sequence. If you can demonstrate that your translation-protocol-of-choice isn't just something that was slapped together post-hoc, you might have something... then again, maybe you might not. How many nucleotides are there in the genome of, say, homo sapiens? Given a pre-defined Translation Protocol X, what are the odds that at least one 50-nucleotide stretch of that genome will yield 100 binary digits of pi when you use Translation Protocol X on it, simply through random chance alone? And since you said "of some organism" rather than specifying a particular species, what are the odds that at least one 50-nucleotide stretch of any organism whatsoever will yield 100 binary digits of pi when you use Translation Protocol X on it? In short: Your proposed test here isn't particularly meaningful. Too much opportunity for cherry-picking, of both the translation protocol and the species whose genome you're gonna use that protocol on.

    Sir_Toejam · 13 November 2005

    Second, one man's "mental masturbation" is another man's "thought experiment".

    no, the use of the term "mental masturbation" is not meant to imply anything more negative than "thought experiment". it's just a more slang term for it. or, we could start another thread to discuss the definition of terms? ;)

    morbius · 13 November 2005

    no, the use of the term "mental masturbation" is not meant to imply anything more negative than "thought experiment". it's just a more slang term for it.

    What did someone say about pissing matches? If you're going to simply naysay, you might try it when your claim isn't so obviously wrong.

    Katarina · 13 November 2005

    In an earlier off-topic comment, John posted this link:

    http://www.iscid.org/papers/deJong_EvolutionExpe...

    I read this paper, and though the flaws in the argument against evolution using the 2nd law of thermodynamics were obvious (the "direction" he is seeking is natural selection, the energy is sources of radiation, mostly solar), it wasn't so obvious to me how to answer his other challenge.

    That in instances of high exposure to radiation, the subsequent mutations have never been observed to add a selective advantage to
    an organism. He writes:

    "Cancer researcher Prof. Plasterk (1996, p. 28) makes clear that this is a misconception: 'There are bunches of biologists who think that evolution happens by the emergence of a mutation somewhere in the species, that brings a selective advantage. It is known for half a century yet that it does not go like this, and cannot go like this..... The forming of a species goes by the selection of combinations, not of mutations.'"

    Now, before everyone jumps on me all at once, please know that I am aware that there is more than one type of mutation, there are duplication mutations, for instance, which demonstrate how "information" is not always lost because of a mutation, as well as chromosomal crossover, etc. But my question is, how important are germ-line mutations, and how important is sexual reproduction, what is meant by "combinations," and what impact does it all have on evolution? Broad question, I know, and I apologize.

    If anyone can direct me to a place where I can learn about this in more detail, please do so. Thanks.

    Katarina · 13 November 2005

    I realized that my link is broken. The full link is

    http://www.iscid.org/papers/deJong_EvolutionExperience_051005.pdf

    and the comment I was referring to by john is comment # 56596.

    byzanteen · 13 November 2005

    I have nothing against whoever lutsko is, but when a physicist presents such mental masturbation as this

    — Sir_Toejam

    no, the use of the term "mental masturbation" is not meant to imply anything more negative than "thought experiment". it's just a more slang term for it. or, we could start another thread to discuss the definition of terms?

    The term you are looking for is pulling a Penrose.

    PaulC · 13 November 2005

    Not only that, but this sort of behaviour is normal from the main ID proponents. Yet I have yet to see a media article that reports these shenanigans when dealing with the ID/Evo issue (except those Dover reports).
    Here's one datapoint. I don't (or didn't) follow the political issues surrounding evolution, and the first I ever heard of Dembski was in an article in last August's NYT that presented him as a mathematician who provided a rigorous underpinning for ID. I found this interesting mainly because it could actually lead to falsifiable claims that could conceivably be shown false using computer experiments. Actually, I just took it for granted that he had theorems that proved something, just that the theorems were inapplicable. Now I'm not sure he has even given one unambiguous definition. In retrospect, I know how late I am to the game, but the NYT story presented Dembski as a serious researcher with credentials, and I started with this assumption even though I was pretty certain his conclusions were wrong. What I've learned since then puts him squarely in the category of either calculated liars or unhinged crackpots. His recent behavior seems less calculated than unhinged, so I continue to refine my model for what drives him. At this point, no responsible science writer should refer to Dembski without including phrases like "habitual liar" in the description. His behavior is so well documented and so thoroughly at odds with academic practice that it deserves a story or at least a sidebar for itself. Unfortunately, I guess it's unlike to happen as journalists crank out "he said, she said" stories.

    Stuart Weinstein · 13 November 2005

    Ed wrote "Okay, let's call a spade a spade here. Dembski is a lying scumbag with no regard for the truth whatsoever. Period. Just when you think he's hit rock bottom, Dembski begins to tunnel."

    Tell us how you feel Ed.

    Sir_Toejam · 13 November 2005

    What did someone say about pissing matches? If you're going to simply naysay, you might try it when your claim isn't so obviously wrong.

    uh, turn that sarcasm meter up a bit. i thought i made it obvious by adding the ";)" at the end.

    Stuart Weinstein · 13 November 2005

    "The term you are looking for is pulling a Penrose."

    Is that a reference to the "Emperor's New Mind" ?

    Stephen Elliott · 13 November 2005

    At this point, no responsible science writer should refer to Dembski without including phrases like "habitual liar" in the description. His behavior is so well documented and so thoroughly at odds with academic practice that it deserves a story or at least a sidebar for itself. Unfortunately, I guess it's unlike to happen as journalists crank out "he said, she said" stories.

    — PaulC
    I would have thought by now that the pro Evo side would have a pr type handout for journalists, one that outlines (with documentary evidence) some of the stunts these people pull. Just guessing, but I would imagine that most scientists are not used to dealing with people of such shallow standards. When I first read a book that was pro ID, I got the impression that the proponents were actually serious scientists. What an eyeopener this last year (or so) has been. It is hard to believe they are still being reported seriously. Living in the UK, I expect it will flare up over here before long. Perhaps I should keep some records of these guys track records, to provide our media when it happens.

    Sir_Toejam · 13 November 2005

    The term you are looking for is pulling a Penrose.

    lol. indeed.

    morbius · 13 November 2005

    At this point, no responsible science writer should refer to Dembski without including phrases like "habitual liar" in the description.

    Which applies to Michael Balter's atrocious op-ed in the LA Times, where he uncritically presented ID talking points, such as

    Using complex statistics, intelligent-design theorists contend that natural selection fails to fully explain life's complexity, thus alternative explanations to evolution should be considered. As a rule, they don't speculate over who or what did the designing.

    They don't speculate because they know.

    morbius · 13 November 2005

    The term you are looking for is pulling a Penrose.

    I can go with that -- of course, nothing negative is implied. :-)

    Sir_Toejam · 13 November 2005

    When I first read a book that was pro ID, I got the impression that the proponents were actually serious scientists

    really? That would be a topic worthy of discussion here: what is it exactly that leads to the impression of ID proponents being serious scientists? Is it just their credentials in print? I think it would be worthwhile to pinpoint exactly where that impression comes from.

    Worldwide Pants · 13 November 2005

    The previous postings were a bit of street theater.

    Positively Pythonesque.

    Stephen Elliott · 13 November 2005

    Which applies to Michael Balter's atrocious op-ed in the LA Times, where he uncritically presented ID talking points

    — moribus
    Did you suspect he was after some self publicity perchance?

    morbius · 13 November 2005

    Is that a reference to the "Emperor's New Mind" ?

    Presumably it refers to Roger Penrose's misapplication of Godel's Theorem, in that book and "Shadows of the Mind", to "prove" that computers can't do everything the human mind can do. It's sort of the flip side of ID -- human cognition is too complex to be the result of an algorithm.

    Sir_Toejam · 13 November 2005

    They don't speculate because they know.

    yup, their problem is they just can't seem to figure out a way to prove it to the rest of us "edumacated" folk. but then, i was raised to think religion was based on faith, and required no proof to begin with. *shrug*

    Stephen Elliott · 13 November 2005

    really? That would be a topic worthy of discussion here: what is it exactly that leads to the impression of ID proponents being serious scientists? Is it just their credentials in print? I think it would be worthwhile to pinpoint exactly where that impression comes from.

    — Sir TJ
    I do not have that impression now. The exact opposite in-fact. But yes; it was the high grade qualifications that led me to believe they were serious scientists. That and the misleading information about their research work and university lecturer positions.

    BlastfromthePast · 13 November 2005

    Katarina, you may have to wait a while for an answer. I'm waiting with you.

    morbius · 13 November 2005

    Did you suspect he was after some self publicity perchance?

    I didn't get that impression either from his op-ed or from the discussion thread, although he did mention (and compliment) his book parenthetically. It was more that he's overly impressed with his own abilities and is just certain that he's got a good idea and everyone who disagrees lacks imagination or is dogmatic or has some other character flaw. Honest engagement with criticism doesn't seem to be part of his repertoire.

    Sir_Toejam · 13 November 2005

    so, correct me if I'm wrong, but it would imply that we all are susceptible to "argument from authority" reasoning, yes?

    so are they just playing to a common psychology? Intentional or not? as an aside, since it is mentioned frequently enough, this is exactly the reason i chose the name i did. just for those that were wondering. hard to extract any form of argument from authority from the name "toejam", and putting the "sir" in front just serves to emphasize the point. right or wrong, inane or logical, i always like what i post to stand on it's own merits (or demerits). of course, i invalidate the function of the handle by explaining it, so don't exepect me to do it again, otherwise i'll have to change it. :)

    Sir_Toejam · 13 November 2005

    oops, the part that should have been in quotes in my last post was:

    But yes; it was the high grade qualifications that led me to believe they were serious scientists

    sorry bout that.

    Stephen Elliott · 13 November 2005

    "so are they just playing to a common psychology? Intentional or not?"

    Was that addressed to me?

    Sir_Toejam · 13 November 2005

    Honest engagement with criticism doesn't seem to be part of his repertoire.

    indeed, that's an understatement, and most worrisome for someone calling themselves a science writer. At least from my perspective.

    Stephen Elliott · 13 November 2005

    Sir TJ,

    Yes the Authority did hold some weight.
    Plus I suspect that my own desire for a purpose for the universe made me want to believe them.
    I knew there were some flaws in the reasoning, but I guess a scientific bunch of evidence to indicate God: was appealing to my psychological makeup.

    Sir_Toejam · 13 November 2005

    Was that addressed to me?

    it's a general question. I'm looking for opinions on whether folks think that specific use of credentials is an actual tactic being deliberately used by the DI (as an example) to present 'authority' to their arguments, or whether it is just accidental.

    Stephen Elliott · 13 November 2005

    it's a general question. I'm looking for opinions on whether folks think that specific use of credentials is an actual tactic being deliberately used by the DI (as an example) to present 'authority' to their arguments, or whether it is just accidental.

    I think it was deliberate. I also think that the tactic would work better for them than you.

    Sir_Toejam · 13 November 2005

    ah, thanks Stephen.

    do you now feel there to be any specific intent to appeal to you in that fashion?

    Sir_Toejam · 13 November 2005

    lol. i'm posting a little behind you, sorry.

    Stephen Elliott · 13 November 2005

    ah, thanks Stephen. do you now feel there to be any specific intent to appeal to you in that fashion?

    Yes I do. They also psychologically prepared me for the hostile reaction I got when I first asked questions on this site. The book I read was "The case for a Creator" by Lee Strobel. It presented the ID mob as a group of "scientists", who through their research, had come to the conclusion that Darwin was wrong and "mainstream" science (atheistic BTW) was acting as a religious group. So when I came here; asked the questions the book had primed me with;got the hostile response, my first thoughts were "they must be onto something". Don't get me wrong. I do not think that anymore. However it would be a good idea to tone down the responses to first time visitors...until they prove themselves as troll.

    morbius · 13 November 2005

    "so are they just playing to a common psychology?"

    The primary purpose of Phase II is to prepare the popular reception of our ideas. The best and truest research can languish unread and unused unless it is properly publicized. For this reason we seek to cultivate and convince influential individuals in print and broadcast media, as well as think tank leaders, scientists and academics, congressional staff, talk show hosts, college and seminary presidents and faculty, future talent and potential academic allies. Because of his long tenure in politics, journalism and public policy, Discovery President Bruce Chapman brings to the project rare knowledge and acquaintance of key op-ed writers, journalists, and political leaders. This combination of scientific and scholarly expertise and media and political connections makes the Wedge unique, and also prevents it from being "merely academic." Other activities include production of a PBS documentary on intelligent design and its implications, and popular op-ed publishing. Alongside a focus on influential opinion-makers, we also seek to build up a popular base of support among our natural constituency, namely, Christians. We will do this primarily through apologetics seminars. We intend these to encourage and equip believers with new scientific evidence's that support the faith, as well as to "popularize" our ideas in the broader culture.

    Stephen Elliott · 13 November 2005

    Posted by morbius on November 13, 2005 08:13 PM (e) (s) "so are they just playing to a common psychology?" The primary purpose of Phase II is to prepare the popular reception of our ideas. The best and truest research can languish unread and unused unless it is properly publicized. For this reason we seek to cultivate and convince influential individuals in print and broadcast media, as well as think tank leaders, scientists and academics, congressional staff, talk show hosts, college and seminary presidents and faculty, future talent and potential academic allies. Because of his long tenure in politics, journalism and public policy, Discovery President Bruce Chapman brings to the project rare knowledge and acquaintance of key op-ed writers, journalists, and political leaders. This combination of scientific and scholarly expertise and media and political connections makes the Wedge unique, and also prevents it from being "merely academic." Other activities include production of a PBS documentary on intelligent design and its implications, and popular op-ed publishing. Alongside a focus on influential opinion-makers, we also seek to build up a popular base of support among our natural constituency, namely, Christians. We will do this primarily through apologetics seminars. We intend these to encourage and equip believers with new scientific evidence's that support the faith, as well as to "popularize" our ideas in the broader culture.

    This is what is so dangerous about them. They have a plan and scruples play no part in it. I found their arguments (before I realised what they were up to) very appealing.

    Sir_Toejam · 13 November 2005

    thanks for reminding us of the wedge document, but I was specifically curious to find out what folks thought about IDers before they learn of things like the wedge document. can folks come to the conclusion they are being manipulated without having seen things like the wedge document?

    I think Stephen's response is exactly what i was looking for.

    from the other end of the spectrum, I never took ID seriously at all until i started paying attention to the politcal bedfellows involved with it; that's when i ran across the 'thumb. so i guess i had completey refuted the argument long before any "authority" was lended to it.

    what about yourself, morbius?

    Andrew Mead McClure · 13 November 2005

    I don't think the public even knows Dembski has a blog. Dembski gets very few comments, far fewer than Panda, and those are mostly from his syncophant regulars. It's one of those little facts that make this whole thread a petty pissing contest.

    Personally, though, while I do kind of suspect Panda's Thumb somewhat trivializes itself by spending so much time on blog wars with Dembski, the entire thing is somewhat fascinating in terms of what it says about the people running ID. Mr. Dembski is one of the true giants, relatively speaking, within the ID movement. He's one of maybe five public figures in ID with even a superficial claim to the term "scientist"; one could argue Dembski and Behe comprise in their writings ID's entire superficial claim that it is science. And here in this thing about Shallit we have the man responsible for arguably half the "scientific" basis of the ID argument, behaving-- plain and simple-- as a common net.kook. What does this say? We are expected to believe that creationism, or intelligent design, or whatever it's going to be called after the Kitzmiller decision, is as a minority viewpoint important enough that it deserves to be taught in public schools. (That's a big deal; I can point you to entire hard science disciplines, say maybe atmospheric thermodynamics, which will never so much as get a mention in an entire high school education.) But there's an awful lot of nonstandard theories coming from people on USENET who are roughly indistinguishable from what Mr. Dembski has made of himself. Why teach this blogger's vague and outlandish theory in a science class, but not this other one?

    k.e. · 13 November 2005

    Someone may have pointed this out before I wonder who might best fit Sancho ;> (snigger)
    Don Quixote is visibly crazy to most people. He believes ordinary inns to be enchanted castles, and their peasant girls to be beautiful princesses. He mistakes windmills for oppressive giants sent by evil enchanters. He imagines a neighboring peasant to be Dulcinea del Toboso, the beautiful maiden to whom he has pledged love and fidelity. Sancho Panza, his simple squire, believes his master to be a bit crazy, in particular he knows that there is "really" no Dulcinea, but he plays along, hoping to get rich. He and Quixote agree for instance that because Dulcinea is not as pretty nor does she smell as good as she should, she "must have been enchanted", and from that point on the mission is to disenchant her. Both master and squire undergo complex change and development throughout the story, and each character takes on attributes of the other as the novel goes on. At the end of the second book, Quixote decides on his deathbed that his actions have been madness. Sancho begs him not to give up, but to no avail. Master and squire have numerous adventures, often causing more harm than good in spite of their noble intentions. They meet criminals sent to the galleys, and are victims of an elaborate prank by a pair of Dukes, when Sancho is made "governor" of fake Barataria.

    Sir_Toejam · 13 November 2005

    We are expected to believe that creationism, or intelligent design, or whatever it's going to be called after the Kitzmiller decision

    i seem to recall "sudden emergence" as being bantered about, anyone confirm/deny that rumor?

    Stephen Elliott · 13 November 2005

    I am a bit worried that ID is being taken too complacently by the scientific community.
    ID is not science...true.
    But it does not have to be.
    To achieve it's aims; ID only has to appear scientific.
    Get the majority vote and BAM, they have won.

    I am starting to get worried by it now.
    Especially with the fundamental views expressed by some of your religious groups.

    It seems there are people that would like to send us back to the dark ages and reintroduce the inquisition.

    I am not joking. Just check some of the posts on Doctor Dembski's own site.

    k.e. · 13 November 2005

    STJ
    The whole beautiful irony of the IDDIots (or any other god botherers for that matter) is that if they didn't tell you [whatever it was they wanted you to believe]
    they wouldn't be needed.

    The typical advertising message

    Buy me!

    why?

    This product will fulfill your dreams!

    Why?

    Because I'm spending zillions telling you... stupid!

    The DI uses that new "bible" of business "The Art of War"

    Katarina · 13 November 2005

    Blast,

    To be fair, my question was off topic. I may ask it elsewhere.

    k.e. · 13 November 2005

    Stephen Elliott

    You are very right to be concerned

    The Catholic Church (and I'm not a Catholic BTW)
    have warned that DI ID crowd are a fundamentalist risk.
    Plus the DI ID have the added twist of "Identity Politics" (Think Germany 1933)

    Look up Fundamentalist religious schizophrenia

    Sir_Toejam · 13 November 2005

    It seems there are people that would like to send us back to the dark ages and reintroduce the inquisition.

    well, i used to get worried about this too, but things like seeing the Dover school board get voted out on their collective *sses suggests that sufficient exposure of these frauds does tend to get folks' notice. I certainly wouldn't categorize the average american by looking at the sychophants that post on Dembski's blog. try an open ID blog (one that isn't constantly submitted to excision by Dembski). I think maybe ARN isn't quite so closed to contrary posters. however, no matter which blog you go to, i doubt it would accurately reflect how "most americans" feel about anything, or what they would actually do in the voting booth. If you are looking for a more accurate measure on the state of things, I would track the success/failure rates of the attacks on the judiciary branch of government in the US currently. ironically, the "appearence" of bias in the courts to those of the extremist persuasion is exactly why they are under attack. regardless of what the people in the majority think, if the courts become heavily biased one way or the other, it won't really matter much. basically, whoever is in the administration will be able to call the shots, and even 200 years ago we all recognized the folly of that.

    Stephen Elliott · 13 November 2005

    Blast, To be fair, my question was off topic. I may ask it elsewhere.

    Does anyone have any links for this persons request? I know I don't. BTW Katarina. I think Blast was trying to divert attention.

    Stephen Elliott · 13 November 2005

    Plus the DI ID have the added twist of "Identity Politics" (Think Germany 1933)

    That is just about exactly what I was thinking. I for one find it pretty worrying. They only have to win the vote once. Then "the master plan/wedge" can be put into place.

    Tevildo · 13 November 2005

    i seem to recall "sudden emergence" as being bantered about, anyone confirm/deny that rumor?

    — Sir_Toejam
    It started out as a humourous observation made by Eric Rothschild during his cross-examination of Behe - http://www.talkorigins.org/faqs/dover/day12pm.html#day12pm317 Unfortunately, I think his hope may be rather optimistic.

    PvM · 13 November 2005

    Personally, though, while I do kind of suspect Panda's Thumb somewhat trivializes itself by spending so much time on blog wars with Dembski, the entire thing is somewhat fascinating in terms of what it says about the people running ID.

    You are right, PT has a rich history of interesting scientific postings. But the side-track was useful as it exposed the scientific vacuity amongst ID proponents. Dembski, scientifically speaking, is a minor player but he's fun since he seems to be unable to admit to any mistakes, and there are many. It's like playing with a voodoo doll, you poke it with a needle and it jumps...

    morbius · 13 November 2005

    what about yourself, morbius?

    I try to make the best inference I can from the evidence I have. Credentials play some role, but they're very weak -- sort a default in the absence of anything more direct. In the case of someone like Dembski, I have no reason to assume that anything else he says is true, regardless of degrees, because he can't write five sentences without his dishonesty becoming apparent. Intellectual authority means nothing if there's reason to think the person isn't motivated to tell the truth. And in the case of ID, I already have a lot of more direct information, including fundamental logical reasons to think it's an incoherent view (see my posts above), and that logic would have to be countered before I could give credence to any more specific claim, and the very last thing I would take into account is that someone has a degree or is published or is a physicist or an information theorist or has been on TV or any other characteristic of some person or persons.

    morbius · 13 November 2005

    it wasn't so obvious to me how to answer his other challenge. That in instances of high exposure to radiation, the subsequent mutations have never been observed to add a selective advantage to an organism.

    Being able to answer this "challenge" is fundamental to understanding natural selection. There's no such thing as an unqualified "selective advantage". Talk about "no improvement in the flora and fauna" is utterly meaningless without some basis for considering something to be an "improvement". But genes more numerous among the organisms that survive a Chernobyl accident are more likely to provide an advantage in surviving such radiation exposures -- that's the only sort of "improvement" that is relevant.

    morbius · 13 November 2005

    To clarify a point about the "challenge": the relevant mutations are those that occurred (randomly or otherwise) before the Chernobyl accident, and which contributed to genetic survivability -- via resistance to radiation damage of gametes, for instance. Those mutations that the accident caused are not relevant -- that's a red herring.

    conspiracy theorist · 13 November 2005

    what is it exactly that leads to the impression of ID proponents being serious scientists?

    I think that the IDiot's use of outright lies, coupled with distortions contribute to the impression. Those that aren't familiar with the details of some experiment/evidence can be suckered when the IDiots mis-characterize it while providing a reference that they know 99% of readers won't check. When the IDiots put together an argument that appears to be supported by their fake evidence, with substantial supporting literature (that disprove everything they're saying mind you), it looks to the average Joe like serious science.

    PvM · 13 November 2005

    There is also the confusion of radiation damage and mutations in general. Once again we see how ID is scientifically vacuous, even when it discusses science.

    Sir_Toejam · 13 November 2005

    That in instances of high exposure to radiation

    the other thing is, that many of these folks that put up the argument about selective disadvantage due to radiation mutation are viewing it from a standpoint of severe genetic damage from extreme UV or gamma radiation, not from minor changes wrought by more common and less extreme cases. I really wonder who in their right minds would think that the kinds of damage accrued from exposure to high radiation levels would produce anything other than a heavily damaged organism, likely without the ability to reproduce any more at all. for selection to work, an individual must be able to actually reproduce to begin with.

    PvM · 13 November 2005

    I think that the IDiot's use of outright lies, coupled with distortions contribute to the impression. Those that aren't familiar with the details of some experiment/evidence can be suckered when the IDiots mis-characterize it while providing a reference that they know 99% of readers won't check. When the IDiots put together an argument that appears to be supported by their fake evidence, with substantial supporting literature (that disprove everything they're saying mind you), it looks to the average Joe like serious science.

    — Conspiracy theorist
    You make some excellent points, but you dilute them with some unnecessary ad hominem, namely calling them IDiots. As an ex-creationist I have found out the hard way the difference between how creationists portray science and the facts. With ID proponents I have found their portrayal of for instance the Cambrian explosion to border on the irresponsible. Unless they insist on showing why ID is scientifically vacuous. Then they make an excellent point.

    Erik · 13 November 2005

    Katarina- re #57012

    Try to google "beneficial mutations" and read the results that contain references to peer-reviewed papers.

    or visit talk origins list of standard responses. (This seems to be another one of Henry Morris's claims (lies))

    Why do you think that scientist would say that beneficial mutations exists if it was not true ?

    Why do you think that the "paper" you refered to would be true ? Why was it not send for peer-reviewing ?

    and this brings us back on topic. Why do you trust anything from the ID-community ?

    Erik

    morbius · 13 November 2005

    I really wonder who in their right minds would think that the kinds of damage accrued from exposure to high radiation levels would produce anything other than a heavily damaged organism, likely without the ability to reproduce any more at all.

    But in fact some of the organisms are able to reproduce. And the offspring of those organisms may well be more radiation resistant than the offspring of organisms that weren't exposed to the radiation (although they may suffer from other genetic damage). The problem lies with the strawman teleological notion that mutations produce "improvement". People with this mistaken notion would think that your point about heavy damage is an argument against evolution.

    PaulC · 13 November 2005

    thanks for reminding us of the wedge document, but I was specifically curious to find out what folks thought about IDers before they learn of things like the wedge document.
    I think the question is a little more complicated. I have known for years that there are politically motivated creation "scientists" that are pushing a religious agenda. But I can tell you what I thought about Dembski based on the NYT article, and how wrong I was. I think there are intelligent people who have a lot of difficulty dropping certain comfortable assumptions about the universe. They're not deluded or bad, or even irrational in most things. They just have a couple of blindspots. The mathematically minded ones go off on tangents claiming to prove the impossibility of things that they prefer to consider impossible. Somewhat brought up Penrose, and his difficulty with AI is a good example. For whatever reason, he doesn't want human intelligence to be reducible to a Turing machine calculation, and this leads him to express what could be summarized as personal incredulity in the form of lengthy arguments. I'm not saying anyone has yet proved AI is possible, just that Penrose hasn't proved that it isn't, and his proposals of where consciousness does come from (e.g. quantum microtubules) have no evidence behind them. I think Penrose is wrong, but he hasn't broken the implicit contract one expects from an academic. I'm a little on the fence with Behe. I think he started out like Penrose but because his issue has more political controversy around it, he has been challenged more and has had to circle the wagons. It is hard for me to believe that if he has a shred of honesty he feels "real good" about his answers under cross-examination. I assumed Dembski fit into something like this pattern. But he now strikes me as something else entirely. On the one hand, his financial benefactors make him seem like a typical partisan thinktank hack (like a "supply-side" economist) and I now expect him to behave dishonestly. On the other hand, I expect him to act in his self-interest and the interest of his allies. But his behavior with respect to the deposition puts him at about the level of my favorite Usenet kooks back in the good old days: you know, Alexander Abian, who proposed blowing up the moon, and Ludwig/Archimedes Plutonium who believed the universe was based on a plutonium atom and had names for hundreds of not-yet-discovered elements. Actually, saying that is unfair to the Usenet kooks, since they were all a lot more honest and affable than Dembski, and more than happy to respond to criticism.

    morbius · 13 November 2005

    Why do you think that the "paper" you refered to would be true ? Why was it not send for peer-reviewing ?

    This is an interesting comment after the discussion of argument from authority. Katarina didn't say anything about thinking the claims in the paper were true; she simply wanted to know what was wrong with the argument it makes. That's what real science is about, not about believing what is peer-reviewed and disbelieving what isn't.

    Sir_Toejam · 14 November 2005

    But in fact some of the organisms are able to reproduce. And the offspring of those organisms may well be more radiation resistant than the offspring of organisms that weren't exposed to the radiation (although they may suffer from other genetic damage). The problem lies with the strawman teleological notion that mutations produce "improvement". People with this mistaken notion would think that your point about heavy damage is an argument against evolution.

    ah, yes, i see your point. I always viewed that argument as the same as any extreme damage argument (meteors, volcanoes, radiation, billy-bob and his M-16 deer killing machine, etc.). that is, it produces a bottleneck. Not necessarily interesting who survives the bottleneck from an evolutionary standpoint per say, it's who survives AFTER the bottleneck. I'd be happy to continue this discussion in a new thread if anyone is interested. We had a very productive discussion on the role of bottlenecks in evolution some time ago in the after the bar closes area.

    PaulC · 14 November 2005

    It was my understanding that radiation is sometimes used in agriculture to generate mutations from which desired cultivars are selected and breed. I have no idea how common this practice is, but I was able to find one link to a Japanese website: Institute of Radiation Breeding http://www.irb.affrc.go.jp/index-E.html
    Radiation breeding is chracterized by its merits; creation of new mutant characters, addition of very few traits without disturbing other characteristics of variety, and improvement of vegetatively propagated and even sterile plants. The Institute of Radiation Breeding (IRB) is engaged in the development of new crop strains through mutation induction, and is conducting research into more efficient methods for inducing mutation. While working to contribute to the breeding of new varieties of various seed-propagated, vegetatively propagated and woody crops, the IRB is conducting fundamental research to elucidate the mechanism of mutation. The IRB has also pursued irradiation service and energetic joint research programs at the request of universities, private industries and local governments.
    Comic books aside, radiation is usually going to do more harm than good, but it has a chance of doing good like any other random modification.

    Sir_Toejam · 14 November 2005

    OT

    On the one hand, his financial benefactors make him seem like a typical partisan thinktank hack (like a "supply-side" economist)

    Paul, if you have ever run across any well-thought out support for supply-side economics, could you post the links here or in a thread over on the off topic forum? I have years-long running arguments about economic theory with several folks and have been collecting references. er, just to clarify, I'm agin 'em ;) thanks /OT

    Sir_Toejam · 14 November 2005

    different case, as far as i can tell, i think the original post was referring to extreme radiation.

    However, if you go there, we should also include the dozens of years that have been spent irradiating drosophila to cause mutations for genetic and selection experiments.

    Hell, i used to set up labs at UCSB to do that very thing for undergraduate biology.

    morbius · 14 November 2005

    It was my understanding that radiation is sometimes used in agriculture to generate mutations from which desired cultivars are selected and breed.

    Right, but it's the selection pressure that produces the desired improvement. The radiation-induced mutations provide the variability upon which selection acts. From the talkorigins page that Erik cited:

    Plant breeders have used mutation breeding to induce mutations and select the beneficial ones (FAO/IAEA 1977).

    PaulC · 14 November 2005

    Sir_Toejam: Just to clarify, so am I.

    PaulC · 14 November 2005

    Right, but it's the selection pressure that produces the desired improvement.
    Yes, I know.

    morbius · 14 November 2005

    Sorry, I should have realized that.

    Sir_Toejam · 14 November 2005

    dang error checking bother.

    It was my understanding that radiation is sometimes used in agriculture

    yes, and in fact, if you want to go there, we should also include the dozens of years spent irradiating Drosophila for genetic and evolutionary studies. In fact, i used to prepare UV irradiation labs at UCSB for undergrads to do their own experiments along these lines. However, i believe the point of the original post was more aiming at the effects of "high" or extreme irradiation. As Morbius points out, you might produce some radiation resistant organisms this way (using extemely high doses of radiation), but especially with your agricultural example, this would be of little evolutionary or economic significance. I can't recall any USDA program that is trying to select crops to be more radiation resistant, for example :)

    morbius · 14 November 2005

    However: http://www.ebi.ac.uk/2can/bioinformatics/bioinf_realworld_1.html

    2.1 Waste cleanup Deinococcus radiodurans is known as the world's toughest bacteria and it is the most radiation resistant organism known. Scientists are interested in this organism because of its potential usefulness in cleaning up waste sites that contain radiation and toxic chemicals

    PaulC · 14 November 2005

    However, i believe the point of the original post was more aiming at the effects of "high" or extreme irradiation.
    Sorry, I caught it in mid-stream. I just thought I saw some suggestion that radiation should never increase fitness. Anyway, there's clearly a limit to what evolution can do. You could probably drop turtles out of airplanes for the lifetime of the universe without discovering one that could fly or survive the impact. You need selective pressure that allows for some reasonable chance of survival. Of course, "reasonable" depends on lots of factors such as population size (e.g. for bacteria it could be one in a billion and still be reasonable in many cases).

    Erik · 14 November 2005

    Morbius re # 57096

    I was not discussing science, I was discussing the paper on ISCID. Why would anyone spend time on that? Obviously, the author (de Jong) did not.

    A google search is far more efficient, and authors that refers to reviewed papers tend to be more reliable. A google search starting with
    "Cancer researcher Prof. Plasterk " easily shows that the quote of de Jong is a misquote, at least I found a page where Plasterk describes the importance of mutations for evolution (in Dutch).

    Erik

    Sir_Toejam · 14 November 2005

    However: (57115)

    yeah, but that isn't really agriculture in the sense i meant (food or ornamental crops). tho it is an interesting note.

    morbius · 14 November 2005

    Morbius re # 57096 I was not discussing science, I was discussing the paper on ISCID. Why would anyone spend time on that? Obviously, the author (de Jong) did not.

    You asked Katarina Why do you think that the "paper" you refered to would be true ? It's a simple fact that she didn't say she did. Both that comment and this later one are non sequiturs.

    morbius · 14 November 2005

    yeah, but that isn't really agriculture in the sense i meant (food or ornamental crops). tho it is an interesting note.

    Um, I know that. That's why I wrote "However" rather than something like "Well, here's one". Isn't miscommunication fun? :-)

    BlastfromthePast · 14 November 2005

    BTW Katarina. I think Blast was trying to divert attention.

    — morbuius
    The Emporer's New Mind is atour de force. There is no misapplication of Turing whatsoever. It's pure brilliance. And incontrovertible.

    BTW Katarina. I think Blast was trying to divert attention.

    — Steven Elliot
    The crystal ball again: I just don't think you have any kind of answer to give to her question. I'm very curious to see what kind of response she gets.

    Sir_Toejam · 14 November 2005

    The Emporer's New Mind is atour de force. There is no misapplication of Turing whatsoever. It's pure brilliance. And incontrovertible.

    ok, now i know that blast posted that specifically for a laugh, so... BWAHAHAHAHAHAHAAHAHAAH.... HAHAHAHHAHAHHAHHA ehhahaah hahah ha

    Erik · 14 November 2005

    Morbius

    My final comment in this "interesting" discussion.

    Yes, I assumed that Katerina thought that de Jongs claim was true about missing evidence of "positive" mutations due to radiation. Of course, I should have thought that she wanted to be able to explain it even though it was incorrect. I stand corrected. I am glad you understand her better than I do.

    Erik

    k.e. · 14 November 2005

    For once I agree with you Blast!

    BWAHAHAHAHAHAHAAHAHAAH....

    HAHAHAHHAHAHHAHHA

    ehhahaah
    hahah
    ha

    Did you figure out that Zen Koan

    http://www.ibiblio.org/zen/cgi-bin/koan.pl

    Sir_Toejam · 14 November 2005

    be careful, you have to be using the same crystal ball i am to assume that blast intended his post in the only rational way he could, as a joke.

    I'll loan you mine if yours is broke.

    morbius · 14 November 2005

    Yes, I assumed that Katerina thought that de Jongs claim was true about missing evidence of "positive" mutations due to radiation. Of course, I should have thought that she wanted to be able to explain it even though it was incorrect. I stand corrected. I am glad you understand her better than I do.

    Somehow I don't think you are. But she was quite clear:

    I read this paper, and though the flaws in the argument against evolution using the 2nd law of thermodynamics were obvious (the "direction" he is seeking is natural selection, the energy is sources of radiation, mostly solar), it wasn't so obvious to me how to answer his other challenge.

    She wanted to be able to answer his challenge, but it wasn't obvious to her how to do so. So yes, she "wanted to be able to explain it even though it was incorrect", if you put it so oddly, the same she is able to explain why de Jong's 2LOT argument is incorrect, even though it's incorrect.

    morbius · 14 November 2005

    morbuius wrote: BTW Katarina. I think Blast was trying to divert attention.

    No, neither "morbuius" nor I wrote that.

    The Emporer's New Mind is atour de force. There is no misapplication of Turing whatsoever. It's pure brilliance. And incontrovertible.

    You know this even though you think Godel and Turing are the same person.

    The crystal ball again: I just don't think you have any kind of answer to give to her question. I'm very curious to see what kind of response she gets.

    Not is only your crystal ball is broken, but so is your browser, or your glasses -- there has already been an extensive discussion addressing her question. You're just yanking our chains, right? Surely no one can be THAT moronic.

    k.e. · 14 November 2005

    STJ
    Blast doesn't do irony :)

    David Wilson · 14 November 2005

    In comment #56955
    Dembski's deletion of some pages only compounds his idiocy. ...
    Dembski did not delete any pages. They are missing in the copy held on the Pennsylvania Middle District court's publicly accessible electronic filing system. The only difference between the copy there now and the one Dembski posted is the document number in the headers on each page of the pdf. In Dembski'scopy it is 229, while in the current version in the PaMDC's files it is 229-3. This makes my original insinuation that Dembski might have been responsible for omitting the pages look rather silly. In my eagerness to score a cheap shot I did not check my facts carefully enough. I have already posted an apology.
    ... My guess is that Dembski found the deposition after Elsberry's comment at Dispatches made it clear that the transcript could be found at NCSE. ...
    No. While the both files were obtained by scanning a faithful copy of the original deposition, even a cursory examination of them shows that they must have been generated by different scans. The headers appearing on each page of Dembski's copy have been generated by the PaMDC's electronic filing system, and show that the copy must have been retrieved from there. This can be done by anyone willing to register with the US courts' PACER document retrieval service (which is free) and pay the necessary fees for the retrieval (which is not--though it is fairly inexpensive). Dembski's copy of the document must have been retrieved when it was the only document then filed under event number 229. There are currently 3 documents filed under that event and Shallit's deposition is now number 3 of that set. Exactly how Dembski got hold of his copy is anyone's guess.

    Erik · 14 November 2005

    I thought I'd better send some
    flowers
    for Katarina

    Do you need more evidence for radiation induced mutations ?

    Erik

    morbius · 14 November 2005

    Do you need more evidence for radiation induced mutations ?

    No one asked for evidence of radiation induced mutations. (Is reading comprehension really that difficult?)

    Katarina · 14 November 2005

    Thanks everyone for your responses.

    You have addressed the standard creationist question "Can mutations be beneficial to an organism/population?" very satisfactorily. But I still do not completely understand how the point that was quoted by de Jong, "The forming of species goes by the selection of combinations, not of mutations," helps his case. What did Plasterk mean by this phrase, "selection of combinations"? What are "combinations"?

    In more complex multicellular organisms, do these combinations count more than do direct mutations, as in prokaryotes? Of course, every variation ULTIMATELY goes back to a genetic mutation.

    Do creationists expect multicellular organisms to react to mutations the same way that bacteria and yeast do?

    OK, so let me get more specific with my question. Are mutations as immediately important for variation in multicellular life like vertebrates, as they are for single-celled organisms?

    And just to clarify, of course the paper I referred to has no scientific merit. In fact, it is a good example of the deceit that is the topic of this thread. It is made to look like a peer-reviewed paper, it is made to sound (vaguely) like one, but it has no content beyond mild discussion and a few drawings. It's ridiculous and only someone who's never even done a small browsing of any scientific journal would mistake it for a scientific paper. Nevertheless, I expect these questions to come up and I want to make sure I can address them honestly and thoroughly for people.

    Chris Lawson · 14 November 2005

    Wowee! This thread has really taken off since I was here yesterday.

    To Lutsko: if you are still reading: if you are interested in discussing the little sub-debate further, please let the PT crowd know so that they can set up an appropriate thread. I do believe you are trying to come to grips with the matter honestly. I am somewhat disappointed to see you claim that you are not a neophyte in these matters since you are using arguments that you should have seen rebutted many times over by now. But if you would like to debate this further, please say so.

    To Blast: I think that even Roger Penrose himself would decline your description of THE EMPEROR'S NEW MIND as "incontrovertible." Incontrovertible is a *very* powerful word. It wouldn't even be applied to quantum theory or relativity theory, for instance, even though they are the best experimentally-established theories in the history of physics. It may be applied (carefully!) to certain mathematical proofs, but EMPEROR'S NEW MIND wasn't that. It certainly shouldn't be used for philosophical arguments, which is what ENM was. I'd say that "incontrovertible" is quite possibly the mathematical-logical equivalent of "unfalsifiable." I wonder if your choice of words gives your game away. Anything you agree with is "incontrovertible" because you just know it is, and therefore anything that disagrees with your world view is by definition a false argument, regardless of the state of the evidence.

    And in case you're thinking of answering back, a simple question: what is Penrose's definition of an algorithm in ENM and what does that say about the logical foundation of his argument?

    Erik · 14 November 2005

    Katarina

    Why don't you try to contact

    Plasterk
    to get the correct quote and the explanation ?

    Erik

    morbius · 14 November 2005

    I think that even Roger Penrose himself would decline your description of THE EMPEROR'S NEW MIND as "incontrovertible."

    If he had thought it incontrovertible, he wouldn't have gone and written a whole other book after TENM was severely criticized by mathematicians and AI researchers.

    It may be applied (carefully!) to certain mathematical proofs, but EMPEROR'S NEW MIND wasn't that.

    In Shadows of the Mind, Penrose addresses at length the issue of how we can know our reasoning is sound. He recognizes that no individual human can be certain of not being in error, but argues (incorrectly) that we can be assured that the entire mathematical community can, over time, eliminate any error. Penrose is so sensitive to the issue and tries so hard to address it responsibly that to apply the word "incontrovertible" is incredibly ironic, and really an insult to Penrose.

    what is Penrose's definition of an algorithm in ENM and what does that say about the logical foundation of his argument?

    An algorithm is defined formally as the steps carried out by a Turing Machine. A better question, I think, is what is his definition of the human mind. Of course, he doesn't have one, and so it isn't possible to come to any formal conclusion about its computational power.

    Tim Hague · 14 November 2005

    Interesting thread this. I too have found myself kicked off Dembski's blog with no real explanation (apart from my anti-ID sentiments ;) ), and I share the overall opinion of his actions.

    Having said all that, I'm also surprised to see the levels of vitriol being directed at lutsko, who was making some interesting points. Some people on here seem to be of the opinion that 'all design hypotheses are bad' and will jump on anyone who suggests otherwise. I realise that this is in response to many arguments with ID proponents, but it still doesn't do anyone any real credit.

    If a scientist found a bacterium with a gene in it that was an exact match of the human insulin gene, and the bacteria was producing insulin for which it had no purpose, what would the scientist conclude? Based on the evidence of this page he would conclude it 'was not beyond the realms of probability' and that there was 'a natural explanation' for it. But of course, this bacterium has actually been designed - by humans in a lab.

    So - these days - design is a perfectly good hypothesis for something we see in nature, given our ever-growing ability to change the nature of the organisms around us. I predict here and now that some underhand ID 'scientist' will deliberately create a very unlikely combination (whale gene in a bacterium or something) and then claim it was found in the 'wild' and this discovery 'blows evolution out of the water' or other such hyperbole. We have to be prepared for that.

    If the binary sequence of PI, or the binary sequence of the first two dozen prime numbers, was found embedded in DNA, the mostly likely hypothesis available at the moment is that a human scientist created it.

    k.e. · 14 November 2005

    Tim Hague
    I second your suggestion.
    Propose a whole raft of scams to unhinge ID and maybe make some money out of it at the same time. All you would need is some loony billionaire (Dr Evil ?) to back you.
    On Lutsko I think the most telling comment is, why has he not solved a very basic logical problem before now ?

    Tim Hague · 14 November 2005

    k.e.

    I don't follow you. What is my suggestion that you are seconding? What is the 'basic logical problem' that you think lutsko had?

    Chris Lawson · 14 November 2005

    Tim,

    I don't think your analogy is a fair one. Finding an insulin gene in bacteria is indeed evidence of design, but that is because we know a priori that such a bacterium has been designed. Design is used by scientists all the time in the fields of anthropology, archeology, and forensic investigation and when design flops over into biology (as in the insulin-secreting bacterium), nobody has a problem with it. But Lutsko's question was what would happen if a *wild* bacterium had the binary sequence of pi in a noncoding part of its genome. The wild part is the critical aspect of the question. It's also the part that applies to evolutionary theory.

    I wasn't saying there *couldn't* be evidence for design in evolution, just that IDers haven't provided any, haven't developed a good model of what to look for, and that Lutsko was using a poor example (and confounded matters by calling it a mathematical proof when he didn't really mean that).

    Humans are prone to seeing design all over the place. A long time ago when I was designing a computer game, my co-designers wanted to develop extensive strategies that the monsters would employ in hunting down the players. I suggested we just make them move randomly. We tested it with a couple of friends, and lo and behold they all exclaimed on how clever the monsters were.

    Lutsko asked about the existence of pi to 100 places in wild genetic code. It would certainly raise some interesting questions. But until someone comes up with a satisfactory test for designedness, all we're doing is playing the game of "this is highly unlikely, so it must be design." I'll reply by asking five questions:

    1. What sequence of pi could not be explained by known genetic events?

    2. What sequence of pi could not be explained by as-yet-unknown naturalistic processes?

    3. What is more likely, 100 binary places of pi or 1700 consecutive GAA triplets on a chromosome?

    See http://www.ich.ucl.ac.uk/cmgs/neuro99.htm

    4. How far into pi does your phone number occur?

    See http://www.angio.net/pi/piquery

    5. What are the chances of finding self-referential loop sequences in transcendental numbers? Would this be evidence for design?

    See http://www.angio.net/pi/piquery

    morbius · 14 November 2005

    I'm also surprised to see the levels of vitriol being directed at lutsko, who was making some interesting points. Some people on here seem to be of the opinion that 'all design hypotheses are bad' and will jump on anyone who suggests otherwise.

    Would it be "vitriol" to point out that this is dishonest hyperbole?

    morbius · 14 November 2005

    If the binary sequence of PI, or the binary sequence of the first two dozen prime numbers, was found embedded in DNA, the mostly likely hypothesis available at the moment is that a human scientist created it.

    Ahem. This has already been refuted by Cubist in #57008. Like Lutsko, you seem to live in your own little mental world, not bothering to pay any attention to the counterarguments that people have posted.

    k.e. · 14 November 2005

    Morbius
    are you aware of Penrose's

    human consciousness is the result of quantum gravity effects in microtubules

    If that's the case then Britney Spears has invented her own anti gravity machine.

    PaulC · 14 November 2005

    Dembski did not delete any pages. They are missing in the copy held on the Pennsylvania Middle District court's publicly accessible electronic filing system.
    OK, then I withdraw my speculation as to how he got the copy. However, his deletion of blog pages and lame excuse of "street theater" still puts him pretty squarely in the camp of net kooks.

    Bayesian Bouffant, FCD · 14 November 2005

    Sir_Toejam wrote: i seem to recall "sudden emergence" as being bantered about, anyone confirm/deny that rumor? It started out as a humourous observation made by Eric Rothschild during his cross-examination of Behe - http://www.talkorigins.org/faqs/dover/day12pm.ht... Unfortunately, I think his hope may be rather optimistic.

    — Tevildo
    Rothschild took that phrase from a manuscript for the next edition of OPAP, being edited by Dembski, working title The Design of Life. Perhaps the 'premature emergence' of that phrase will require yet another cut-and-paste job.

    Katarina · 14 November 2005

    "Katarina

    Why don't you try to contact

    Plasterk to get the correct quote and the explanation ?

    Erik"

    Thank you Erik. So I did. If anything interesting comes out of it, I will keep you posted.

    Blast, stay tuned.

    PaulC · 14 November 2005

    Ahem. This has already been refuted by Cubist in #57008. Like Lutsko, you seem to live in your own little mental world, not bothering to pay any attention to the counterarguments that people have posted.
    Cubist's point was that you could choose the encoding to produce any sequence you like. This criticism isn't entirely unfair since lutsko never defined the encoding, but he suggests incorrectly that there is no sense in which "finding pi in DNA" could be a surprise requiring some kind of explanation. So let's assume something reasonable about the encoding: the digits of pi are given in bits. There is an encoding window of length k such as we find in the code for peptides. To encode bits, length 1 suffices but it could be longer (two bits could even be packed into one nucleotide). The encoding from nucleotide windows to bits is given as a table (the pi "discoverer" discovers the table along with it). The bits are given in sequence, but the sequence could be forward or reverse; they have to be contiguous on a DNA molecule, and there has to be n of them, starting at the beginning of the bit expansion of pi. To make the problem statement rigorous, we treat junk DNA as a string of m letters A, C, G, or T, each independently chosen with some probability (0.25, or something determined empirically). At this point we're already straying from biology, because the distribution might not be independent (e.g. could include markov processes). I don't know enough biochemistry to say. But now we can ask a question about my toy probabilistic model. The question is: Given a uniformly chosen "junk DNA string" of length m what is the probability that there exists a function from windows of length k to binary digits 0 and 1 such that the string contains the first n bits of the binary expansion of pi as a contiguous substring in either forward or reverse order. (Note: I am trying to say something precise in the above. Making precise statements is difficult, and often requires a lot of correction and revision. I have limited time and apologize if I missed something above; I welcome corrections.) Given that, and given the number of such strings you have looked at, given that you are looking specifically for famous transcedental constants and won't make up a post hoc story for anything else you find, given those conditions you can reasonably claim to be surprised at finding pi. What is sort of clear without working it out completely is that the larger the window k, the more "wiggle room" you have to encode anything you like. However, this problem goes away if you restrict k (or more generally restrict the Kolmogorov complexity of the encoding rather than allowing any table you like, so that would be another variation on the question, but not the one I'm giving.) Without doing the analysis one can see that the probability goes up with increasing m, down with increasing n, and up with increasing k. I suspect Lutko intended k=1, in which case the wiggle room is limited to 2^14 functions from {A,C,G,T} to {0,1} that can encode both 0 and 1. In that case, it would be pretty surprising to find a sufficiently long expansion of pi in a sufficiently short sequence of DNA. In that case, I agree that the first thing to look for is a human designer: your colleague is playing a trick on you by inserting messages in junk DNA. For that matter, it might be reasonable to assume someone hacked the sequencing software rather than the DNA itself. If you could really rule all of that out, there would be something to explain. The one that would occur to me is that DNA could have some kind of functioning ALU capable of iterative numerical calculations. The process to calculate pi is pretty mindless and we know that many natural processes can be described as algorithms. But there is no evidence for such a thing, and it seems implausible to me (and probably sounds insane to a practicing biologist). Finding pi would give some reason to look for that, since the likelihood would be even lower than pi in the DNA sequence increases fitness. If the above failed, there would be kind of a glaring anomaly that science would have to note and claim no provisional explanation for. However, no such anomaly is currently known, and in no case would science fill in the lack of provisional explanation with a specific non-scientific belief.

    Tim Hague · 14 November 2005

    Would it be "vitriol" to point out that this is dishonest hyperbole?

    — morbius
    Where's the hyperbole? That's my opinion having read this thread. I'm still allowed to have one of those, at least last time I checked... I am just as against ID as you are. I'm not an ID supporter. I think ID is a bunch of made-up religious claptrap. I'm on your side, OK? Let's just say your posting style reminds me of someone called DaveScot...! Here's an example:

    You seem to live in your own little mental world, not bothering to pay any attention to the counterarguments that people have posted

    — morbius
    My point - as you appear to have missed it completely - is that if a complex sequence of DNA is found in an unexpected place that matches a certain pattern (such as a known whale gene appearing in a bacteria, or Pi or any other very complex sequence) then the most likely explanation is that it was put there by a human 'designer'. I'm making the point because I fully expect the ID crowd to try it at some point and then pretend this anomolous sequence was found in the wild. What I'm also saying is that a 'design inference' as the ID guys call it cannot be ruled out these days, because scientists are changing other organisms (by design) - just as in my example above, where bacteria are producing insulin using a human insulin gene. If you like - there is (now) an intelligent designer. And it's us.

    PaulC · 14 November 2005

    Oops, I meant to say 14 functions that encode from {A,C,T,G} to {0,1}. I.e., there are 2^4=16 functions, but the two constant value functions aren't useful for encoding.

    There may be other errors, but let me restate my general claim that there are reasonable circumstances in which "finding pi in the DNA sequence of a bacterium" could hypothetically be well-defined and would require an explanation not covered by current scientific theory. Until someone "finds pi" (or e, or a list of primes, etc.), this kind of speculation is not very interesting, but it would be disingenuous in the extreme to suggest that such an occurrence would easily be explained by evolutionary theory.

    If anything, that makes the thought experiment supportive of evolution as science. If evolution could be used to explain *anything* than it would be unfalsifiable. If fact, it is limited to explaining features that contribute to fitness and are reachable through a series of incremental selection events. The features that IDers like to point out (e.g. bacterial flagella) fall into this category. It's difficult to imagine how an encoding of pi would do so. Empirically, we've founds lots of features like flagella, and none analogous to finding pi in junk DNA.

    PvM · 14 November 2005

    Having said all that, I'm also surprised to see the levels of vitriol being directed at lutsko, who was making some interesting points. Some people on here seem to be of the opinion that 'all design hypotheses are bad' and will jump on anyone who suggests otherwise. I realise that this is in response to many arguments with ID proponents, but it still doesn't do anyone any real credit.

    I agree. Lutsko raises some interesting questions and while one may disagree with his arguments, the best way of showing him to be wrong is by actually presenting one's own argument. I was also a bit discouraged by the level of the response to lutsko's statements. I hope that the commenters at PT can make an attempt to differentiate themselves from the ID creationists who are allowed to comment at Dembski's website. And I hope this to be in a positive manner.

    PaulC · 14 November 2005

    "If fact" above should be "In fact." I apologize for other typos. I hope there is something readable in all that.

    As a postscript, I just want to get back to my old hobbyhorse about ID. I wrote "[evolution] is limited to explaining features that contribute to fitness and are reachable through a series of incremental selection events."

    I would add that the "theory of design by intelligent humans" is also similarly limited in a way that IDers ignore entirely. A complex feature created by humans should have some explanation in terms of "fitness", which might just mean that the human mind finds it beautiful or else might mean it has practical applications. Moreover, the feature must be reachable by a sequence of incremental refinements. Each incremental step can be due to chance or the exhaustive search of a small enough combinatorial space, but humans usually do not follow a garden path of useless modifications forever and when they do they have a vanishingly small probablity of coming up with anything of value as a result.

    IDers seem to acknowledge that human beings, and not just the anonymous designer can produce "complex specified information", but it is a mystery to me how their formalism could ever make a distinction between the creative power of these processes.

    PaulC · 14 November 2005

    I agree. Lutsko raises some interesting questions and while one may disagree with his arguments, the best way of showing him to be wrong is by actually presenting one's own argument.
    I think it's par for the course that someone new who shows up asking questions that seem naive, or uses nomenclature that seems idiosyncratic to regular PT readers, is sort of assumed to have a crypto-ID agenda. This holds even when a slightly generous interpretation of their overall thrust would suggest otherwise. As a result, the kind of dismissive comments that one develops in response to old creationist talking points are sometimes lobbed inappropriately at people who have showed up with reasonable expectations of give and take, whose ideas may be insightful or half-baked, but who are willing to defend their view and learn from others. The best rule of thumb is probably just not to expect much fruitful discussion out of threads with as many comments as this one. That's a pretty clear indicator of a pissing match in progress. I'm not really sure that there is a lot that can be done to fix it. People have different posting styles, and I have observed that they are often not very amenable to suggestions that they change their style. We also don't want to develop a culture in which people are judged by declarations of loyalty rather than content.

    PaulC · 14 November 2005

    Since it looks like I have the floor to myself, here's one big clarification and then I'm out of here (there are several uncorrected typos):

    I wrote "it is a mystery to me how their formalism could ever make a distinction between the creative power of these processes."

    I mean it is a mystery how IDers propose to distinguish between the creative power of evolution and that of human intellect, since both are limited in remarkably similar ways with respect to finding optimal solutions in a large combinatorial search space.

    Sir_Toejam · 14 November 2005

    I agree. Lutsko raises some interesting questions and while one may disagree with his arguments, the best way of showing him to be wrong is by actually presenting one's own argument. I was also a bit discouraged by the level of the response to lutsko's statements.

    and what of those of us who completely disagree that lutsko raised any interesting questions at all, PvM? There WERE several arguments presented in contrast to Lutsko's. Are you just as dismissive of those? Perhaps it would have been better if anybody had paid attention to the suggestion to move the whole OT issue into a new thread on the ABC area, that usually has a tendency to break up any building vitriol. Perhaps it's what you should have encouraged as well, rather than basically overgeneralizing the responses to lutsko.

    lutsko · 14 November 2005

    To Chris Lawson, PaulC and even old skeptical Toejam,
    I am not a troll and take the rules seriously. It was proposed that this subject would be better persued on the "after the bar closes" forum so I have opened a thread there. If anyone cares to persue it, I am game.

    PaulC: you are right - i imagined k=1 all along. I didn't spell it out, expecting that any honest critic would address that case but hey, its OK to be surprised.

    So, to those of you interested in honest give and take, I hope to see you there. To everyone else, ... dream on.

    jim

    Sir_Toejam · 14 November 2005

    thanks, lutsko.

    see you there.

    cheers

    Salvador T. Cordova · 14 November 2005

    HiYa Panda's Thubites,

    Are you calling Bill's editorial changes to his weblog as dishonest? Guess you guys don't have anything better to do. He offered a speculation, not a claim of absolute fact.

    I'd like to thank Ed Brayton for assisting in the editorial process of Bill's Weblog. Good work Ed. No apology from our side forthcoming, but rather thanks for improving the factual content of what we write.

    cheerio :-)

    Salvador

    PS
    And for the record, I deleted threads at ARN because I was tired of seeing the typical thread jamming tactics being waged by Darwinist sock puppets.

    Well, we fixed that at ARN with Rule 9. Cleaned that place up. Yesiree sir.

    As far as the outcome of those claiming I ran away, I took on 20 Darwhinists on in the 3rd longest thread in ARN history. I didn't run away from the discussion. Several of my opponents are no longer there. Heck, they didn't even own or read the books we were discussing.

    But in any case did you here the latest fine bit of reporting by NPR:
    Progess of the Darwinist Inquisition

    I'm surprised you all did protest this fine work of reporting by NPR! We're cleaing you're clocks in the PR wars, and I just had this bit of heart warming news, 1/3 of bio freshman at ISU diss Darwin.

    Sir_Toejam · 14 November 2005

    Hey! Slaveador! we were beginning to doubt you would ever deign to grant us your presence here.

    are you staying or just dropping by to show us yet again how a proper sycophant behaves?

    Rilke's Granddaughter · 14 November 2005

    No, Sir T. You must remember that Salvador suffers from Narcissistic Personality Disorder. Consider

    Narcissicism is a personality disorder and that means that narcissists' personalities aren't organized in a way that makes sense to most people, so the notes below do not necessarily go in the order I've listed them or in any order at all. Interaction with narcissists is confusing, even bewildering -- their reasons for what they do are not the same as normal reasons. In fact, treating them like normal people (e.g., appealing to their better nature, as in "Please have a heart," or giving them the chance to apologize and make amends) will make matters worse with a narcissist. [For general discussion of cognition, affectivity, interpersonal functioning, and impulse control in personality disorders and NPD. It's also interesting to compare these traits below with characteristics of normal six-year-olds.] amoral/conscienceless authoritarian care only about appearances contemptuous critical of others cruel disappointing gift-givers don't recognize own feelings envious and competitive feel entitled flirtatious or seductive grandiose hard to have a good time with hate to live alone hyper-sensitive to criticism impulsive lack sense of humor naive passive pessimistic religious secretive self-contradictory stingy strange work habits unusual eating habits weird sense of time The most telling thing that narcissists do is contradict themselves. They will do this virtually in the same sentence, without even stopping to take a breath. It can be trivial (e.g., about what they want for lunch) or it can be serious (e.g., about whether or not they love you). When you ask them which one they mean, they'll deny ever saying the first one, though it may literally have been only seconds since they said it -- really, how could you think they'd ever have said that? You need to have your head examined! They will contradict FACTS. They will lie to you about things that you did together. They will misquote you to yourself. If you disagree with them, they'll say you're lying, making stuff up, or are crazy. [At this point, if you're like me, you sort of panic and want to talk to anyone who will listen about what is going on: this is a healthy reaction; it's a reality check ("who's the crazy one here?"); that you're confused by the narcissist's contrariness, that you turn to another person to help you keep your bearings, that you know something is seriously wrong and worry that it might be you are all signs that you are not a narcissist]. NOTE: Normal people can behave irrationally under emotional stress -- be confused, deny things they know, get sort of paranoid, want to be babied when they're in pain. But normal people recover pretty much within an hour or two or a day or two, and, with normal people, your expressions of love and concern for their welfare will be taken to heart. They will be stabilized by your emotional and moral support. Not so with narcissists -- the surest way I know of to get a crushing blow to your heart is to tell a narcissist you love her or him. They will respond with a nasty power move, such as telling you to do things entirely their way or else be banished from them for ever.

    from http://www.halcyon.com/jmashmun/npd/traits.html Consider Dembski. Consider Sal. Consider a six-year old. 'nuff said.

    Sir_Toejam · 14 November 2005

    NPD would be considered to be a common psychological disorder amongst sycophants tho, yes?

    limpidense · 14 November 2005

    Some jerk's bragging about cleaning a clock or something. Paley's watch evidently has been found, but in the hands of a gang of desp-p-p-p-picable,vandalism-prone brats the "cleaning" is unlikely to leave even a functioning chronometer, much less evidence of the manufacturer.

    You are a fanatic in very nearly the worst sense of the word, STC. You would have to add the use of violence to your resume to sink lower, and you don't seem the type, unless the victim was helpless and "everyone" put you on the spot and expected you to join in the lynching.

    Worldwide Pants · 14 November 2005

    Salvador,

    I don't remember Dembski qualifying his claims as speculation. Perhaps you could talk him into reposting them so you can point out what I missed.

    Sir_Toejam · 14 November 2005

    desp-p-p-p-picable

    yosemite sam or sylvester? ;)

    You would have to add the use of violence to your resume to sink lower, and you don't seem the type

    hmm. you might want to check his comments on the original "vice strategy" proposed by Dembski several months ago. seems he and many others that kiss BD's feet every day exhibit quite violent tendencies indeed, at least in semi-repressed form. However, their desire to get "darwinism crucified in court" has been granted in Dover, and it ended up backfiring on them quite completely. The extremely limited rationality exhibited by these folks, even when repeatedly demonstrated without reasonable doubt, seems unable to be grasped by them. We used to suggest that folks like that seek professional medical treatment, but then i guess that the tremendous decline in mental health care in the US in the last 20 years has hampered their ability to seek treatment. Perhaps all we really need to end the ID madness is better and more readily available mental health care facilities?

    morbius · 14 November 2005

    Where's the hyperbole? That?s my opinion having read this thread. I'm still allowed to have one of those, at least last time I checked?

    — Tim Haley
    What a pathetic hypocritical strawman. No one said you couldn't have a stupid, false, and offensive opinion -- an opinion voiced as an absurd bit of innuendo:

    Some people on here seem to be of the opinion that "all design hypotheses are bad" and will jump on anyone who suggests otherwise.

    the best way of showing him to be wrong is by actually presenting one's own argument

    — PvM
    You, like Haley and Lutsko, seem to have paid no attention to the arguments that were presented. Rather than addressing substance, you all make out like there's some unthinking dogmatic opposition. This is just like the charge Michael Balter made, and it stinks. Indeed, the best way of showing people they are wrong is to present an argument, not to engage in this ad hominem crap about jumping on people or "level" of response.

    Stephen Elliott · 14 November 2005

    We're cleaing you're clocks in the PR wars

    — Sal T. C.
    Does that make ID any more scientific?

    morbius · 14 November 2005

    I think it's par for the course that someone new who shows up asking questions that seem naive, or uses nomenclature that seems idiosyncratic to regular PT readers, is sort of assumed to have a crypto-ID agenda.

    This is more of the same -- there is no evidence at all that anyone made any such assumption about Lutsko.

    Rilke's Granddaughter · 14 November 2005

    Sal T. C. wrote: We're cleaing you're clocks in the PR wars Does that make ID any more scientific? (Emphasis added.)

    — Stephen Elliott
    No. And the fact that we're cleaning ID's clock in the grammar wars is telling.

    morbius · 14 November 2005

    There may be other errors, but let me restate my general claim that there are reasonable circumstances in which "finding pi in the DNA sequence of a bacterium" could hypothetically be well-defined and would require an explanation not covered by current scientific theory. Until someone "finds pi" (or e, or a list of primes, etc.), this kind of speculation is not very interesting, but it would be disingenuous in the extreme to suggest that such an occurrence would easily be explained by evolutionary theory.

    It's remarkable that one can imagine a crime in their mind and then accuse people of it. Of course it would be disingenuous to suggest that something that is ex hypothesi not explainable by ToE is explainable by ToE, but all we had here is people questioning how one would know that one had found the digits of pi in the genome. In light of such numerological nonsense as "The Bible Code" (which far too many innumerate scientists fall for), you would think that people would be a little more careful about how they express such a thing.

    Sir_Toejam · 14 November 2005

    Morbius: that discussion has moved to the ABC area:

    http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=4378ca781d80427f;act=ST;f=14;t=71

    have fun :)

    Stephen Elliott · 14 November 2005

    No. And the fact that we're cleaning ID's clock in the grammar wars is telling.

    Can I loin in now?

    We're cleaing you're clocks in the PR wars

    I was refraining; but you encouraged me.

    Rilke's Granddaughter · 14 November 2005

    Oh, bother. Missed that one. My bad.

    morbius · 14 November 2005

    Cubist's point was that you could choose the encoding to produce any sequence you like. This criticism isn't entirely unfair since lutsko never defined the encoding, but he suggests incorrectly that there is no sense in which "finding pi in DNA" could be a surprise requiring some kind of explanation.

    No, he did not suggest that. What he said was

    Your proposed test here isn't particularly meaningful. Too much opportunity for cherry-picking, of both the translation protocol and the species whose genome you're gonna use that protocol on.

    His comment doesn't apply if you axiomatically rule out cherry picking:

    Given that, and given the number of such strings you have looked at, given that you are looking specifically for famous transcedental constants and won't make up a post hoc story for anything else you find

    morbius · 14 November 2005

    If the above failed, there would be kind of a glaring anomaly that science would have to note and claim no provisional explanation for. However, no such anomaly is currently known, and in no case would science fill in the lack of provisional explanation with a specific non-scientific belief.

    This is no different from finding precambrian rabbit fossils. But that has never been considered a basis for offering up the sort of strawman innuendo and Lutsko did:

    I therefore do not think it heretical to allow for the possibility that some sort of "design inference" could be justified and I do not think that appeals to authority rule it out.

    Steve S · 14 November 2005

    Salvador has really outdone himself this time.

    R.O. · 14 November 2005

    No. And the fact that we're cleaning ID's clock in the grammar wars is telling.

    You would not know that from Toejam's posts.

    'Rev Dr' Lenny Flank · 14 November 2005

    HiYa Panda's Thubites

    HiYa, Sal. 1. What is the scientific theory of intelligent design, and how do we test it using the scientific method? 2. According to this scientific theory of intelligent design, how old is the earth, and did humans descend from apelike primates or did they not? 3. what, precisely, about "evolution" is any more "materialistic" than weather forecasting, accident investigation, or medicine? 4. do you repudiate the extremist views of the primary funder of the Center for (the Renewal of) Science and Culture, Howard Ahmanson, and if so, why do you keep taking his money anyway? And if you, unlike most other IDers, are not sucking at Ahmanson's teats, I'd still like to know if you repudiate his extremist views. 5. Why are you undermining your own side by proclaiming here that ID is all about defeating "atheism" and "anti-religion", while your side is desperately trying to argue in court that ID has nothing at all whatsoever to do with religion or religious apologetics? Are your fellow IDers just lying under oath when they testify to that, Sal?

    'Rev Dr' Lenny Flank · 14 November 2005

    We're cleaing you're clocks in the PR wars

    I'm sure that will be consolation to all those newly-unemployed school board members in Dover. But then, in a few weeks, we'll see just how, uh, impressed the judge was by ID's PR war. How, exactly, do you market something that is illegal?

    Sir_Toejam · 14 November 2005

    You would not know that from Toejam's posts.

    do you EVER make any substantive contributions to a discussion? pathetic.

    Sir_Toejam · 14 November 2005

    actually, maybe i should be asking somebody else that question, since you never actually answer any questions put to you.

    so, does anybody here know if RO ever contributes substantive input?

    'Rev Dr' Lenny Flank · 14 November 2005

    But his behavior with respect to the deposition puts him at about the level of my favorite Usenet kooks back in the good old days

    Speaking of which, I heard from someone that Ed Conrad was supposedly submitting an amicus brief to the Dover Judge . . . ?

    CJ O'Brien · 14 November 2005

    How, exactly, do you market something that is illegal?

    Psssssst. Hey, buddy. You wanna buy some warmed-over apologetics?

    Tim Hague · 15 November 2005

    You, like Haley and Lutsko, seem to have paid no attention to the arguments that were presented. Rather than addressing substance, you all make out like there's some unthinking dogmatic opposition. This is just like the charge Michael Balter made, and it stinks. Indeed, the best way of showing people they are wrong is to present an argument, not to engage in this ad hominem crap about jumping on people or "level" of response.

    — morbius
    You can't even spell my name right. I have been making points, you have not addressed them. I'll head over to after the bar closes and make them again.

    Sir_Toejam · 15 November 2005

    psst, tim, i'm not one to speak for morbius, but i think the section of his post you quoted refered to what PvM said, not you:

    PvM wrote: the best way of showing him to be wrong is by actually presenting one's own argument

    it was a "multi-addressed" post.

    Tim Hague · 15 November 2005

    Sir_Toejam - thanks for the pointer. I was the 'Tim Haley' he quoted earlier in his post (at least he quoted something I said under the wrong name) and mentioned again later 'Haley and Lutsko'. I've moved over to after the bar closes now. It's a bit more civil over there so far ;)

    Morbius · 15 November 2005

    You can't even spell my name right. I have been making points, you have not addressed them.

    I can, but I didn't -- human error. As for the second sentence, it's sheer hypocrisy.

    Tim Hague · 15 November 2005

    Morbius,

    Which points of yours have I not addressed? You directed a rebuttal at one of three examples I gave for complex sequences in DNA (the one Cubist wrote). I also mentioned two other examples which you have ignored. I happen to disagree with Cubist and I also note that Paul C has written an extensive response to you and Cubist in comment 57217 which neither of you has responded to. As Paul C has expressed the point better than I could, I will leave that issue open until such as time as you get round to addressing it. To use your own words: "Is reading comprehension really that difficult?"

    I can't see anywhere else where you have done anything other than get on your high horse... you also exhibit a tendency to insult everyone you don't agree with, which makes it ironic to see that you are getting upset (boo hoo ad hominems, they're calling me dogmatic) and also ironic that YOU are calling ME a hypocrite.

    ben · 15 November 2005

    Dembski's idea of factual correction:

    Dembski: "2+2 is 5."

    [[Demonstration that 2+2 is clearly 4]]

    Dembski: "I have always said that 2+2 is 4."

    Oceania has always been at war with Eastasia.

    Wayne Francis · 15 November 2005

    What would it mean if scientists found PI in DNA? Does the theory of evolution have an answer to why we might find PI encoded in the DNA? Can we figure out how an Intelligent designer would encode PI into DNA?

    Lets say we have some crazy graduate student that has nothing better to do with his/her time then look for weird sequences in genomes.

    We will call this student Robin.

    Robin decides he/she is hungry and thinks
    "I would really like some apple pie....AH!!!! I've got it! I'll look for PI"

    Next question for Robin should be something like.
    How do I actually look for it?
    Does Robin look for it at the nucleotide level? (base 4)
    Does Robin look for it at the amino acid level? (base 22)

    Depending on which one Robin picks will determine the next step.

    Now some people have given some arbitrary precision of PI to be unlikely. I don't believe that the precision really matters and in practical terms you will see why.
    For simplicity I will use

    3.141592653589793 as my precision. The reason I picked this precision is this is the largest precision I can get PI without loosing precision and not have to spend hours coding.

    Robin thinks "What the hell. I'll look at both the nucleotide level and amino acid level."

    Robin then goes about the work of converting PI into a nucleotide sequence and amino acid sequence.

    First thing Robin realizes is that Robin has to not only look for 1 sequence but 24 actual different sequences. This is because Robin does not actually know what nucleic acid would have what value.
    Is adenine = 0,1,2, or 3?
    Is guanine = 0,1,2, or 3?
    Is cytosine = 0,1,2, or 3?
    Is thymine = 0,1,2, or 3?
    Given that Robin doesn't know Robin is forced to use all 24 combinations.
    This gives Robin the issue of finding the following sequences all of which could be interpreted as PI

    CTACCGGAATAACCACGGGCTGACAG
    TCATTGGAACAATTATGGGTCGATAG
    GTAGGCCAATAAGGAGCCCGTCAGAC
    TGATTCCAAGAATTATCCCTGCATAC
    GCAGGTTAACAAGGAGTTTGCTAGAT
    CGACCTTAAGAACCACTTTCGTACAT
    CTGCCAAGGTGGCCGCAAACTAGCGA
    TCGTTAAGGCGGTTGTAAATCAGTGA
    ATGAACCGGTGGAAGACCCATCGAGC
    TAGTTCCGGAGGTTGTCCCTACGTGC
    ACGAATTGGCGGAAGATTTACTGAGT
    CAGCCTTGGAGGCCGCTTTCATGCGT
    GTCGGAACCTCCGGCGAAAGTACGCA
    TGCTTAACCGCCTTCTAAATGACTCA
    ATCAAGGCCTCCAACAGGGATGCACG
    TACTTGGCCACCTTCTGGGTAGCTCG
    AGCAATTCCGCCAACATTTAGTCACT
    GACGGTTCCACCGGCGTTTGATCGCT
    GCTGGAATTCTTGGTGAAAGCATGTA
    CGTCCAATTGTTCCTCAAACGATCTA
    ACTAAGGTTCTTAATAGGGACGTATG
    CATCCGGTTATTCCTCGGGCAGTCTG
    AGTAACCTTGTTAATACCCAGCTATC
    GATGGCCTTATTGGTGCCCGACTGTC

    Robin thinks "WOW that wasn't as a straight forward search as I thought it would be!"

    Robin then goes about the task of figuring out the amino acid sequences that could equal PI.

    Robin gets a bit of a shock and realizes that again he/she can not rightly assign values to the amino acids thus would have to search for all the possible combinations. With a bit of simple math Robin realizes that there are
    1,124,000,727,777,607,680,000 different sequences that could represent PI at the amino acid level.

    Now the base 22 representation of PI with 16 digits is
    58651B59AFD7
    And because we don't know what amino acid represents what value then Robin's search then become much like the bible codes. With 1,124,000,727,777,607,680,000 different combinations Robin is bound to find it somewhere if Robin could actually do a search on this scale. Until quantum computers become affordable Robin decides to spend his/her time on more worth while endeavors.

    Now even if you wanted to do either of these searches to try to prove your "Intelligent Designer" then you have a problem. The likely hood of finding a sequence of PI to some precision of valuable length is pretty good, just think of real world applications and the precision of PI used for them. Say we will look for PI to 100 digits. What does this mean? Why do you think the "Intelligent Designer" would pick PI to 100 digits? Why couldn't the Intelligent Designer pick 99? If you then searched for 100 you would miss the ID message! Picking a precision is completely arbitrary.

    OK so what does evolution have to say about an organism you find PI in the genome? Well evolution says that we should find signs of PI in closely related organisms around the same location. This does not mean we have to find PI just a sequence in the same area that could have be mutated into PI.

    I'll take one of the, roughly, 1.12 sextillion amino acid sequences that represent PI to 16 digits
    CGQAKCHLSFE or CysGlyGlnAlaLysCysHisLeuSerPheGlu
    What should we look for in the closely related organism? Well there are many different things we would have to look for. Basically all the different mutations that we know can occur to DNA. Let us take a single nucleotide frame shift. There now is 36 different positions where this insertion could have taken place and 4 different values it could have taken. Thus there are 144 different sequences that could bridge the gap just from a single nucleotide frame shift. Maybe it was 2 nucleotides that where added. Maybe it was one removed. Maybe it was and inversion. Maybe this sequence is completely new in one organism due to a retro virus. Maybe the sequence is there exactly. It all depends on the mutations accrued by both populations since the last common ancestor. It in no way is simple but the science of phylogenetic trees is well developed and the data supports common descent.

    Forgive any spelling/grammer errors....it is 3:30am and I'm bad at writing at the best of times.

    BlastfromthePast · 15 November 2005

    Given that, and given the number of such strings you have looked at, given that you are looking specifically for famous transcedental constants and won't make up a post hoc story for anything else you find, given those conditions you can reasonably claim to be surprised at finding pi.

    — PaulC
    I don't have time to read everything that's been written here on this topic of "pi", but, Paul, I think lutsko's point--remembering back to a post of his I happened to read--was that it's impossible to find "pi" in the genetic code....since this requires what you might call boundary conditions. I.e, to go from binary code to the genetic code, you'd have to set up some kind of one-to-one sequence between the one code and the other. And this one-to-one correspondence is, by necessity, arbitrary. So, if you find "pi", then anyone would be right in saying that "pi" is simply due to the arbitrary correspondence that was set-up, and nothing more. In other words, you wanted to find it, and you did. The problem, then, IMHO, is intractable. I just glanced at Wayne Francis' post--just above; but I think he's basically saying the same thing.

    Worldwide Pants · 15 November 2005

    Dembski's idea of factual correction: Dembski: "2+2 is 5." [[Demonstration that 2+2 is clearly 4]] Dembski: "I have always said that 2+2 is 4."

    — ben
    or one of the following: - That paper is outdated. - I address that issue in the following papers: [list of papers that don't address the 2+2 issue] - Why are you so obsessed with me? - That was just street theatrics. - [delete] [delete] [delete]

    BlastfromthePast · 15 November 2005

    To Blast: I think that even Roger Penrose himself would decline your description of THE EMPEROR'S NEW MIND as "incontrovertible." Incontrovertible is a *very* powerful word. It wouldn't even be applied to quantum theory or relativity theory, for instance, even though they are the best experimentally-established theories in the history of physics. It may be applied (carefully!) to certain mathematical proofs, but EMPEROR'S NEW MIND wasn't that. It certainly shouldn't be used for philosophical arguments, which is what ENM was. I'd say that "incontrovertible" is quite possibly the mathematical-logical equivalent of "unfalsifiable."

    — Chris Lawson
    I respectfully submit that this is exactly what I meant. It is "unfalsifiable", meaning that every effort at AI with the hope of its being an authentic equivalent to human thought is consequently doomed to failure. (Artifical limbs mimic normal human function; but it's limited in some degree or another) And, yes, it is a mathematical proof....with philosophical, as well as scientific, implications. When Penrose finished, he should have put Q.E.D. He's brilliant; and he poses the dilemna brilliantly. And if it's Turing Machine and Godel's theorom, then I'm sorry for mixing up the two.

    An algorithm is defined formally as the steps carried out by a Turing Machine. A better question, I think, is what is his definition of the human mind. Of course, he doesn't have one, and so it isn't possible to come to any formal conclusion about its computational power.

    — morbius
    Penrose clearly demonstrates that the human mind is capable of doing things that no Turing Machine could ever do. He doesn't have to define what a human mind is. All he has to do is show that the human mind can do what no algorithm can ever do. It's straight forward.

    Not is only your crystal ball is broken, but so is your browser, or your glasses --- there has already been an extensive discussion addressing her question. You're just yanking our chains, right? Surely no one can be THAT moronic.

    — morbius
    Your above comment comes from Post#57164. Here's Katrina's later post (Post#57215)

    "Katarina Why don't you try to contact Plasterk to get the correct quote and the explanation ? Erik" Thank you Erik. So I did. If anything interesting comes out of it, I will keep you posted. Blast, stay tuned.

    — Katrina
    Would you like to explain why she's still awaiting an explanation? And would you like to apologize for your invective?

    Katarina · 15 November 2005

    Blast,

    1. I do not think Plasterk's quote strengthenes any of ID's arguments. I am merely curious about what he meant by "combinations" causing variation.

    2. Plasterk is an active scientists, busy with producing resaerch, publishing articles, and writing grant proposals. I am sure one e-mail from someone he doesn't know isn't on top of his list. Many people regularly delete e-mails from people they do not know!

    3. What does your challange to PT'ers prove? Why would they be responsible for knowing why Plasterk didn't respond to my e-mail within 24 hours?

    Besides, you have nothing to say about the excellent responses PT'ers have already given to the main part of my inquiry. Read, man.

    Worldwide Pants · 15 November 2005

    Blast,

    Penrose is a physicist, not an expert in computation and formal language theory. If you tell me your understanding of his argument, I'll point out the fallacies.

    BlastfromthePast · 15 November 2005

    Katarina: I've read. I don't consider them anywhere near being excellent. Sorry.

    Penrose is a physicist, not an expert in computation and formal language theory. If you tell me your understanding of his argument, I'll point out the fallacies.

    — Worldwide Pants
    There are no fallacies. His argument is unassailable. If you sincerely feel that there are fallacies, you would be doing Dr. Penrose a favor by pointing them out to him.

    Sir_Toejam · 15 November 2005

    There are no fallacies. His argument is unassailable

    statements like this are why we never take you seriously.

    Worldwide Pants · 15 November 2005

    If you sincerely feel that there are fallacies, you would be doing Dr. Penrose a favor by pointing them out to him.

    — BlastfromthePast
    Unfortunately, dozens have beaten me to the punch. Have you read their rebuttals?

    Sir_Toejam · 15 November 2005

    I'll use my "crystal ball" here.

    no, blast has been repeatedly documented as refusing to read ANYTHING that would burst his little personal worldview bubble. One can quite reasonably assume he refuses to read rebuttals to Penrose as well.

    don't bother.

    Steviepinhead · 15 November 2005

    As best we've been able to discern, Blast has a strict reading regimen: Scientific journal articles--read the abstract only, then quote-mine or misconstrue for anti-evolution insinuations. On no account read the whole article, a difficulty compounded by: Basic evolutionary biology textbooks--refuses to read, would only stir his preconceptions into a tizzy and, besides, are way too intimidating in several other respects. General science books--no more than one a month then, if it resonates with his preconceptions, it's exalted to irrefutable (there's obviously no point in reading refutations which Blast has determined in advance to be clearly-wrong); if it doesn't resonate, then proceed to refutations and

    then quote-mine or misconstrue for anti-evolution insinuations.

    Repeat until thoroughly basted, then serve while still freshly steaming.

    PaulC · 15 November 2005

    Blast wrote:
    I.e, to go from binary code to the genetic code, you'd have to set up some kind of one-to-one sequence between the one code and the other. And this one-to-one correspondence is, by necessity, arbitrary.
    No, it's not arbitrary if you make reasonable restrictions on the mapping, as I did in my long post. In particular, if you interpret individual bases as encoding bits according to a uniform mapping, there are only 14 ways of doing this. If they encode base-4 digits (0-3) then there are 24 ways to do it (all permutations of four elements). You also want to make restrictions about the substring encoding pi, such as requiring it to be contiguous. To say something about the probability of finding pi by chance, you need to make statistical assumptions. The most obvious one (but probably not the most faithful to biology) is to model DNA sequences as strings of letters A,C,T,G chosen uniformly with 1/4 probability. This would allow you to ask a question such as given a uniformly chosen "DNA sequence" of length 1000, what is the probability that it contains a contiguous substring encoding the first 100 digits in the expansion of pi? Even if you are allowed to choose between base 2 encoded any of 14 ways, base 4 encoded any of 24 ways, and accept pi in forward or reverse order, the probability of having the first 100 digits turn up in one chosen sequence is quite small. In short (and this seems like kind of an obvious point), it would be really surprising to "find the first 100 digits of pi" in a study of bacterial DNA for any reasonable definition of that phrase, or in any case any definition that a working scientist would accept. Now if somebody made that claim, probably the first question would be what exactly did they find, because it would be an extraordinary claim requiring extraordinary evidence. If they said it was encoded, but the code is really elaborate, or the strings are not contiguous and follow some complicated series, then you would rightly see if they had engaged in cherry picking. You want to make sure that the explanatory model has fewer degrees of freedom than the observation allegedly being explained. But if, for instance, you stuck to the codes listed above, nobody could seriously accuse you of cherry picking. There are not enough "combinatorial cherries" in these simple codes to substantially increase the probability of getting pi in a random sequence. Actually in the case of pi it's even trickier because you would need to make sure not only that their code had few degrees of freedom, but that the encoding scheme itself did not somehow include an algorithm for calculating pi, since that algorithm might be very compact. Still, the general point is to make sure that it is the DNA and not the encoding scheme that is giving the result.

    Morbius · 15 November 2005

    Would you like to explain why she's still awaiting an explanation? And would you like to apologize for your invective?

    She didn't say she was, and your comments reinforce the justification of "moronic".

    Morbius · 15 November 2005

    Penrose clearly demonstrates that the human mind is capable of doing things that no Turing Machine could ever do. He doesn't have to define what a human mind is. All he has to do is show that the human mind can do what no algorithm can ever do. It's straight forward.

    The human mind can do things no TM can do, because a TM is a mathematical abstraction that cannot affect the physical world. OTOH, a computer, like the human brain, is a physical device. For this reason alone his project fails. There are, however, numerous other problems. Penrose employs Godel's Theorem, but Godel's Theorem only applies to consistent formal systems. As Marvin Minsky has noted, people can construe false ideas to be factual, and thus the process of thinking is not limited to formal logic. Penrose tries to deal with this by asserting that the mathematical community, through its error correcting process (akin to the scientific method), can be assured of eventually establishing the factuality of its statements. But this is at best circular; he certainly can't assure that his statement is factual.

    Morbius · 15 November 2005

    What would it mean if scientists found PI in DNA?

    What would it mean if scientists found precambrian rabbit fossils? Why do we care about pi? We already know that ToE is falsifiable; additional examples of how it might be falsified give us nothing -- they are a red herring in regard to the question of whether ID can be scientifically legitimate, which is the context in which Lutsko raised this.

    Morbius · 15 November 2005

    Picking a precision is completely arbitrary.

    This pertains to the point Cubist made about cherry picking. Finding pi in the genome is not an experiment we carry out, it's just a hypothetical event, and is thus akin to finding bible codes, jesus's face in cheese, and so on. A priori probability calculations aren't relevant, any more than they are relevant when two people at a party discover they share a birthday. What are the odds of that? Wrong question. So, what are the odds that we can find some sequence in some DNA that seems, well, "designed"? Much much higher than the a priori question about 100 digits of pi.

    Wayne Francis · 15 November 2005

    I don't know if people miss understood me so I'll make it more clear.

    Finding PI in some genome means NOTHING. This is because
    1) The number of genomes out in nature is HUGE
    2) That the number of ways PI can be translated into binary code is huge.
    3) The translation we use and the precision we choose is 100% completely arbitrary
    4) In practical terms we don't have the computational power at this time to perform a useless experiment like this

    At the nucleotide level there are 24 different sequences for any value of PI you are looking for.
    At the amino acid level there are 1,124,000,727,777,607,680,000 different sequences that could represent PI

    Finding PI to 1000 digits has no meaning. With 1,124,000,727,777,607,680,000 different combinations that PI could translate to how long do you think it would take to search all the genomes?

    Compound this with the fact that we have no idea what numerical constant an Intelligent Designer would put into the genetic code you would have to be crazy to seriously consider the search.

    Which genome do we search? I guess logically if you think Humans are the pinnacle of the ID's design process then you would search us.

    As far as finding PI as pertained to the theory of evolution. I meant that evolution doesn't really care if PI is in a genome with a precision of 16 digits or 16,000 digits. All evolution is going to say is if you look at closely related species that you should be able to find evidence of a path way from the 2 species LCA that explains the PI in one and the either absence or presence of PI in the other and that there will be at least one pathway that is not lethal to either species.

    Since I'm also not 100% sure about this next part I'll ask the biologist here
    Given the human genome is there any stretch of .....lets say 150 nucleotides or 150 amino acids that is present in all humans that is exactly the same? My understanding is at that level there can be changes that do not effect the proteins being produced significantly. If this is the case then you can not even find PI in every human even if you found the sequence in 1.

    BlastfromthePast · 15 November 2005

    Finding pi in the genome is not an experiment we carry out, it's just a hypothetical event, and is thus akin to finding bible codes, jesus's face in cheese, and so on.

    I wouldn't say it's hypothetical. I would say it's virtually impossible. You could only find it there if you devised a translation of the code that puts it there.

    A priori probability calculations aren't relevant

    This really isn't about a priori calculations, but simply the mathematics of how codes are translated.

    Penrose tries to deal with this by asserting that the mathematical community, through its error correcting process (akin to the scientific method), can be assured of eventually establishing the factuality of its statements. But this is at best circular; he certainly can't assure that his statement is factual.

    I'm not familiar with The Shadows of the Mind. I'm surprised that Penrose would argue this way since Godel's argument was meant to show that mathematics cannot be grounded in itself as a kind of "truth" machine. However, the point that Penrose makes in TENM is about the superiority of the mind to machines. And perhaps there is an over-optimistic appraisal of what the human mind can accomplish. Back to the more original point, to my satisfaction Penrose demonstrates in a formal way that "machine" intelligence not only cannot outdo human intelligence, but that it is more limited. IMHO.

    Blast, 1. I do not think Plasterk's quote strengthenes any of ID's arguments. I am merely curious about what he meant by "combinations" causing variation.

    Katrina: the "combinations" that Plasterk is referring to are undoubtedly "allelic" combinations. I'll presume you know what an allele is. So, he's saying that the phenotypic differences we see between similar organisms come from them simply having a different "combination" of already existing "alleles", and not through mutations of those alleles. (Since most mutations are harmful anyways.) William Bateson, in his critique of Darwinism at the beginning of the 20th century, made this same observation. Genetics tends to be rather conservative, conservative in the sense of keeping what's already there. As to "induced mutations", specifically the "flowers" Erik sent to you, let's note two things: 1. the changes to the genome was "artificially induced". 2. The variations so induced, were "artifically" selected for. That is, both involve the use of INTELLIGENCE. Darwin thought evolution was simply animal breeding written in large letters. But, of course, we've known, and for a long time, that there are barriers to variation that species cannot cross. Which, of course, invalidates Darwin's theory. It's really as simple as that; and even Darwin's bulldog, Thomas Huxley, was discomfitted by the absence of what I call "transpeciation" events. (crossing over from a higher taxonomic group (e.g., "family") to another.)

    'Rev Dr' Lenny Flank · 15 November 2005

    As best we've been able to discern, Blast has a strict reading regimen:

    You forgot the websites written by self-proclaimed "ecological visionaries". (snicker) (giggle)

    Wayne Francis · 15 November 2005

    Wooops
    2) That the number of ways PI can be translated into binary code is huge.
    above should read
    2) That the number of ways PI can be translated into genetic code is huge.

    Sir_Toejam · 15 November 2005

    Wayne, did you post your excellent analysis over here:

    http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=437a4af9d5ed11f5;act=ST;f=14;t=71

    I think that might finally convince lutsko.

    Sir_Toejam · 15 November 2005

    Darwin thought evolution was simply animal breeding written in large letters. But, of course, we've known, and for a long time, that there are barriers to variation that species cannot cross. Which, of course, invalidates Darwin's theory. It's really as simple as that

    I'm laughing at you Blast. ready to tell us why you continue posting here yet? it seems such a simple question, yet you haven't ever answered it.

    Sir_Toejam · 15 November 2005

    You could only find it there if you devised a translation of the code that puts it there.

    It's... the DAVINCI CODE! (play scary music)

    Sir_Toejam · 15 November 2005

    to my satisfaction Penrose demonstrates

    there's that vaunted opinion of your's again, Blast. I thought you said earlier his conclusions were completely unassailable? getting ready to qualify that now? and when those that actually feel the need to, do your work for you and read you the relevant critiques of Penrose that you yourself seem incapable of doing, will you qualify your assesment of Penrose's unassalable genius yet again? amazing.

    Sir_Toejam · 15 November 2005

    Ok I'm done Blast bashing now.

    please note that I am not objecting to anyone who actually wishes to argue with him, but i do wonder what the point is when he keeps repeating the same level of ignorance and laziness in his thinking over and over and over again.

    it gets so tiresome.

    'Rev Dr' Lenny Flank · 15 November 2005

    But, of course, we've known, and for a long time, that there are barriers to variation that species cannot cross.

    What barriers. How do they work. Is this going to be anything like your "snake genes" fiasco, Blast? (sigh) Ya know, even an EARTHWORM is capable of learning, after several experiences, to avoid painful situations. . . . .

    Steviepinhead · 15 November 2005

    As Lenny correctly reminded the pinhead:

    You forgot the websites written by self-proclaimed "ecological visionaries".

    Oops, my bad. No pizza for me tonight! I also forgot that Blast predictably attempts to find something to read up on about the various scientists and species that he has first learned of from Lenny's posts. Of course, if Blast did any advance research before he expostulated, he could save himself the hurried catch-up. But then, if Blast's reading regime were sensible, he wouldn't be nearly as entertaining as he is. And Blast's painfully-public refusal to learn continues, ironically, to provide a nationwide audience with the opportunity to obtain a considerable evolutionary education.

    BlastfromthePast · 15 November 2005

    No, it's not arbitrary if you make reasonable restrictions on the mapping, as I did in my long post. In particular, if you interpret individual bases as encoding bits according to a uniform mapping, there are only 14 ways of doing this. If they encode base-4 digits (0-3) then there are 24 ways to do it (all permutations of four elements). You also want to make restrictions about the substring encoding pi, such as requiring it to be contiguous.

    But, note this, your decision to encode using base-4 digits is itself arbitrary. Why not have a conversion to base-2, or base-10? And, of course, your restriction about being "contiguous" is also arbitrary. Why not look for a sequence where the numbers are separated by a comma. (Then, of course, you'd have to include a coding system for commas!) In nature, you have different coding systems. The coding system for nuclear DNA is different for that of mitochondrial DNA, for example. But what this demonstrates is that in nature there is a (more or less) one-to-one correspondence between amino acids and different sequences of 3 nucleotides. This isn't arbitrary. This is nature. It's a settled question there. When we come along, we're entirely free to set up any rules we want. Thus, if someone wanted to "reverse engineer" a particular (conserved) sequence into PI, then you could simply try different formulations of what digit corresponded to what given sequence, search genomes for the DNA sequence that results from the "reverse engineering", find some that are close, and then iterate yourself to the final answer. I'm not sure that this is possible to do. But if it were, it would certainly be arbitrary.

    Sir_Toejam · 15 November 2005

    And Blast's painfully-public refusal to learn continues, ironically, to provide a nationwide audience with the opportunity to obtain a considerable evolutionary education.

    *sigh* point taken. still bugs me tho.

    Sir_Toejam · 15 November 2005

    your decision to encode using base-4 digits is itself arbitrary

    sorry i can't resist: BWAHAHAHAHHAHAHHAHHAHAHHAAHHAHAHHAHAHAHAHHHAHAAAAAA *breath* HAHHAHHHAHHAHHAHHAHAHHAHAHHAHAHHAHAHHAHAHAHAHAHHAH *GASP*

    Katarina · 15 November 2005

    Blast,

    Thanks for answering my question. I believe that is what was meant.

    I don't know, but maybe mutations resulting in variation is more obvious and directly observed in single-celled organisms than in multicellular ones. When you don't know the answer to a question though, maybe it's easiest to invoke ID.

    BlastfromthePast · 15 November 2005

    What barriers. How do they work.

    As I've said before, when you can turn a cat into a dog using artifical selection, then I'm a Darwinian for life! But, if not.....

    ready to tell us why you continue posting here yet? it seems such a simple question, yet you haven't ever answered it.

    I keep waiting for somebody to give me a good explanation of what I see are errors in Darwinian theory. I won't get that at Uncommon Descent. And you guys need a fly in the ointment.....you guys have a tendency (completely natural, of course) to revel in the "correctness" of your thinking. That's never good. Like I said, you need a fly in the ointment.

    there's that vaunted opinion of your's again, Blast. I thought you said earlier his conclusions were completely unassailable?

    The critics are wrong. I was trying a bit of magnanimity. Silly me.

    BlastfromthePast · 15 November 2005

    I don't know, but maybe mutations resulting in variation is more obvious and directly observed in single-celled organisms than in multicellular ones.

    Katrina, there was a paper recently out about bacteria (I think that's what you have in mind when you say single-celled organisms) which was reporting that 20% of every bacterial genome is constantly changing! In other words 20% of the genome is constantly "mutating", and no real change takes place: they're just bacteria. So, you can see, that if 20% is constantly changing and nothing really changes, then some simple "point" mutation--that is, a single nucleotide change, in all probability, wouldn't show any change at all. About ID: ID doesn't say we can't understand biological complexity, so let's just say God did it. It says that the molecular biology of the cell, especially the genome, is so complex, that it shows every evidence of being "designed." So rather than approaching biology with the (Darwinian) idea of "random" variation, let's approach it with the idea that some kind of intelligence designed it, and let that idea guide the thinking of biologists--and others--in their laboratories. So, don't believe everything you hear about ID. And again, for the umpteenth time, I don't consider myself that wedded to ID. It's just one way of pointing out the insufficiency of Darwinian theory.

    Katarina · 15 November 2005

    Blast,

    I am not that knowledgable myself, but I trust the consensus of the National Acadamies of Sciences. Why don't you?

    'Rev Dr' Lenny Flank · 15 November 2005

    I was trying a bit of magnanimity. Silly me.

    You don't have it in you, Blast. (shrug) Now then, what is this barrier, and how does it work? Are you going to make me ask you a dozen times before you cut-and-paste an answer from some website somewhere that you're too stupid to understand yourself? Just like the "snake genes" thingie? How many times do you need to sit on a stove before you understand that it burns your ass, Blast?

    'Rev Dr' Lenny Flank · 15 November 2005

    And again, for the umpteenth time, I don't consider myself that wedded to ID. It's just one way of pointing out the insufficiency of Darwinian theory.

    Based on your, uh, vast experience and knowledge, huh Blast? (snicker) (giggle)

    Sir_Toejam · 15 November 2005

    I keep waiting for somebody to give me a good explanation of what I see are errors in Darwinian theory.

    liar. we've done this many times, and others have done it before us, and put it print, and in peer reviewed journals. you just can't be honest, can you. do remember that when i originally challenged you to post your reasons, i stipulated that you must be honest about it.

    BlastfromthePast · 15 November 2005

    sorry i can't resist:

    Honestly, what's so funny?

    Steviepinhead · 15 November 2005

    Blast fizzles along:

    I don't consider myself that wedded to ID.

    Not to worry, Blast. That would certainly be an infertile cross. And, don't bother repeating yourself--I'll do it for you:

    Honestly, what's so funny?

    Sir_Toejam · 15 November 2005

    you need a fly in the ointment

    lol. you're not a fly in the ointment, you're a clown in the ring! if you were a fly in the ointment, occassionally you might actually bring up a valid point. I've been watching your posts for months now, and have yet to see one. not even one. even when we actually TRIED to help you make one (refer back to the discussion about front-loading and the evolution of snake venom we had). or here, when Katarina is being so patient with you. you are still failing to make any valid points. dumb as a fly, maybe.. but fly in the ointment? hardly. otoh, as lenny points out, since even earthworms can learn, i think i might be insulting flies everywhere in by using the comparison. oh well. In fact, it's not your vapidity that vexes me so, Blast, it's your utter dishonesty and inability to actually ASK questions, rather than, er, "Blast" your nonsense as if we had no clue and you are educating all of us. again, if you can't answer my simple question to you honestly here, i doubt you can even answer it for yourself, but it's my fault for expecting the answer to any question posed to you of any type to actually be answered honestly by you. i retract my offer and my question.

    Sir_Toejam · 15 November 2005

    Honestly, what's so funny?

    you're kidding, right? encode base-4 digits (0-3) a c g t now do you see why blast saying that choice was arbitrary is funny?

    BlastfromthePast · 15 November 2005

    liar. we've done this many times, and others have done it before us, and put it print, and in peer reviewed journals. you just can't be honest, can you.

    So now you add slander to invective? I'm being honest. If I thought your explanations were good, I'd agree with you, wouldn't I. So, obviously, I would be a liar if I thought your arguments were sound and acted otherwise. Isn't that just straightforward. BTW, is your argument an argument from authority?

    I've been watching your posts for months now, and have yet to see one. not even one. even when we actually TRIED to help you make one (refer back to the discussion about front-loading and the evolution of snake venom we had). or here, when Katarina is being so patient with you. you are still failing to make any valid points.

    You're flippant and bragadocious. Did you happen to read this post by Katrina (#57930):

    Blast, Thanks for answering my question. I believe that is what was meant.

    — Katrina
    And then there's this smugness on your part:

    you're kidding, right? encode base-4 digits (0-3) a c g t now do you see why blast saying that choice was arbitrary is funny?

    You're kidding right??? How about this: a= 0 c= 1 g= 2 t= , (comma) This is to base-3, separated by commas. How about this: aa= 0 ac= 1 ag= 2 at= 3 cc= 4 ca= 5 cg= 6 ct= 7 This is to base-8 (0-7). Do you see how simple it is to invent a code? Would you like to apologize now?

    Erik · 15 November 2005

    Blast

    I appreciate your interest in Katarina's efforts. You're wondering why Katarina have not yet heard from Plasterk.

    Actually, you can help her. When you pass by your library, just obtain this article

    Plasterk, R. 1996. Signaal (column). Intermediair, 25 oktober, p. 28.

    and reproduce the quote to us, so we can get the full context.

    As you know from reading de Jongs "paper", this is where Plasterk's quote is found. Actually "Intermediair" seems to be a business magazine. Plasterk is a leading expert on induced mutations and has a comprehensive scientific publication list, from at least 20 years of research.
    So it's perfectly natural to cite from a business magazine, or ....

    I look forward to see the result of your search within the next 24 hours

    Erik

    BlastfromthePast · 15 November 2005

    How about this from Steve Abram's Op-Ed piece:

    So instead of participating in the science hearings before a state board subcommittee and presenting testimony about evolution, they stood out in the hall and talked to the media about how the Ph.D. scientists who are presenting testimony about the criticisms "aren't really scientists" and that "they really don't know anything." Instead of discussing the issues of evolution, noisy critics go into attack mode and do a character assassination of anyone who happens to believe that evolution should actually be subject to critical analysis.

    (My emphasis) This all sounds familiar, doesn't it?

    BlastfromthePast · 15 November 2005

    As you know from reading de Jongs "paper", this is where Plasterk's quote is found. Actually "Intermediair" seems to be a business magazine. Plasterk is a leading expert on induced mutations and has a comprehensive scientific publication list, from at least 20 years of research. So it's perfectly natural to cite from a business magazine, or .... I look forward to see the result of your search within the next 24 hours Erik

    Have you noticed that I've already answered her question, Erik? She had a question about what Plasterk meant. I answered it. Simple as that. I don't have an interest in pursuing it any farther than that. If you do, then please go ahead.

    k.e. · 15 November 2005

    Just in case anyone has any doubt about blasts argument from ignorance and why he refuses to engage in logical thought and building a personal sanity based on the collected wisdom of man, both scientific and theological

    This will help

    http://hannes.domainplanet.at/fusi/BunnySuicide/Bunny%20suicides.html

    Wayne Francis · 16 November 2005

    Comment # 57944

    Comment #57944 Posted by BlastfromthePast on November 15, 2005 09:35 PM (e) (s) ... Katrina, there was a paper recently out about bacteria (I think that's what you have in mind when you say single-celled organisms) which was reporting that 20% of every bacterial genome is constantly changing! In other words 20% of the genome is constantly "mutating", and no real change takes place: they're just bacteria. So, you can see, that if 20% is constantly changing and nothing really changes, then some simple "point" mutation---that is, a single nucleotide change, in all probability, wouldn't show any change at all ...

    — BlastfromthePast
    Umm Blast all that says is that about that is that 20% of the DNA may have little to no effect, that we know of, in many species of bacteria. Saying "they're just bacteria." is not the same as "they are just the same species of bacteria". I'm sure we can find 20% of one species DNA to change that will easily qualify said bacteria as a new species bacteria. "a single nucleotide change, in all probability, wouldn't show any change at all" Umm Blast you left something out a single nucleotide change in many organism wouldn't show any change at all as many changes are neutral. Also if you are talking about regions of DNA that have end result with respect to the organism, as many retroviruses are, then it is not surprising. Much to your disappointment we have seen a single nucleotide change in a bacteria that produced a new species. You just choose to ignore the facts of the bacteria that can metabolize nylon and try to claim it was "front loaded" but as that and your stupid claim that snake venom is front loaded shows that your "front loaded" only means that a DNA sequence can be mutated from one to the other via natural causes. I'm sure in a few years we'll be able to provide a nice pathway from the LCA of Chimps and humans. Including our chromosome fusion event, breaking of the vitamin C gene, etc. Comment # 57985

    Comment #57985 Posted by BlastfromthePast on November 15, 2005 11:10 PM (e) (s) liar. we've done this many times, and others have done it before us, and put it print, and in peer reviewed journals. ... How about this: a= 0 c= 1 g= 2 t= , (comma) This is to base-3, separated by commas. How about this: aa= 0 ac= 1 ag= 2 at= 3 cc= 4 ca= 5 cg= 6 ct= 7 This is to base-8 (0-7). Do you see how simple it is to invent a code? Would you like to apologize now?

    — BlastfromthePast
    Blast what use is the ","? When applying Occam's Razor one should not increase, beyond what is necessary, the number of entities required to explain anything. what does the "," explain in your first translation? Why would we assume that a ID would put in commas? Occam's Razor say we should go for the most simple explanation which for DNA is that the base 4 nucleotide equates to values 0 to 3. The only thing we can't tell is what nucleotide corresponds to which value. Thus we have to search for 24 different sequences for any value we are searching for. Your example of aa= 0 ac= 1 ag= 2 at= 3 cc= 4 ca= 5 cg= 6 ct= 7 leaves out a lot. What about gg,ga,gc,gt,tt,ta,tc,tg? What you've effectively said is now we are working in Hexadecimal. Which means ever sequence we look for now has 20,922,789,888,000 different possible combinations that would match. Again Occam's Razor would suggest that this is not the way to go. I do agree with you that it is arbitrary but the arguments you make are very lacking in logical terms. Its like saying "Only A and C matter and the ID wants us to ignore T and G" There is no reason for us to think that if a ID put in PI into the DNA that they would make things any more difficult then they needed to. This means that we have the 24 different choices to make. Base 4 is as simple as we can make it without making unfounded assumptions even then we are left with 24 different searches. Truly the only way I could see this working, in favor of those that claim PI in DNA = ID, is if from the first nucleotide of every gene of every living organism we found the same sequence that = PI or the first 100 primes. That would be truly amazing because evolution would not predict that level of conservation within every genome.

    Worldwide Pants · 16 November 2005

    The critics are wrong.

    — Blast
    Which critics have you read, Blast?

    Cubist · 16 November 2005

    Ahem. This has already been refuted by Cubist in #57008. Like Lutsko, you seem to live in your own little mental world, not bothering to pay any attention to the counterarguments that people have posted.

    — paulc, in post 57217,
    Cubist's point was that you could choose the encoding to produce any sequence you like. This criticism isn't entirely unfair since lutsko never defined the encoding, but he suggests incorrectly that there is no sense in which "finding pi in DNA" could be a surprise requiring some kind of explanation.

    Beggin' yer pardon, Paul, but I was responding to lutsko's specific claim: Namely, that it would be significant if we found a stretch of DNA which encoded 100 binary digits of pi. And no, someone's finding 100 binary digits of pi encoded into DNA would not be significant if the specific nucleotide-to-bits translation protocol they used was not defined ahead of time. In the case of a translation protocol that was selected after the fact, how could anyone tell whether or not that protocol had been cherry-picked to yield the desired result? Thus, if you want your discovery of 100 nucleotide-encoded bits of pi to be taken seriously, you simply have to nail down, ahead of time, exactly which translation protocol you're using.

    ...given the number of such strings you have looked at, given that you are looking specifically for famous transcedental constants and won't make up a post hoc story for anything else you find, given those conditions you can reasonably claim to be surprised at finding pi.

    — paulc, in post 57217,
    Not necessarily, Paul. Given a nucleotide-to-bits translation protocol that is capable of yielding 100 binary digits of pi when used on a 50-nucleotide sequence, there will necessarily be some nonzero probability of that protocol yielding pi-to-100-bits when you apply it to any arbitrary 50-nucleotide sequence, right? Okay, so how many 50-nucleotide sequences are you going to use your protocol on? If the probability of any one 50-nucleotide sequence yielding pi-to-100-bits is P, the probability that the sequence in question won't yield pi-to-100-bits is, therefore, (1-p). Given two 50-nucleotide sequences, the chance that neither one will yield pi-to-100-bits is (1-p)^2; for three such sequences, the chance is (1-p)^4; for seven, the chance is (1-p)^7; and so on. Given a stretch of 'junk DNA' which is 1,000,000 nucleotides long, that stretch of 'junk DNA' contains 999,951 distinct 50-nucleotide sequences (#s 1-50; #s 2-51; etc all the way up to #s 999,950-999,999 and, finally, #s 999,951-1,000,000). And, therefore, the chance of not finding pi-to-100-bits anywhere at all within those million nucleotides is (1-P)^999,951. And, therefore, the chance of finding pi-to-100-bits within those million nucleotides, would be 1-((1-P)^999,951). Now, I have no idea what the value of P is in that expression. But, just for illustrative purposes, let's say that P equals a literal one-in-a-million chance, okay? In that case, 1-((1-P)^999,951) = .632 -- that is, given a one-million-nucleotide sequence, the chance that any particular 50-nucleotide stretch of the whole sequence will posses any particular one-in-a-million quality is a little less than two-thirds! If we assume P to be one-in-a-billion, 1-((1-P)^999,951) works out to a sliver under .001; thus, there's a tenth of a percent chance of a billion-to-one longshot showing up somewhere within that million-nucleotide sequence. And how many nucleotides long did you say was the section of DNA you were going to examine..? For me, the conclusion is clear: No, it wouldn't be all that significant if someone discovered pi-to-100-bits encoded into a 50-nucleotide stretch of 'junk DNA'. Rather, such a discovery would be nothing more than playing 'Bible Code' with nucleotides. Personally, I'm willing to buy the idea that a sufficiently bizarre/interesting DNA sequence might be evidence of Design -- I just don't think "it translates to 100 bits of pi" is all that interesting. Maybe 1,000 bits of pi might be worth fussing over; maybe not. [shrug] I dunno... care to do a bit of probability analysis to determine how many digits of pi would be worth fussing over?

    Tim Hague · 16 November 2005

    As I've said before, when you can turn a cat into a dog using artifical selection, then I'm a Darwinian for life! But, if not.....

    — BlastFromThePast
    I'm sure you must have had this discussion before on here Blast... anyway: Did you mean natural selection rather than artificial selection? Either way, 'turning a cat into a dog' is not something that can be done by selection, either type. While both cats and dogs are carnivores (in the order Carnivora) they are in completely different suborders. Evolution doesn't say that you can turn a cat into a dog. Evolution says that - at some point in the distant past - dogs and cats had a common ancestor. Over time that common ancestor diverged into two different species, one which became more dog like and one which became more cat like, and these sub-species also then diverged to give us the dogs and cats (and all other creatures in the order Carnivora) we have today. If you could live long enough (millions of years) and had enough patience and had a suitably primitive starting 'ancestor' you could try to use 'artificial' selection to get a similar result. You still wouldn't end up with dogs and cats though, although you might end up with something similar. For example see the Thylacine, sometimes called the tasmanian tiger, which looks a lot like a wolf but is actually a marsupial - i.e. even though it looks like a wolf it is even more distantly related to a wolf than a cat is.

    'Rev Dr' Lenny Flank · 16 November 2005

    This all sounds familiar, doesn't it?

    Yep. Same old "help help I'm being repressed!" baloney that we've heard from pseudo-scientists for centuries now. (shrug)

    Tim Hague · 16 November 2005

    I do like that quote on your website Lenny (site is excellent by the way):

    "We've been attacked by the intelligent, educated segment of the culture." ----- Ray Mummert, creationist from Dover, Pennsylvania, 2005

    BlastfromthePast · 16 November 2005

    Umm Blast all that says is that about that is that 20% of the DNA may have little to no effect, that we know of, in many species of bacteria.

    This is the kind of ad hoc hypothesis that makes neo-Darwinism unfalsifiable.

    Saying "they're just bacteria." is not the same as "they are just the same species of bacteria". I'm sure we can find 20% of one species DNA to change that will easily qualify said bacteria as a new species bacteria....... Much to your disappointment we have seen a single nucleotide change in a bacteria that produced a new species.

    If my memory serves me, the same article said that their results threw into question the whole idea of whether or not you can talk about "species" of bacteria at all.

    Blast what use is the ","? When applying Occam's Razor one should not increase, beyond what is necessary, the number of entities required to explain anything. what does the "," explain in your first translation? Why would we assume that a ID would put in commas?

    If you had followed my argument about PI, you would have seen that I was basically arguing that PI in the genome is, and can ONLY be, an arbitrary action by someone intent on finding it there in the first place. The particular point I was making, via the examples I used, was, as you AGREE, that the system of translation chosen is completely arbitrary. Of course, base-4 is the most logical starting point. But what if, using base-4, you can't locate PI? Well, maybe you'll switch to base-3 with a comma, or to base-7, or whatever. Again, PI can only be found using arbitrary conventions, not like nature, which is bound by the one-to-one correspondence it's set up.

    Which critics have you read, Blast?

    There's no reason for me to read the critics, as I consider Penrose's argument to be unassailable. If you have read some of these criticisms and can suggest what you consider to be the best of them, I'll be happy to give it a look-see.

    Evolution doesn't say that you can turn a cat into a dog. Evolution says that - at some point in the distant past - dogs and cats had a common ancestor. Over time that common ancestor diverged into two different species, one which became more dog like and one which became more cat like, and these sub-species also then diverged to give us the dogs and cats (and all other creatures in the order Carnivora) we have today.

    Firstly, in response to what you said before this quote, if it weren't for artificial selection, there likely wouldn't be dogs, just wolves. So, let's not sell artifical selection short compared to NS. Secondly, let's assume that you are able to turn a cat into a dog. Let's suppose it takes hundreds of generations, an on-going experiment left to your disicples. As you're going along, either you or one of your disciples, notice these dog-like qualities in the off-spring in one of the generations your line of in-breeding has produced. So you choose two of these off-spring to mate. You leave the other two or three alone. The two that mate, eventually form the line that leads, successfully, to a dog. The other three of the litter are left to breed with no artificial selection taking place. These very quickly regress back into being normal, everyday cats. Looking back on this "experiment", I am completely justified in saying that, "at some point in the distant past - dogs and cats had a common ancestor. Over time that common ancestor diverged into two different species, one which became more dog like and one which became more cat like, and these sub-species also then diverged to give us the dogs and cats". So, this is completely do-able according to Darwinian theory. I, like Huxley, await.

    BlastfromthePast · 16 November 2005

    Just in case anyone has any doubt about blasts argument from ignorance and why he refuses to engage in logical thought and building a personal sanity based on the collected wisdom of man, both scientific and theological

    Invective and ad hominems......... How truly scientific and theological of you.

    PaulC · 16 November 2005

    Let me go back to basics first. You can make claims of finding patterns in nature without your claims always being dismissed as cherry picking. This is not always an easy thing to do, but if you could not ever do it, then science would be impossible.
    Beggin' yer pardon, Paul, but I was responding to lutsko's specific claim: Namely, that it would be significant if we found a stretch of DNA which encoded 100 binary digits of pi. And no, someone's finding 100 binary digits of pi encoded into DNA would not be significant if the specific nucleotide-to-bits translation protocol they used was not defined ahead of time. In the case of a translation protocol that was selected after the fact, how could anyone tell whether or not that protocol had been cherry-picked to yield the desired result? Thus, if you want your discovery of 100 nucleotide-encoded bits of pi to be taken seriously, you simply have to nail down, ahead of time, exactly which translation protocol you're using.
    I agree that 100 bits (about 10^30 possibilities) isn't really enough to make a big deal over. That's why I left the variables open in my example. My point, and I apologize if it's not a response to your claim, was that there is a range of values for n bits inspected, length m of contiguous pi prefix found, and length k of encoding window for which the result would be surprising and would require some explanation other than chance. This would be significant even if the translation protocol was not specified ahead of time, provided that the protocol is taken from a small enough family of protocols, such as the 14 ways of interpreting single nucleotides as bits. In fact, the family of protocols is implicitly specified ahead of time, since no scientist is going to take your claim seriously if it's clear that you are choosing a kind of protocol complicated enough to claim to "find" anything you want. For instance, if you said you were using windows of 4 nucleotides and mapping them to bits according to some function, then your claim would be pretty meaningless since there are 128 possible combinations and you could find long substrings that don't repeat these combinations, which would allow you to assign the encoding table to decode that substring into anything you want. The problem here is trying to describe this event as "finding pi." The thing that would make the find significant is not that it's pi but any highly compressible string (in the sense of low Kolmogorov complexity) not explained by a known process and without any plausible contribution to fitness. E.g., a repeating sequence is highly compressible, but these are found in DNA as I understand it, and can be explained in terms of the copying process. The part about the encoding scheme is a red herring if you treat this in terms of compressibility. Suppose you find a long substring in the DNA that can be generated by a much shorter sequence of computer code (to rule out cherry picking, it runs on a particular universal machine chosen ahead of time). This substring is significant in a rigorous sense if it is sufficiently long and is not explained by chance or by cherry picking. If it's a repeat sequence, then it's explained by known processes and not an interesting new find. But among the things it could be is an encoding of pi according to a simple protocol. I.e., you can write a short computer program to find as much of the expansion of pi you like and output it applying some simple encoding from digits to nucleotides. Note that the shortness of the code itself is what rules out cherry picking. If the only way to "find pi" is to develop a complicated encoding table aimed at producing it, then the complexity of the encoding would be reflected in the computer program. There's nothing special about pi; the above test would also indicate that the expansion of e is significant, that the consecutive primes are significant, etc. It cannot be restated enough that you need more than compressibility to make your substring interesting; repeat strings are common but not interesting because we can explain them. It's also worth noting that this test would miss many interesting substrings such as genes encoding new and useful proteins, since these are not highly compressible. I am not suggesting the above as a serious research program, since I doubt it would turn up anything. But it would be a rigorous test for patterns in DNA that were not explainable by evolution. My point, to summarize, is that there are rigorous tests for the general class of thought experiments including "finding pi" and that it is possible to choose your test in a way that rules out objections of cherry picking.

    k.e. · 16 November 2005

    Good one Blast, but its too late they found the bones.
    By the way you left out the most important part of my quote.

    Tim Hague · 16 November 2005

    Firstly, in response to what you said before this quote, if it weren't for artificial selection, there likely wouldn't be dogs, just wolves. So, let's not sell artifical selection short compared to NS.

    — BlastFromThePast
    I wasn't sure if you mean natural or artificial selection which is why I asked the question.

    Secondly, let's assume that you are able to turn a cat into a dog. Let's suppose it takes hundreds of generations, an on-going experiment left to your disicples. [leaving out the details...] Looking back on this "experiment", I am completely justified in saying that, "at some point in the distant past - dogs and cats had a common ancestor. Over time that common ancestor diverged into two different species, one which became more dog like and one which became more cat like, and these sub-species also then diverged to give us the dogs and cats".

    Well there are some problems with this. First is the assumption you make "let's assume that you are able to turn a cat into a dog". You see, the problem with your assumption is that cats and dogs are both fully modern creatures, that descended from a less specialised ancestor. Even assuming that we breed cats for milennia, we need to see dog-like characteristics appearing through mutation, in order to select on them. Because mutation is random there is no guarantee we would get such mutations. We would also have to apply selection pressures to the population (so any mutations we do get become fixed) and ensure a spare ecological niche for them to evolve into (we'd probably have to wipe out the dogs for this). Assuming we get mutations that have dog-like characteristics we could eventually get to a cat descendent that looked and behaved like a dog. It wouldn't however be a dog, because genetically it would be different from the original dogs, and almost certainly wouldn't be able to breed with the original dogs. You would basically end up with dog-like cats and not dogs. Also, by this time, the original dogs (if we didn't wipe them out, or out-compete them with our cats) would also have been evolving and could be quite different themselves. So, I'm not quite sure exactly what this experiment would prove. I've already pointed out another dog-like animal (Thylacine, sadly now extinct) which has a common ancestor with a kangaroo. So you had two 'types' of dogs - one which shares a common ancestor with a cat, and one which shared a common ancestor with a kangaroo. If you like, the experiment 'can I get from two different sources to something that looks like a dog' has already been done.

    So, this is completely do-able according to Darwinian theory. I, like Huxley, await.

    I think this has already been done, and I don't have a spare few million years at the moment to repeat it!

    PaulC · 16 November 2005

    Erratum: "n bits inspected, length m of contiguous pi prefix ..." should be "m nucleotides inspected, length n of contiguous pi prefix ..." to be consistent with my original formulation.

    There are probably some other errors.

    PaulC · 16 November 2005

    Blast: To begin with, scientists don't commonly speak of having "disciples." They have students, colleagues, assistants, and other collaborators, none of whom are called disciples. And spare me the "Webster's defense" that disciple is synonymous to student, because you know very well (if you have any ear for language) that it's a provocative word suggesting a follower of a religious belief.

    Second, you seem to be very confused about evolution. Evolution says that cats and dogs have a common ancestral species that existed at some time in the distant past, and that there are plausible pathways (involving natural and artificial selection) from that ancestral species to the modern domesticated species.

    It does not say that there is any plausible pathway from the cat or dog back to the ancestral species. Selection events don't work in reverse.

    It does not say that any individual of the ancestral species is now living. I.e., if you could do a "Jurassic Park" and get an individual of that species, it would probably not be able to breed with an individual of any modern species.

    Therefore, one cannot conclude that there is a plausible pathway from cat to dog. Why? Well, the first pathway that comes to mind is back to the ancestor and forward to the other species. But we know that the reverse of a plausible pathway is not necessarily plausible. Indeed it is as implausible as the reverse of any other complex event such shattering a vase; much of the information about the ancestor has been lost. We may find more to like in a kitten than in a broken vase, but both are the result of thermodynamically irreversible events.

    No other cat-to-dog pathway is predicted by evolution either. The only pathways that must exist according to evolution are the ones going forward from an ancestor.

    Note that under certain environmental conditions, it's conceivable that a cat or dog population would produce a new species with a phenotype and behavioral niche similar to their ancestral species. However, the likelihood that it would be the same species--i.e., capable of breeding with an ancestral individual--is vanishingly small. Evolutionary processes will introduce many chance differences if these differences are independent of fitness. These differences cannot be miraculously reversed to go back to the ancestral species or somehow directed to make it possible to breed with some other unrelated species.

    Likewise, you could conceivably breed cats for dog-like characteristics, but whatever the result of your efforts, the probability is vanishingly small that it would be a member of the dog species--i.e., able to breed with dogs.

    Worldwide Pants · 16 November 2005

    and even Darwin's bulldog, Thomas Huxley, was discomfitted by the absence of what I call "transpeciation" events.

    — Blast
    Even Thomas Huxley, that unimpeachable authority on the subject? Guess what, Blast? Today's biology undergrads know far more about evolutionary theory than Huxley did. It's called progress.

    Worldwide Pants · 16 November 2005

    Apology to Blast: My previous post was snarky and uncalled for. Sorry.

    I'll come up with a short list of rebuttals to Penrose for you.

    (BTW, I love Penrose's books. As a non-physicist, I think The Road to Reality is the best and most demanding pop physics book out there.)

    'Rev Dr' Lenny Flank · 16 November 2005

    Which critics have you read, Blast?

    There's no reason for me to read the critics

    Well, that about sums up Blast in a nutshell, doesn't it? (shrug)

    Anton Mates · 16 November 2005

    Katrina, there was a paper recently out about bacteria (I think that's what you have in mind when you say single-celled organisms) which was reporting that 20% of every bacterial genome is constantly changing! In other words 20% of the genome is constantly "mutating", and no real change takes place: they're just bacteria. So, you can see, that if 20% is constantly changing and nothing really changes, then some simple "point" mutation---that is, a single nucleotide change, in all probability, wouldn't show any change at all.

    On the other hand, sometimes a relatively small number of mutations take you from a nice lady in Maryland to a free-living unicellular lineage. Are Homo sapiens and Helacyton gartleri the same "kind?"

    'Rev Dr' Lenny Flank · 16 November 2005

    Apology to Blast: My previous post was snarky and uncalled for. Sorry.

    No it wasn't -- it was right to the point. ID/creationists in general, and Blast in particular, seem to have some sort of silly penchant for 100-year-old science, which they attempt to depict as if it were modern state of the art. Don't let him get away with it. You will realize quickly that Blast is just a pit yorkie. All yap, and no bite. (shrug)

    Morbius · 16 November 2005

    Let me go back to basics first. You can make claims of finding patterns in nature without your claims always being dismissed as cherry picking. This is not always an easy thing to do, but if you could not ever do it, then science would be impossible.

    Not so. As I noted:

    This pertains to the point Cubist made about cherry picking. Finding pi in the genome is not an experiment we carry out, it's just a hypothetical event, and is thus akin to finding bible codes, jesus's face in cheese, and so on. A priori probability calculations aren't relevant, any more than they are relevant when two people at a party discover they share a birthday. What are the odds of that? Wrong question. So, what are the odds that we can find some sequence in some DNA that seems, well, "designed"? Much much higher than the a priori question about 100 digits of pi.

    This is basic: a priori vs. a posteriori probability estimations. If all we were doing is "finding patterns in nature", rather than doing directed observation by setting up conditions for tests and experiments, then indeed science would be impossible. And, again, even if finding pi in the genome would be a genuine falsification of ToE -- so what? We already have numerous other examples of same, such as precambrian rabbit fossils. The possibility of finding such things has no bearing on whether ID can be scientifically respectable -- which was the reason digits of pi were introduced here in the first place. P.S. I can log in to ABC but I can't post to the Lutsko thread -- I tried to register, but never received a confirmation email. Is there else I'm supposed to do?

    Sir_Toejam · 17 November 2005

    P.S. I can log in to ABC but I can't post to the Lutsko thread --- I tried to register, but never received a confirmation email. Is there else I'm supposed to do?

    send an email to Wesley; i think he manages that board. In fact, i think he is currently tweaking the code, so it might have something to do with your registration failure. just a guess.

    PaulC · 17 November 2005

    If all we were doing is "finding patterns in nature", rather than doing directed observation by setting up conditions for tests and experiments, then indeed science would be impossible.
    First, I didn't say that this is all we're doing, but finding patterns--parsimonious models of observations--is clearly part of doing science.
    And, again, even if finding pi in the genome would be a genuine falsification of ToE --- so what?
    So nothing... I'm not all that interested in it as a falsification of ToE, since as you point out it is only one of many others such as pre-Cambrian rabbit fossils, and I'm not expecting it to be proven false. I am making the general point that you can rule out the problem of cherry picking in a claim to have found a pattern in some data provided you are reasonably careful about your claim. Probably the most rigorous way to handle this is to use a notion of string compressibility (Kolmogorov complexity) as I already noted. I think you are familiar with this, since you recently alluded to something like this in a different thread as the modern form of Occam's razor. If you find long contiguous substrings in an observed string that can be generated by a much shorter Turing machine program, then these strings are interesting and provide very strong scientific evidence that the string is not, for example, the result of a sequence of uniform choices of characters. The Turing machine needs to be agreed to ahead of time, but the exact choice will only change constant factors, so we could all agree to one right now and it would be sufficiently general for all future purposes. The first n digits of pi are highly compressible for sufficiently large n. Likewise for the first n digits of e. Likewise for the first n primes. Likewise even for a string consisting of the same character repeated. Finding any one of these things in a string rules out with high probability that the string came from a uniform random process, though in the case of the repeated string it doesn't suggest a very interesting process. If I had a sufficiently long strand of DNA from wild type bacteria, claimed to "find pi" in it and when you asked me what I mean by that I said: "I wrote this much shorter code segment in the standard TM that I wrote to generate pi and encode it in nucleotide bases, and when I run it, it generates the same sequence that I found in the DNA." then you could ignore my wild rantings about pi and about encoding schemes but would still have to take the shortness of the program that generated it as evidence that my finding had significance. Ergo, no opportunity whatsoever for cherry picking.

    BlastfromthePast · 17 November 2005

    (BTW, I love Penrose's books. As a non-physicist, I think The Road to Reality is the best and most demanding pop physics book out there.)

    Couldn't agree with you more.

    To begin with, scientists don't commonly speak of having "disciples."

    We're speaking of a hypothetical experiment. You'd have to have disciples to carry on the experiment as I described it; lab assistants wouldn't do. So don't take it personally.

    Second, you seem to be very confused about evolution. Evolution says that cats and dogs have a common ancestral species that existed at some time in the distant past, and that there are plausible pathways (involving natural and artificial selection) from that ancestral species to the modern domesticated species. It does not say that there is any plausible pathway from the cat or dog back to the ancestral species. Selection events don't work in reverse.

    How about this syllogism: Blast doesn't understand nonsense. The theory of evolution is nonsense. Therefore, Blast doesn't understand the theory of evolution. I fully understand what evolution "purports" to reveal, it's just that it doesn't make any sense. For example, your statement: "It does not say that there is any plausible pathway from the cat or dog back to the ancestral species. Selection events don't work in reverse." Why? Because you say so. And why do species emerge? Because there's "selective pressure" to do so. Where's the proof? This is just pure conjecture. I don't buy it. And, by your own argument, there's no way to verify these "plausbile" pathways. So, I guess we'll never know for sure. (And the whole idea of "common ancestors" is itself suspect since these putative ancestors don't appear in the fossil record?)

    Likewise, you could conceivably breed cats for dog-like characteristics, but whatever the result of your efforts, the probability is vanishingly small that it would be a member of the dog species---i.e., able to breed with dogs.

    Let me make it easier for you: turn a cat into anything else. Turn it into a car muffler, a peach tree, an as yet unknown ungulate, anything, just something that's not a cat. (And, of course, you know that's not possible because in-breeding eventually produces sickly lines.)

    BlastfromthePast · 17 November 2005

    Are Homo sapiens and Helacyton gartleri the same "kind?"

    Cancer is a loss of cell differentiation, i.e., a loss of what it's "supposed" to be. Doctors routinely remove cancerous growths. So what is the purpose of such a question?

    Morbius · 17 November 2005

    Finding any one of these things in a string rules out with high probability that the string came from a uniform random process

    For a specific string, but not if we have an arbitrarily large number of strings, any one of which would be considered a match if it contained such a sequence. As with Behe's dirt, absolute low probabilities mean nothing; no matter how low the probability of an individual hit, the probability of some hit approaches 1 as the number of samples goes to infinity. What is the probability of finding the entire King James Bible encoded in ASCII appearing somewhere in a binary expansion of pi? It's 1.

    Morbius · 17 November 2005

    If I had a sufficiently long strand of DNA from wild type bacteria, claimed to "find pi" in it and when you asked me what I mean by that I said: "I wrote this much shorter code segment in the standard TM that I wrote to generate pi and encode it in nucleotide bases, and when I run it, it generates the same sequence that I found in the DNA." then you could ignore my wild rantings about pi and about encoding schemes but would still have to take the shortness of the program that generated it as evidence that my finding had significance. Ergo, no opportunity whatsoever for cherry picking.

    Ok, let's consider this. The number of DNA strands that you might have examined considered before presenting this one is relatively small, so my previous comment about arbitrarily large sample space doesn't apply in that regard. But your talk about "Turing Machine program" and "code segment" is confusing or, I think, confused. A TM is fully defined by its state transitions, the initial content of the tape, and the position of the head. Perhaps you mean a UTM that can process a program encoded on its tape -- that program representing a TM that generates pi. But I don't see the point to any of this; we can just specify an encoding of pi beforehand, we don't need a program to generate it, as numerous such programs have already been written and run. But this is strictly a hypothetical, not an experiment or a search that anyone is proposing to carry out, and so there's absolutely no reason to prespecify an encoding for pi or for anything else. If we -- or more likely folks who believe in ID -- want to have such encodings handy just in case they are ever found, then we have no clue what encoding to prespecify. If we just pick one arbitrarily then -- lacking any theory of ID -- the chances are infinitesimal that it's the one the designer actually used. And the more we have available ahead of time, the less significant the fact that one of them matches -- which gets back to the point about number of samples. What we're left with is a very silly hypothetical: suppose we prespecified one particular encoding of pi, for no particular reason at all, and we arbitrarily picked some DNA sequence from some arbitrary organism -- all for no reason at all -- and the DNA sequence matched encoding. Wouldn't that be something!

    Alan Fox · 17 November 2005

    Dawkins' petwhac?

    Morbius · 17 November 2005

    petwhac = Population of Events That Would Have Appeared Coincidental

    Indeed. I haven't read the book but I would expect that Dawkins' treatment would apply here, and is explained far better than any of us are managing.

    PaulC · 17 November 2005

    Morbius: Yes, by "Turing Machine program" I meant an initial tape configuration on a UTM. I expressed this more generally and more coherently in my previous posting, which you already responded to as "a much shorter sequence of computer code (to rule out cherry picking, it runs on a particular universal machine chosen ahead of time)."
    But I don't see the point to any of this; we can just specify an encoding of pi beforehand, we don't need a program to generate it, as numerous such programs have already been written and run.
    I need to demonstrate the existence of a program shorter than the string itself in order to rule of objections of cherry picking. Also, no programs have been written that output pi in the encoding that would appear in the DNA in the thought experiment.
    What we're left with is a very silly hypothetical: suppose we prespecified one particular encoding of pi, for no particular reason at all, and we arbitrarily picked some DNA sequence from some arbitrary organism --- all for no reason at all --- and the DNA sequence matched encoding. Wouldn't that be something!
    I agree that that's roughly the hypothetical, although it can be generalized significantly in terms of string compressibility, and there does not have to be one encoding providing the encoding comes from a small enough family of possible encodings. It would be too "silly" to waste time on except in the concept of supporting the following statement, that you and Cubist both dismissed as susceptible to cherry picking: Someone (and now I forget who) said roughly "If you found 100 digits of pi in bacterial DNA, the most likely explanation is that a human put it there." This seems obviously true, although as initially stated it's possible to raise objections to it. So here is the more rigorous form: If you found a highly compressible substring in bacterial DNA that contributed to fitness of the organism in no plausible way, seemed very difficult to explain in terms of DNA copy mechanisms, and coincidentally could be transformed by substituting bases for digits into a string known to be of interest to humans, then the most reasonable starting hypothesis is that a human put it there. Finding sufficiently many base 4 digits of the prefix of pi encoded in one of the 24 possible ways of mapping nucleotides to digits is one particular instance of the above. If that happened, it would be scientifically reasonable to look for some mechanism for it, because the compressibility would suggest that chance was not the explanation. Given the irrelevance of a pi encoding to biology, the first thing you would want to rule out is that a colleague was playing tricks on you. As I already said, I'd first look at the sequencing software, because that's easier to hack than the DNA. If it happened on April 1, I would be even more likely to attribute it to human agency, since there is scientific evidence that humans play precisely this kind of joke on April 1. There is no cherry picking about it. My hypotheses would be entirely reasonable whether I found pi, e, or a list of primes. By contrast, if I found a sequence made by pasting together numbers from the Manhattan phone directory, you could reasonably start to look for cherry picking. If human agency was not involved, then I'd have to reconsider if some DNA copy mechanism could produce it, which would be interesting, or if it contributed to fitness after all, which seems very hard to imagine. At a certain point, after testing these and rejecting them, I'd just have to conclude I had exhausted reasonable hypotheses. I grant that nothing like this has ever been found in DNA and there is no reasonable expectation of finding any such thing.

    PaulC · 17 November 2005

    Oops. In the above "rule of objection" should be "rule out objection" and "in the concept of" should be "in the context of."

    PaulC · 17 November 2005

    Finally, I have to wonder how one would go about cracking encrypted text or detecting steganography (concealed messages) if every pattern found in strings were to be dismissed as cherry picking. Both of these are rigorous subdisciplines of applied math (I'll leave open if it counts as science), and routinely make the distinction between apparently random strings and strings suspected of carrying information between human parties. They do this without a priori assumptions about what content is expected to be found in the decrypted strings.

    Now looking for secret messages in DNA is clearly a game for cranks (or at least those with way too much time on their hands) but if you included a sufficiently long prefix of pi in any simple encoding in a string sent to reasonably motivatied decryption experts, I would give them a reasonably good chance of finding it. If they did, they would consider it part of the content and not dismiss it as cherry picking.

    Wait, let me make this more specific. Suppose I'm wrong and decryption experts wouldn't find it. Then I've invented the unbreakable PandasThumb cipher. All I do is take my message, XOR it with the bits in an equal length prefix of PI and include it somewhere in the middle of a much longer string. Then the NSA will never find my plaintext, because the encoding of pi in the string is easily dismissed as cherry picking.

    PaulC · 17 November 2005

    They do this without a priori assumptions about what content is expected to be found in the decrypted strings.
    Or, rather, the only a priori assumption about content is that it is more compressible than uniform random data.

    PaulC · 17 November 2005

    How about this syllogism: Blast doesn't understand nonsense. The theory of evolution is nonsense. Therefore, Blast doesn't understand the theory of evolution.
    A better one, though not strictly a syllogism (a passable Koan perhaps?): Blast puts hands over his ears. Blast sings "la la la not listening la la la." Therefore, Blast remains ignorant.

    Julie · 17 November 2005

    Let me make it easier for you: turn a cat into anything else. Turn it into a car muffler, a peach tree, an as yet unknown ungulate, anything, just something that's not a cat. (And, of course, you know that's not possible because in-breeding eventually produces sickly lines.)
    Aside from the non sequitur (turn a cat into something else by means of inbreeding?), there are inbreeding populations in quite a few animal species, and many plants are capable of the ultimate inbreeding strategy -- self-pollination. I spent a few years studying inbreeding in a solitary wasp species in which about two-thirds of all matings may be between siblings. (More details on request; I can go on about this for pages and pages.) Adaptations that permit or even favor inbreeding in some species are far more common than one might think.

    Anton Mates · 17 November 2005

    Are Homo sapiens and Helacyton gartleri the same "kind?"

    — BlastfromthePast
    Cancer is a loss of cell differentiation, i.e., a loss of what it's "supposed" to be. Doctors routinely remove cancerous growths.

    How are either of those statements relevant here? H. gartleri doesn't particularly care about what its ancestors were "supposed" to be doing in Henrietta Lacks' body, nor about the fact that it was removed from said body by a doctor.

    So what is the purpose of such a question?

    To clarify your definition of "kinds." H. gartleri is, again, a free-living unicellular organism, not dependent on a human host to grow or replicate itself. So is it the same "kind" of organism as Homo sapiens? Or not?

    Morbius · 17 November 2005

    If you found a highly compressible substring in bacterial DNA that contributed to fitness of the organism in no plausible way, seemed very difficult to explain in terms of DNA copy mechanisms, and coincidentally could be transformed by substituting bases for digits into a string known to be of interest to humans, then the most reasonable starting hypothesis is that a human put it there.

    "found a highly compressible substring in bacterial DNA", is not at all unlikely, without specifying it strictly. We're going in circles. Certainly if we find something very difficult to explain in terms of DNA copy mechanisms then we would have trouble explaining it, and if the best explanation appears to human design, then that's the best explanation. Like I said, wouldn't that be something!

    Finally, I have to wonder how one would go about cracking encrypted text or detecting steganography (concealed messages) if every pattern found in strings were to be dismissed as cherry picking.

    Cryptography is based on prespecified criteria such as letter frequencies. But consider cypher text produced via a one time pad. Any possible pattern can be found in such texts, but none of them mean a thing -- one time pad encryption is theoretically unbreakable.

    Morbius · 17 November 2005

    Another point about cryptography: it is based upon the highly reasonable expectation that there is an encoded message. In the case of the genome, that is not a reasonable expectation, and we shouldn't expect to find one. If we do find something that we think is a message, that's a very different situation than finding something we think is a message in some gibberish in an Al Qaeda email.

    If someone says they have a DNA sequence that encodes 100 digits of pi, it's most likely a hoax. If they present a pre-mailed envelope containing that encoding, most likely it's still a hoax. No matter how firm the evidence that the encoding was pre-known, the most obvious question is, how was it known? This would not tell us something about DNA and evolution, it would instead suggest that we have either a very talented trickster or a psychic among us.

    Morbius · 17 November 2005

    They do this without a priori assumptions about what content is expected to be found in the decrypted strings.

    Or, rather, the only a priori assumption about content is that it is more compressible than uniform random data. This isn't even remotely true. At the very least, they have the assumption that the content is meaningful in some human language; that's why the U.S. used Navajo's in WWII. And they generally have a great deal of information as to what content and what words are more likely than others. If they find a recipe for fruitcake, they'll consider that it might be a feint and that there's some other message present.

    'Rev Dr' Lenny Flank · 17 November 2005

    Cryptography is based on prespecified criteria such as letter frequencies.

    That depends on what particular method the encryption used. Certainly it is a simple matter to break a single substitution cipher (a "Caesar code") using frequency analysis. But this doesn't work on most other cipher systems. The polyalphabetical Vigenere double-substitution cipher, for instance, and all its variants, is specifically designed to defeat frequency analysis, by insuring that the same clear letter is enciphered by a different cipher letter with each occurance. Of course, the Vigenere-type cipher can be defeated using Kasiski or Kerkhoff analysis, if the key is relatively short and repeated (a key-word or key-phrase), or by the Mathematical Coordinates method, if the key is long but structured (a key-text). Most transposition ciphers can be detected by a frequency analysis, but frequency analysis doesn't really help to break the cipher, particularly in the case of "keyed transpositions" --- these are, however, vulnerable to an attack called "multiple annagramming", which doesn't use frequency analysis.

    But consider cypher text produced via a one time pad. Any possible pattern can be found in such texts, but none of them mean a thing --- one time pad encryption is theoretically unbreakable.

    That's right. It is a popular misconception that there is no such thing as an "unbreakable cipher". But the onetime pad, which uses a non-repeating (and non-repeated) random unstructured key, cannot be broken by any cryptanalytic methods. Even a "brute force" computer attack will simply spit out every possible combination of letters that fits the allotted space. The problem with the onetime pad system (and the reason why it's not used very often in the real world) is logistical. The pad system works well only if the transmitted messages are short and infrequent. Long messages or frequent contact means that the pads are quickly used up, and transferring new pads (actually two different pads -- one for transmitting and one for receiving) presents its own security risks. Therefore, embassies and other users who must transmit long frequent messages, rely on less-secure but more-practical encryption methods. Most computer encryptions use a system known as RSA, which uses the mathematical product of two large prime numbers to produce a two part key. The security lies in the enormous difficulty (even by computer) of factoring large numbers to reconstruct the two parts of the key. However, although exceedingly difficult in practice (and thus secure for all intents and purposes), the cipher system is theoretically vulnerable since the key is not random.

    'Rev Dr' Lenny Flank · 18 November 2005

    Any possible pattern can be found in such texts, but none of them mean a thing

    Actually one of them DOES -- the intended message. But it's impossible for an unauthorized recipient to know which one is the intended one. One simple way to tremendously increase the security of any cipher system is to cipher the message and then cipher the cipher. Even if the crytpanalyst breaks the first stage of the process, it'll look like gibberish to him and very likely be discarded. Since he won't know which is the real message, he'll have to try and break them all. Makes life far more difficult for him.

    'Rev Dr' Lenny Flank · 18 November 2005

    Finally, I have to wonder how one would go about cracking encrypted text or detecting steganography (concealed messages) if every pattern found in strings were to be dismissed as cherry picking.

    Cryptanalysis depends largely on having a large amount of material, all ciphered with the same system and same key. That way, any patterns that are observed across ALL of the messages can pretty safely be assumed to be the result of the encryption process itself, rather than just random "cherry-picking". It is extremely difficult to break a single message using cryptanalysis, for precisely the reason you cite --- it's hard to tell when a pattern is really a pattern and not just a random artifact.

    PaulC · 18 November 2005

    "found a highly compressible substring in bacterial DNA", is not at all unlikely, without specifying it strictly. We're going in circles.
    No it doesn't. Look up Solomonoff induction. Solomonoff showed in the early 1960s using a concept like Kolmogorov complexity that subjectivity could be eliminated in a priori assumptions. I gave a more rigorous version of my arguments on Lutsko's ABC thread, by defining a p-value in terms of Kolmogorov complexity, which you can look at as well. I'm through trying to explain this to you, as neither general principle nor specific counterexample seems to reach you. The notion that compressibility implies significance is well-established. It has nothing to do with ID, but ID is hogwash, so why should it?

    'Rev Dr' Lenny Flank · 18 November 2005

    As an aside, for most cryptographic systems, it takes about 30-40 messages, all ciphered with the same key, to give a cryptanalyst enough material to have a decent chance of cracking the cipher relatively quickly.

    So one good way to beat the codebreakers is to change your key after every 15-20 messages. It doesn't give the analyst enough material to work with, and makes it very difficult to use mathematical methods to break the cipher.

    They will still be able to do it, but it will take much longer (much more trial and error and "brute force"). And by the time the cipher is finally broken, the information it contains will already be old and useless ---- the standard by which a successful cipher system is measured.

    PaulC · 18 November 2005

    Any possible pattern can be found in such texts, but none of them mean a thing --- one time pad encryption is theoretically unbreakable.
    One last attempt at explanation. A one-time pad is only unbreakable if it comes from a true random source. I.e., is incompressible. If I used a periodic string like 010101....010101 as my pad it would be very breakable even if I used it just once. Even a pseudorandom source is breakable unless its based on a very secure algorithm. Hence, incompressibility in the objective sense of Kolmogorov complexity is also a key to the design of one time pads. A prefix of pi makes a bad one-time pad for two reasons: (a) in theory, it is highly compressible (b) in practice, it's something human beings have a pretty high chance of looking for. OK, that's it.

    PaulC · 18 November 2005

    If someone says they have a DNA sequence that encodes 100 digits of pi, it's most likely a hoax.
    Sorry about my lack of discipline in continuing to respond. Anyway, I have given up on explaining, but I just want to comment that this is what I have been saying all along. Any claims of finding 100 digits of pi in bacterial DNA are most likely an indication of human agency. The could hack the sequencing software or (far less likely) hack the bacterial genome itself. In a pure hoax, they could just send out a false press release.

    'Rev Dr' Lenny Flank · 18 November 2005

    A one-time pad is only unbreakable if it comes from a true random source. I.e., is incompressible. If I used a periodic string like 010101....010101 as my pad it would be very breakable even if I used it just once.

    That's right. One of the Vigenere variants works by using a long text as its key --- IIRC one Soviet spy used the text of a Dostoyevsky story as his key. The problem with that is there is a method called "mathematical coordinates" which, given enough material, can be used to reconstruct bits and pieces of the key text, until enough of it is recognized to identify the key text. The onetime system gets aorund this by using an utterly random long key that has no structure, making it impossible for a cryptanalyst to reconstruct enough of it to identify. And, the fact that every key is used only once adds greatly to the security, for the reason I noted above --- it takes a fair amount of material using the same key to give mathematical techniques much chance to crack the cipher.

    Even a pseudorandom source is breakable unless its based on a very secure algorithm.

    One variation of the onetime pad, used by Soviet spies, used a particular date, a five digit number, and a short phrase from a popular song to generate a long pseudorandom key text that was then used to cipher the message. The FBI never broke it, and learned how it worked only when the spy confessed and showed them how it was done. But, with enough captured material using the same system, it would have been vulnerable to cryptanalysis.

    'Rev Dr' Lenny Flank · 18 November 2005

    Sorry about my lack of discipline in continuing to respond.

    I found it quite interesting, actually.

    k.e. · 18 November 2005

    Even if you found a "message/pattern/random artifact" it would be meaningless except in prayer(self worship) the metaphysical interpretation would be colored totally by culture. An opinion.

    To have it accepted you would need to "convert" the disciples. It would only be accepted if it had value.

    No different to finding god in a snowflake.

    Blast (Parsifal) again leaves the enchanted castle without the holy grail all for want of a question.

    PaulC · 18 November 2005

    Rev. Dr. Lenny Flank wrote:
    I found it quite interesting, actually.
    Yes, but it's embarrassing to me to say I'm done explaining and then come back and continue to explain. It's my fault for not wrapping up all my thoughts into one package. Note that I didn't say I was going away from PT or never again responding to Morbius. I just think that after several back-and-forths, I've formalized my claim by defining a p-value based on Kolmogorov complexity. This can be found in my posting to Lutsko's ABC thread, or by starting here: http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=437cf7cb79633537;act=ST;f=14;t=71;st=40 I have nothing further to say on the matter at this time.

    BlastfromthePast · 18 November 2005

    To clarify your definition of "kinds." H. gartleri is, again, a free-living unicellular organism, not dependent on a human host to grow or replicate itself. So is it the same "kind" of organism as Homo sapiens? Or not?

    — Anton Cates
    I wrote: Cancer is a loss of cell differentiation, i.e., a loss of what it's "supposed" to be. Translation: They're not liver cells, nor are they brain cells, nor are they skin cells, etc. So, I don't know what it is; but I can tell you what it isn't. It isn't a Homo sapien cell. It's a cell that is derived from a Homo sapien cell. I also wrote: Doctors routinely remove cancerous growths. If these cancer cells were something integral to the species, Homo sapiens, they wouldn't just routinely remove them. So, conclusion: They're human cancer cells. They aren't Homo sapiens cells. And, tell me, what would happen if scientists in labs didn't culture these cells, wouldn't they just die? They're really on life-support.

    PaulC · 18 November 2005

    One variation of the onetime pad, used by Soviet spies, used a particular date, a five digit number, and a short phrase from a popular song to generate a long pseudorandom key text that was then used to cipher the message. The FBI never broke it, and learned how it worked only when the spy confessed and showed them how it was done. But, with enough captured material using the same system, it would have been vulnerable to cryptanalysis.
    That's an interesting story. I would comment that if a US intelligence agency had somehow guessed the scheme and found that they were able to convert the encrypted text into Russian plaintext, they would consider this significant and no one would accuse them of cherry picking the proposed encryption method provided the decryption algorithm had a smaller representation than the decrypted text. Now, if they said oh, it just uses this random looking one-time pad and you apply that and here's what it says, then it would look a lot like they had simply cherry-picked the pad to get the text to say whatever they wanted. Once again, compressibility is the key to claiming you have a significant find. The simpler the explanation, the less opportunity for cherry picking. It's an application of Occam's razor, or the modern version, Solomonoff Induction.

    'Rev Dr' Lenny Flank · 18 November 2005

    They aren't Homo sapiens cells.

    Um, Blast, whose DNA do they contain.

    'Rev Dr' Lenny Flank · 18 November 2005

    It isn't a Homo sapien cell. It's a cell that is derived from a Homo sapien cell.

    I.e., it evolved.

    Stephen Elliott · 18 November 2005

    I am quite confused about the cryptography comments.
    Are you encoding words with words?
    Or changing letters to numbers?

    My main experience with crpto is digital, where you take plain text then digitise it. then this plain (digitised) message is put through an exclusive OR gate along with a pseudo random key. The XOR gate then gives out the encrypted text. Further encryption can be carried out by repeating the process (XOR) with either the same key or yet another key of the same or different number of chars.

    While it is possible to eventualy break such encryption is only going to happen with raw computer power. No cryptologist is reasonably likely to be able to do this.

    Even with plenty of computer power; without any knowledge of how many chars are in the key or how many times the original message was encrypted anyone/computer trying to get back to the original (plain text) is in for a very hard time.

    PaulC · 18 November 2005

    While it is possible to eventualy break such encryption is only going to happen with raw computer power. No cryptologist is reasonably likely to be able to do this.
    Yes, it's usually difficult to break encryption schemes. The salient point is that once a cryptologist has broken a scheme, the fact of having found the plaintext is clear to the cryptologist, and it's worth examining why that is (also see my comments on ABC). Informally, we think of the plaintext as recognizable natural language, but suppose you were trying to decrypt a document, proposed a simple decryption scheme and after applying it found that the document consisted of all 0s. In that case, you'd still have to conclude that your decryption was meaningful and in merely decrypted a source text containing very little information. The encryption algorithm and key, and a count of the number of 0s would be a complete specification of the file. Hence the file would be highly compressible. At that point, it would be foolish to look for some other explanation the encrypted text. It has been cracked, end of story, no cherry picking objections because the scheme is too simple to allow that.

    Anton Mates · 18 November 2005

    To clarify your definition of "kinds." H. gartleri is, again, a free-living unicellular organism, not dependent on a human host to grow or replicate itself. So is it the same "kind" of organism as Homo sapiens? Or not?

    I wrote: Cancer is a loss of cell differentiation, i.e., a loss of what it's "supposed" to be. Translation: They're not liver cells, nor are they brain cells, nor are they skin cells, etc. So, I don't know what it is; but I can tell you what it isn't. It isn't a Homo sapien cell. It's a cell that is derived from a Homo sapien cell. And I agree. So then when you say,

    But, of course, we've known, and for a long time, that there are barriers to variation that species cannot cross.

    apparently those barriers aren't narrowly-spaced enough to prevent prevent a human being from giving rise to a decidedly non-human single-celled organism, correct? Without any genetic tinkering to the latter by human scientists, moreover? And when you say,

    In other words 20% of the genome is constantly "mutating", and no real change takes place: they're just bacteria. So, you can see, that if 20% is constantly changing and nothing really changes, then some simple "point" mutation---that is, a single nucleotide change, in all probability, wouldn't show any change at all..

    this is a counterexample to that claim, yes? In all probability much less than 20% of the H. gartleri genome has changed from within the overall human range of variation--they're still used for human cell research, and they can often overgrow colonies of other human cells without the researcher's notice. Yet, as you say, they are no longer "just human cells."

    And, tell me, what would happen if scientists in labs didn't culture these cells, wouldn't they just die? They're really on life-support.

    Actually, they frequently pop up without lab scientists culturing them. They've contaminated many other cell cultures unbeknownst to the researchers (which usually leads to the poor researcher being super-happy at how well his culture is suddenly growing!) They're now a successful invasive species of a very specialized and recent environment--the culture plate. But it's certainly true that if you just dumped some outside on the soil or in a pond or something, they wouldn't last long. They originated in the very friendly environment of the human body, and don't do well in an environment with predators or insufficient nutrients or oxygen. Which of course is why cancers almost never outlive their hosts. You can't really call that "life-support," though, unless you want to say the California condor's on "life-support" since it needs our positive help to avoid extinction, and the human eyelash mite's on "life-support" since it wouldn't survive without us for hosts, and we're on "life-support" since we'd all die if the kindly plants weren't pumping out oxygen and assembling food reserves. Every species depends on others.

    PaulC · 18 November 2005

    k.e. wrote
    Even if you found a "message/pattern/random artifact" it would be meaningless except in prayer(self worship) the metaphysical interpretation would be colored totally by culture. An opinion.
    Well I'm certainly not offering a metaphysical interpretation, nor defending ID. What I am saying is that if you define a p-value: P(n,k)=the probability that a uniformly chosen nucleotide string of length n has Kolmogorov complexity k or less. Then you can use this p-value in a garden-variety statistical inference test of the sort one might use to decide if the coin you're flipping is biased. [In the latter case, which I trust is not controversial, you'd use a p-value based on the probability of an unbiased coin giving you m or fewer heads on n flips (the binomial distribution). A sequence of 100 flips of which only 10 were heads would have a low p-value, and by statistical inference you could conclude that it is likely that the coin is biased (only a vanishingly small chance that an unbiased coin gave you that result).] Now, if analogously you found a sufficiently long prefix of n bits of pi (say n=1000000 to be safe), it would certainly have Kolmogorov complexity k much much less than n with respect to any reasonable universal computer (we agree on one a priori and exhibit a k-bit or less program for calculating n digits of pi). Thus, it would have a vanishingly low p-value according to the definition above and you could make the statistical inference that with very high probability, the source was not a uniform random process (in fact, we know it was not, but we could substitute a better statistical model of junk DNA). The above would hold for a prefix of e, or phi, for a representation of prime number sequences, none of which are probable in any reasonable statistical model of junk DNA. The point is that it works for any highly compressible string not just the one you specified ahead of time. Of course it would tell you diddly about an "intelligent designer" because plenty of natural processes are far from being random, and evolution is one of them, and there is no reasonable expectation of the existence of an intelligent designer given the robustness of evolution to explain countless observations, but that's not my point. My point is that if objections of cherry picking are made too broadly, this rules out any possibility of statistical inference or scientific induction. Solomonoff induction gets around this problem by defining induction in terms of compressibility.

    PaulC · 18 November 2005

    I sloppily suggested
    you could make the statistical inference that with very high probability, the source was not a uniform random process
    Actually, that looks like one of the fallacious interpretations of a p-value. What I (ahem) "meant" to say (see http://en.wikipedia.org/wiki/P-value) was that there is a very low "probability that, given that the null hypothesis is true, T will assume a value as or more unfavorable to the null hypothesis as the observed value." I.e., given that the source is a uniform random process (null hypothesis) the probability is low of getting such a compressible string as a result. In any case, statistical inference is a standard tool of legitimate science. It is not to be confused with numerology, tea-leaf reading, or ID, and my application of p-value to this case is sound (modulo any corrections, which are welcome).

    PaulC · 18 November 2005

    Stephen Elliott:
    Even with plenty of computer power; without any knowledge of how many chars are in the key or how many times the original message was encrypted anyone/computer trying to get back to the original (plain text) is in for a very hard time.
    One more comment: your statement is only true if the complexity theoretical conjecture P!=NP holds. http://en.wikipedia.org/wiki/Complexity_classes_P_and_NP While it would be astonishing if the conjecture is false, it has yet to be proven. While encryption with a true random one-time pad is unbreakable in an information theoretic sense, many decryption problems can be solved if you can guess a short polynomial-time computable decryption protocol, guess the key used for this protocol, and can apply a polynomial time test to identify plaintext. For instance, RSA-encoded English text would meet those criteria. Such encryptions can be cracked in polynomial time in a nondeterministic model, so it is a matter of conjecture as to whether there is an efficient algorithm for breaking them on actual deterministic computers.

    'Rev Dr' Lenny Flank · 18 November 2005

    am quite confused about the cryptography comments. Are you encoding words with words? Or changing letters to numbers?

    Either. Some cipher system use an alphanumeric table (keyed, usually) to convert letters to numbers. Some don't.

    My main experience with crpto is digital, where you take plain text then digitise it. then this plain (digitised) message is put through an exclusive OR gate along with a pseudo random key. The XOR gate then gives out the encrypted text. Further encryption can be carried out by repeating the process (XOR) with either the same key or yet another key of the same or different number of chars.

    Crytologically, the computer "XOR" function produces a double-substitution Vigenere cipher with an unordered key.

    While it is possible to eventualy break such encryption is only going to happen with raw computer power. No cryptologist is reasonably likely to be able to do this.

    Not entirely true. The problem is that such computer systems use the same key to encrypt different messages. Further, most such systems use a key that is shorter than the average message, therefore the key itself repeats within each message (the longer the key, the more secure it is). That leaves the system vulnerable. If the key is a short one (a word or short phrase or even a short random string of numbers/letters) then the method is vulnerable to Kasiski and Kerkhoff attacks. If the key is very long, it's still vulnerable. Since the first letter (or number) of every message is always encrypted with the first letter (or number) of the key, the second text letter with the second key letter, etc, a cryptanalyst can, with enough intercepted material, set each of these up as a column, and then use frequency analysis to break each one, eventually reconstructing the entire key. The reason that the onetime pad system is unbreakable and invulnerable to cryptological methods is because it uses a random unordered key that is *never repeated*, either within a single message or in other messages.

    'Rev Dr' Lenny Flank · 18 November 2005

    They're human cancer cells. They aren't Homo sapiens cells.

    Hey Blast, I do realize that you're not, uh, terribly bright, but I have one simple question for you . . . . Where, exactly, do human cancer cells come from? Feel free to look it up on the web if you need to, Blast.

    PaulC · 18 November 2005

    I can't argue with anything Lenny said about cryptography. The part that rings a bell sounds right to me, and there's an awful lot I don't know (e.g. Kasiski and Kerkhoff attacks). (Lame but true excuse: back when I was in grad school, my department was about to offer a cryptography course, but the professor who was going to teach it moved to another university.)

    I wish I had not brought up cryptography, though, since I think the related field of randomness testing (e.g. http://www.ciphersbyritter.com/RES/RANDTEST.HTM ) is more pertinent to what I've been trying to say here. I added more comments on ABC as well.

    Stephen Elliott · 18 November 2005

    If the key is very long, it's still vulnerable. Since the first letter (or number) of every message is always encrypted with the first letter (or number) of the key, the second text letter with the second key letter, etc, a cryptanalyst can, with enough intercepted material, set each of these up as a column, and then use frequency analysis to break each one, eventually reconstructing the entire key.

    But the first letter/number in digital encryption is encoded by several (usually 8) bits of the key. IE. The letter a might be 1010 0011 in binary code. This will then be encrypted using the first 8 bits of the key. eg. if plain text is 1010 0011 and the first 8 bits of key are 1100 1010 the cypher text becomes 0110 1001. so you have gone from 1010 0011 to 0110 1010 and this is only the first letter. Plus if you are talking about an embassy system, it is likely to be transmitting constantly. The majority of the time sending encrypted white noise. If you add to this a double (or more) encrypted transmission, it becomes very difficult to break. Yes it can be done, but only practical with knowledge of the encryption method and plenty of computer power and time.

    'Rev Dr' Lenny Flank · 18 November 2005

    But the first letter/number in digital encryption is encoded by several (usually 8) bits of the key. IE. The letter a might be 1010 0011 in binary code. This will then be encrypted using the first 8 bits of the key. eg. if plain text is 1010 0011 and the first 8 bits of key are 1100 1010 the cypher text becomes 0110 1001. so you have gone from 1010 0011 to 0110 1010 and this is only the first letter.

    Not relevant. Each 8-bit section represents a letter/number. In both key and plaintext. Each first letter of the text (represented by an 8-digit ASCII) is still being encrypted using the first 8-bit ASCII in the key. And the process of breaking it is still the same.

    If you add to this a double (or more) encrypted transmission, it becomes very difficult to break. Yes it can be done, but only practical with knowledge of the encryption method and plenty of computer power and time.

    Well, of course, breaking ANY cipher requires some knowledge of cryptology. :> And yes, double-enciphering does make it far more than twice as difficult to break it. Nevertheless, the same vulnerabilities are still there, and it can still be done. Indeed, double-substitution Vigenere ciphers, like the ones produces by XOR, were being broken, routinely, centuries ago, using nothing but paper and pencil. The purpose of an encryption system, of course, is simply to delay unauthorized entry until such a time as the information it contains is no longer useful. The intention is usually to DELAY breaking the cipher, not to PREVENT it. After all, the onetime pad is the only system that is absolutely completely unbreakable even in principle ---- and virtually no one uses it. Too many logistical problems with it.

    PaulC · 18 November 2005

    If you add to this a double (or more) encrypted transmission, it becomes very difficult to break. Yes it can be done, but only practical with knowledge of the encryption method and plenty of computer power and time.
    While I agree that cracking encryption systems is hard, it's also very risky to propose a new encryption systems, since even one that appears to be secure may have vulnerabilities unknown to its inventor. A case in point is the knapsack public key cipher, based on the NP-complete (and therefore conjectured to be intractable) knapsack problem. See http://www.quadibloc.com/crypto/pk0504.htm
    A public-key system that has been found to be unsafe, and which is therefore of primarily historical interest today, is the knapsack method. Unlike RSA and Diffie-Hellman, this system was based on a mathematical problem which was known to be NP-complete, and thus one that was tougher to crack than either factoring or the discrete logarithm problem.
    Because the knapsack cipher was based on disguising such a set of numbers, called a superincreasing knapsack as an ordinary knapsack, although solving the general knapsack problem had been proven to be an NP-complete problem, someone attacking a knapsack cipher had one piece of information that someone trying to solve the general knapsack problem did not: that the knapsack to be solved was a disguised version of a superincreasing knapsack. Thus, the flaw was that the security of the cipher depended not only on the difficulty of the knapsack problem, but on the security of the disguise.
    Other than one-time pads, I'm unaware of any encryption system that is provably secure as opposed to one (like RSA) for which there are no known attacks (no published ones anyhow) provided sufficiently large keys are chosen. As I mentioned above, in many cases an actual proof that cracking is an intractable problem would be tantamount to proving the conjecture P!=NP.

    Stephen Elliott · 18 November 2005

    The purpose of an encryption system, of course, is simply to delay unauthorized entry until such a time as the information it contains is no longer useful. The intention is usually to DELAY breaking the cipher, not to PREVENT it. After all, the onetime pad is the only system that is absolutely completely unbreakable even in principle ------ and virtually no one uses it. Too many logistical problems with it.

    Agreed. Now to move on a tad. If someone decided to do a search for information in DNA or whatever. By selecting a favorable key, I would think that you could probably manage to "recover" almost anything you wished. Although it would be erroneous.

    'Rev Dr' Lenny Flank · 18 November 2005

    I can't argue with anything Lenny said about cryptography. The part that rings a bell sounds right to me, and there's an awful lot I don't know (e.g. Kasiski and Kerkhoff attacks). (Lame but true excuse: back when I was in grad school, my department was about to offer a cryptography course, but the professor who was going to teach it moved to another university.)

    Call it a hobby of mine. :> Or was, a few years ago. Kasiski was a Prussian cryptanalyst who found a reliable way to break the Vigenere double-substitution cipher in the mid-19th century (the Vigenere system itself was several hundred years old by that time). It worked by looking for repeated patterns within the ciphertext, assuming that these resulted when the same repeated letters of the key were used to encipher the same plaintext letters to produce the same ciphertext. This allows one to determine the length of the keyword. Here's where the Dutch cryptographer Kerkhoff's method comes in: once you know how long the keyword is, then you can break the ciphertext into columns made up of all the cipher letters that were encrypted using the same letter in the keyword. Each column is then in essence a single substitution cipher or "Caesar code", which can be broken using ordinary frequency analysis -- and this allows one to identify the letters of the keyword, breaking the cipher.

    PaulC · 18 November 2005

    By selecting a favorable key, I would think that you could probably manage to "recover" almost anything you wished.
    I'm starting to feel like I'm on a merry-go-round here, but to be brief, it depends on the size of the key. If you picked a k-bit key (*), then the most you could "recover" with it is anything with Kolmogorov complexity k or less. Thus, if you restrict such "cherry picking" to short keys, then you are effectively limited in what you could claim to "recover." This is a rigorous defense against objections of cherry picking, and is related to Solomonoff induction, the modern, rigorous theory that subsumes intuitive notions of scientific induction and Occam's razor. (*) In this context, key would mean a k-bit representation of the key and the decryption protocol in such a form that it could be run on an a priori chosen universal machine.

    PaulC · 18 November 2005

    I said: "the most you could 'recover' with it is anything with Kolmogorov complexity k or less."

    To clarify, I take quote-recover-unquote to mean "confabulate by means of cherry picking." This will not prevent you from actually recovering however many bits of information may be found in the ciphertext itself.

    BlastfromthePast · 18 November 2005

    Actually, they frequently pop up without lab scientists culturing them. They've contaminated many other cell cultures unbeknownst to the researchers (which usually leads to the poor researcher being super-happy at how well his culture is suddenly growing!) They're now a successful invasive species of a very specialized and recent environment---the culture plate.

    Anton, this is so strained an argument that I can't believe you're making it. You have an artificial environment, with a cell line that is no more than degraded human cells. If this is your definition of crossing the species barrier, then all it does it further point out what we already know: most variations are harmful. This hardly helps Darwinism.

    Where, exactly, do human cancer cells come from?

    The question being posed wasn't "whence", but "what." And I can't believe it; you actually sound intelligent in your discussion with Paul C. Who would have thought?

    'Rev Dr' Lenny Flank · 18 November 2005

    By selecting a favorable key, I would think that you could probably manage to "recover" almost anything you wished.

    Right. Depending on which key you choose, you can produce *any* combination of letters and/or numbers that happens to fit within the allotted space. And no way to tell which, if any, is the "real" message. For instance, you could, with one key applied to a nine-codon sequence of DNA, produce the nine-letter "message": GODISREAL But by simply changing to a different key, you could also produce the nine-letter "message": GODISFAKE And with still another key, you can produce the nine-letter "message": ZEUSISGOD And you'd have no way to know which, if any, is the intended message. Or even IF there is any "intended message". You can, quite literally, find whatever you *want* to find. That is the problem with all the so-called "Bible codes" ------ they simply hunt around for the one key or process that produces a result that they like, then declare it to be "real", all the while ignoring all the thousands of OTHER (equally valid) keys or processes that give results that they DON'T like. I.e., they find what they want to find.

    'Rev Dr' Lenny Flank · 18 November 2005

    Where, exactly, do human cancer cells come from?

    The question being posed wasn't "whence", but "what."

    And the "whence" answers that. They are human cells. Mutated human cells. Mutated cells which, according to YOU, are *no longer* human cells. That sounds an awful lot to me like "evolution", from one "kind" to another. Unless you want to argue that either (1) they weren't really human cells to begin with (in which case I will ask you YET AGAIN where they came from) or (2) they are nothing but human cells NOW. Do you want to argue either of those, Blast? If they (1) were human then and (2) aren't human now, then please feel free to explain to me how this does NOT constitute "evolution from one kind to another". Be as detailed as you need to be, Blast. And please please pretty please feel free to invoke, uh, "frontloading". (snicker) (giggle) My prediction? We are getting **very very close** to the point where you will simply jump ship and disappear, just like you did with all your earlier asinine blithering about snake venoms and such.

    And I can't believe it; you actually sound intelligent in your discussion with Paul C. Who would have thought?

    That's because PaulC isn't a dishonest evasive deliberate liar who evades and avoids answering simple questions, Blast. Know anyone who IS like that, Blast?

    'Rev Dr' Lenny Flank · 18 November 2005

    Actually, they frequently pop up without lab scientists culturing them. They've contaminated many other cell cultures unbeknownst to the researchers (which usually leads to the poor researcher being super-happy at how well his culture is suddenly growing!) They're now a successful invasive species of a very specialized and recent environment---the culture plate.

    Anton, this is so strained an argument that I can't believe you're making it.

    Translation from Blast-ese: "I don't have the foggiest idea what you're talking about."

    If this is your definition of crossing the species barrier

    Is it your opinion, then, that humans can interbreed with these cells . . . ? And in what way, precisely, are they "degraded"? And if these "degredations" are "harmful", then, uh, how do these cells manage to live outside the human body? How is that "harmful" for them? Oh, and how, exactly, are these cells "artificial"? Mice live in my house; my house is an artificial environment. Does that mean mice are "degraded" or "artificial"? Did the species of house mouse not evolve from wild species like deer mice simply because they live in an "artificial environment"? How about things like German cockroaches (which are so specialized for an "artificial" environment that they cannot live away from humans and are not found anywhere in the wild)? Thanks, once again, for clearly showing everyone how utterly vapid and pig-ignorant you actually are, Blast.

    PaulC · 18 November 2005

    Here's where I beg to differ with Lenny (and nearly everyone else here, so it seems).

    I don't want anyone to think I don't understand the issue of cherry picking. The problem with "Bible codes" and other exercises in numerology and specious pattern discovery is that they propose a scheme more complex than the pattern they claim to discover. This is akin to any other over-specified explanation. Give me any n points and I can give you an (n-1)-degree curve that interpolates them perfectly.

    However, it is possible to develop statistical models and other explanatory theories for datasets of unknown origin. E.g. if I find a straight line that goes through 1000 points, I have a parsimonious explanation for them in far fewer degrees of freedom than the data. If it doesn't quite go through them, but shows a good least squares fit, I have a linear regression model. This is not numerology, but a well-accepted modeling technique that appears in numerous peer-reviewed papers every year.

    By analogy, "degrees of freedom" can be restricted in discrete parameters connected to a model. Cherry picking is a real problem, and shows up in a lot of pseudoscience, but it is not an all-powerful way of producing any bogus claim from data, provided you restrict your model to few parameters relative to the amount of data to explain.

    'Rev Dr' Lenny Flank · 18 November 2005

    you actually sound intelligent in your discussion

    That is because I, unlike you, do not presume to speak upon topics I don't know anything about. I, unlike you, limit myself to speaking on topics I *do* know something about; as for topics I *don't* know anything about, I limit myself to asking questions of people who DO know them, so I can learn from them. I, unlike you, am not such a putz that I brainlessly cut-and-paste big long regurgiquotes from creationist crapsites that I don't even understand myself, and then try to tell everyone that they support the particular pig-ignorant argument that I am trying to make about a topic that I don't know anything about. Such as, say, _Pakicetus_ or _Caudipteryx_ or Baldwin or Waddington or snake venom. I leave that sort of silliness to YOU, Blast. You're much better at it than I am.

    Steviepinhead · 18 November 2005

    Or, Blast, you could always head over to the Charles-Darwin-In-A-Pan thread and explain to them how, of course, God would never miraculously "cause" Darwin's image to appear in any such mundane device and, of course, how this is just one more of an endless series of examples of the human mind imposing pattern on noise.

    And then you could explain to us again how you DO believe God miraculously "caused" various statues to bleed, sculptures to weep, and images of saints to appear in various holy artifacts and relics, and so on.

    The only difference being, of course, that YOU can tell a "real" miracle from a "fake" one, since YOU are infallible--your word, not mine--in such matters, while the rest of us mere mortals are not.

    Curious, though, how your "real" miracles always support your ingrained religious beliefs, isn't it?

    Maybe if your faith were a little firmer, you wouldn't feel this compulsive need to fill the chinks in your armor by pointing out the gaps in someone else's thinking.

    How's it go? Something about the mote and the beam?

    In, of all things, an eye, that, um, holy grail of the anti-evolutionary. Wouldn't you just know...

    Stephen Elliott · 18 November 2005

    Whoa..holds hands up.

    Posted by PaulC on November 18, 2005 07:59 PM (e) (s) By selecting a favorable key, I would think that you could probably manage to "recover" almost anything you wished. I'm starting to feel like I'm on a merry-go-round here, but to be brief, it depends on the size of the key. If you picked a k-bit key (*), then the most you could "recover" with it is anything with Kolmogorov complexity k or less. Thus, if you restrict such "cherry picking" to short keys, then you are effectively limited in what you could claim to "recover." This is a rigorous defense against objections of cherry picking, and is related to Solomonoff induction, the modern, rigorous theory that subsumes intuitive notions of scientific induction and Occam's razor. (*) In this context, key would mean a k-bit representation of the key and the decryption protocol in such a form that it could be run on an a priori chosen universal machine.

    Your technical knowledge far exceeds mine. I did not understand that at all. But this was what I was trying to get to.

    For instance, you could, with one key applied to a nine-codon sequence of DNA, produce the nine-letter "message": GODISREAL But by simply changing to a different key, you could also produce the nine-letter "message": GODISFAKE And with still another key, you can produce the nine-letter "message": ZEUSISGOD

    I am happy to admit that the (mathematics?) Are beyond my grasp, I just have a rudimentary understanding of the technical element involved in digital encryption using military/government radio/line transmission of encrypted messages. I was taught enough to install, fix and maintain the machinery.

    PaulC · 18 November 2005

    Sorry, I'll note that Lenny has added an important proviso:
    Depending on which key you choose, you can produce *any* combination of letters and/or numbers that happens to fit within the allotted space.
    Emphasis mine. Yes, I agree. You can cherry pick within a carefully restricted range depending on the length of your proposed key.

    'Rev Dr' Lenny Flank · 18 November 2005

    Your technical knowledge far exceeds mine. I did not understand that at all.

    Don't look at ME. I hated math, and nearly flunked all of the (very few) classes that I was forced to take. :>

    PaulC · 18 November 2005

    Your technical knowledge far exceeds mine. I did not understand that at all.
    Let's see. How would Johnnie Cochran put it? "If the key's too small, no cherries will fall." Sorry, that's not much help. I guess I don't have the gift of a catchy tag line. What I mean is that of course you can make up keys to find things that aren't there, but any falsely "recovered" pattern that came from cherry picking the key will be limited by the amount of information carried in the key itself. So, for instance, if you guess a 10-character key and it appears to decrypt a much longer document, you have reason to believe you found something interesting. If it merely "decrypts" a few scattered parts of the document, you are right to doubt the significance.

    'Rev Dr' Lenny Flank · 18 November 2005

    to be brief, it depends on the size of the key. If you picked a k-bit key (*), then the most you could "recover" with it is anything with Kolmogorov complexity k or less.

    That's right. But then, the length of the key is just as completely arbitrary as is its content. If you make the length of the key match the length of the "message" and use the "key" that you like, you can "recover" anything you want to out of the "message". :> In cryptanalysis, this problem is avoided by decrypting several messages at the same time (provided, of course, that all those messages used the same encryption system and key). Then, any sensible pattern that is found in one message but not in the others, is probably spurious (although any good cipher system will also have lots of "flash", or random/nonsensical sequences that are only placed there for precisely this reason). Only patterns that are found across all of the messages, can be considered potentially useful. Hence, you can't pick a meaning out of one message unless that very same process gives meaningful messages in all the others, too. Once again, the onetime pad system defeats this by eliminating any possibility of comparing patterns between messages. Hence, the analyst has no way to know whether any putative pattern is legitimate or not.

    Stephen Elliott · 18 November 2005

    Are we talking about lutskos' proposition about looking for encoded information in DNA?

    If so; what possible information would anybody have about the the "key code" used or the type of encryption used?

    DNA has 4 "letters" does it not?
    Yet only 2 need to be considered as 1 letter always oposes another.

    If I remember right DNA has the letters CAG&T. Right or wrong doesn't matter..call them ABC&D where A always oposes B and C oposes D. That is in effect a binary system on any one side (helix) or am I missing something important there?

    If you wanted to look for encoded information; how could you possibly choose length of key, how many times message was encrypted, type of encryption used etc.?

    By the way. My questions in this post are not facetious. I just don't know enough biology.

    'Rev Dr' Lenny Flank · 18 November 2005

    An an interesting aside (I was watching "Contact" on cable last night), all of these problems will become crushingly apparent if/when we ever receive a textual "message" from an advanced space civilization.

    It seems to me that, unless we have a fairly large number of messages, all using the same "coding" algorithm, we will never be able to "decode" it because we will never be able to tell what patterns are the right ones or not.

    'Rev Dr' Lenny Flank · 18 November 2005

    If so; what possible information would anybody have about the the "key code" used or the type of encryption used?

    None. That's the problem. :> Anyone can pick whatever method and key they like, keep the ones that give results they like, and toss out all the rest. And there'd be no way at all to tell whose results are "right" and whose aren't. Or even whether there actually IS any "code" there in the first place (since ANY random sequence of characters can, given the right "key" and algorithm, produce any "message" that you want to produce from it). As I noted, that's the problem with all the so-called "Bible codes".

    Stephen Elliott · 18 November 2005

    I can see no reason why there should not be advanced civilisations on other planets.

    Making contact might be problematic though.

    Looking at the age of the Earth and how short a time it has creatures capable of advanced research on it, we are looking at a very small timescale. Add to that the effect we are having on the sustainability of our species. The outlook seems glum. Shame.

    'Rev Dr' Lenny Flank · 18 November 2005

    I can see no reason why there should not be advanced civilisations on other planets. Making contact might be problematic though.

    Yep. Not much opportunity for conversation when each query/answer cycle takes 100 years or so. ;> Most people do not really understand how vast interstellar space actually is.

    Add to that the effect we are having on the sustainability of our species.

    Me, I've always said that if we humans want to destroy ourselves, we should at least be polite enough to move offplanet to do it, and not take all the rest of life on earth out with us. ;>

    'Rev Dr' Lenny Flank · 18 November 2005

    My goodness, we certainly have strayed awfully far afield of the original topic of this thread. ;>

    Stephen Elliott · 18 November 2005

    This comment reminded me of something.

    Most people do not really understand how vast interstellar space actually is.

    Quite a few years ago, myself and some mates (friends in USA speak) were staring at the stars. One member of the group came out with the comment "when you think about it, the distances in space are astronomic". Made me laugh and I have never forgotten it...yet.

    Anton Mates · 19 November 2005

    Actually, they frequently pop up without lab scientists culturing them. They've contaminated many other cell cultures unbeknownst to the researchers (which usually leads to the poor researcher being super-happy at how well his culture is suddenly growing!) They're now a successful invasive species of a very specialized and recent environment---the culture plate.

    — BlastfromthePast
    Anton, this is so strained an argument that I can't believe you're making it.

    It's not an argument at all, actually--just a couple of observations in response to your question of whether H. gartleri has to be cultured by scientists. I wouldn't think there needs to be an argument on that count unless you're arguing that that question is actually relevant to the classification of H. gartleri. Is that what you're arguing? And if so, why?

    You have an artificial environment, with a cell line that is no more than degraded human cells. If this is your definition of crossing the species barrier, then all it does it further point out what we already know: most variations are harmful. This hardly helps Darwinism.

    Hmm. So are you now arguing that H. gartleri is the same kind of organism as Homo sapiens? I mean, that's fine, nothing wrong with changing one's mind. I'm just not sure what side you actually came down on there. As for whether the genetic changes between H. sapiens and H. gartleri were "harmful"...well, Henrietta Lacks is dead. H. gartleri is not, and probably won't be for the foreseeable future, and by some estimates now packs more total biomass than Mrs. Lacks' body ever did. It seems that, far from being "harmed" by its evolution, H. gartleri has if anything enhanced its fitness. (Of course, to balance that out, Mrs. Lacks had children.) On the other hand, maybe by "harmful" and "degraded" you simply mean that human beings are better/cooler/smarter/more lovable than H. gartleri. I'm not sure I can argue with that, but that really has no relevance to evolutionary theory.

    k.e. · 19 November 2005

    Lenny only a 100 years turn around ?

    The nearest inhabitable solar system is how far away ?
    20,000 -40,000 light years if the message was via radio(not sure on actual nearest imaginary planet)
    Turn around time 80,000 years (lets say)
    twice the time we went from nomads to now and who knows what in another 40,000 years.

    What should an interstellar message have

    a simple fax would do it repeated over and over

    A picture of my family with and my dog.

    Guess what ?

    we are already doing it

    the first "I love Lucy's are what ? 50 Light years on their way to some nomad on the planet Zork or 2 brains in a bottle on a remote star-ship in a solar system far far away

    BlastfromthePast · 19 November 2005

    As for whether the genetic changes between H. sapiens and H. gartleri were "harmful"...well, Henrietta Lacks is dead. H. gartleri is not, and probably won't be for the foreseeable future, and by some estimates now packs more total biomass than Mrs. Lacks' body ever did. It seems that, far from being "harmed" by its evolution, H. gartleri has if anything enhanced its fitness. (Of course, to balance that out, Mrs. Lacks had children.)

    Vous etes francais, ne-c'est pas? Anton, Henrietta Lack walked and talked. H. gartleri never will. Isn't that an awful lot of "loss of fitness"?

    'Rev Dr' Lenny Flank · 19 November 2005

    Anton, Henrietta Lack walked and talked. H. gartleri never will.

    Um, how do you know that? After all, it already has ALL the genetic information necessary to do so. The ultimate example of "frontloading", eh Blast? (snicker) (giggle)

    Isn't that an awful lot of "loss of fitness"?

    Isn't that "two different kinds"? One of which, uh, evolved from the other? Or do you think the walking talking Henrietta and the non-talking non-walking single-celled life form gartleri are the SAME "kind" . . ? Which is it, Blast. Same kind, or not. And how can you tell. (This should be good. . . . . ) BTW, Blast, pine trees don't walk or talk either, and they seem to be pretty damn "fit", since they've been around for millions of years. Henrietta was fit for her environment. Gartleri is fit for its.

    Anton Mates · 19 November 2005

    Vous etes francais, ne-c'est pas?

    — BlastfromthePast
    One of the few countries I don't have ancestors from, actually.

    Anton, Henrietta Lack walked and talked. H. gartleri never will. Isn't that an awful lot of "loss of fitness"?

    It would be if H. gartleri had the same sort of life history as a human being, but, of course, it doesn't. As Lenny said, plenty of organisms get by without walking or talking. The ability to grow and reproduce from a single cell is much more useful than the ability to dance or write poetry...when your niche is a Petri dish. Unless by "fitness" you mean "ability to do cool stuff," in which case I must repeat:

    On the other hand, maybe by "harmful" and "degraded" you simply mean that human beings are better/cooler/smarter/more lovable than H. gartleri. I'm not sure I can argue with that, but that really has no relevance to evolutionary theory.

    So, aside from your feelings on whether H. gartleri is fit or lovable or suited for political office--would you consider it within the Homo sapiens "kind" or not? I think your answer was still no, but I'm not sure.

    ben · 19 November 2005

    This is the kind of ad hoc hypothesis that makes neo-Darwinism unfalsifiable
    William Bateson, in his critique of Darwinism...
    This hardly helps Darwinism
    Etc., etc. I suggest that since IDiots endlessly try to use the 'Darwinism' straw man against evolutionary theory ('Darwinism' being a straw man because evolutionary theory has evolved far past Darwin and because evolution isn't an '-ism' at all but a scientific theory), it would be appropriate to start obstinately referring to their beliefs as 'Dembskiism' or 'Beheism', no matter how many times it may be pointed out that Dembski or Behe is not an accurate representative of their particular viewpoint. Mmm? And Blast, it's "n'est-ce pas." Vous n'êtes pas français, vous êtes ennuyeux simplement.

    'Rev Dr' Lenny Flank · 19 November 2005

    William Bateson, in his critique of Darwinism

    Bateson has been dead for almost 80 years. He never even knew what "DNA" was. (shrug) Once again, we see Blast's basic dishonesty, by citing century-old "science" and claiming that it represents state of the art. Hey Blast, I'm still waiting for you to answer my questions about HeLa, Blast. Or have you run away already?

    'Rev Dr' Lenny Flank · 19 November 2005

    I suggest that since IDiots endlessly try to use the 'Darwinism' straw man against evolutionary theory ('Darwinism' being a straw man because evolutionary theory has evolved far past Darwin and because evolution isn't an '-ism' at all but a scientific theory), it would be appropriate to start obstinately referring to their beliefs as 'Dembskiism' or 'Beheism'

    "Gishism" would be more accurate, since every ID argument I've ever heard was lifted, almost intact, straight from decades-old young-earth creation "science".

    Stephen Elliott · 19 November 2005

    decades-old young-earth creation "science".

    Something about the phrase, old young Earth creationism jars on the ear.

    Anton Mates · 19 November 2005

    I suggest that since IDiots endlessly try to use the 'Darwinism' straw man against evolutionary theory ('Darwinism' being a straw man because evolutionary theory has evolved far past Darwin and because evolution isn't an '-ism' at all but a scientific theory), it would be appropriate to start obstinately referring to their beliefs as 'Dembskiism' or 'Beheism', no matter how many times it may be pointed out that Dembski or Behe is not an accurate representative of their particular viewpoint

    — ben
    It's an old-if-not-exactly-honorable tactic in theological battles--the "Nestorians" and the "Arians" and all the other early Christian sects never called themselves that, they just called themselves "Christians." They'd call all the other guys by names derived from human founders/priests/prophets/bishops to make them look like dirty idolators. Tradition dies hard, I suppose. I prefer not to go that route myself, partly because a lot of creationists seem to be consciously proud of their allegiance to particular authority figures--indeed, they're quite happy to say that Dembski and Behe are both accurate representatives of their viewpoint, as is the Book of Genesis, even when they contradict one another or themselves. So I wouldn't imagine that calling it "Dembski-ism" or something would really bother them that much. Well, it'd probably bother Behe...

    'Rev Dr' Lenny Flank · 20 November 2005

    So I wouldn't imagine that calling it "Dembski-ism" or something would really bother them that much. Well, it'd probably bother Behe...

    I am quite sure that Dembski would see it as a badge of honor. He is, after all, precisely the sort of arrogant narcissistic full-of-himself prick who gets off on that sort of thing.

    BlastfromthePast · 22 November 2005

    Bateson has been dead for almost 80 years. He never even knew what "DNA" was. (shrug) Once again, we see Blast's basic dishonesty, by citing century-old "science" and claiming that it represents state of the art. Hey Blast, I'm still waiting for you to answer my questions about HeLa, Blast. Or have you run away already?

    Lenny, you can double-check this, but I'm pretty sure that when I mentioned Bateson I said "at the beginning of the 20th century." So, how am I being "dishonest." Nonetheless, Bateson's criticism is just as ripe now as then. He understood about "alleles" and their expression and the mathematics behind their expression. He saw clearly that the problem is one of producing "new" alleles. He didn't see anyway of that happening. It took Fisher, and his mathematics, to provide a mathematical basis for "new" alleles (basically, a mutation that then becomes "fixed"). This formed the basis of neo-Darwinism, or the Modern Synthesis--whatever you want to call it. Hoyle (and Wright--to some extent) criticize Fisher's mathematics as being overly optimistic about how quickly fixation can occur. When gel electrophoresis came into its heyday, this was a further bump for Fisherian neo-Darwinism. Those represent real hurdles. So, which side you come down on in this debate really has a lot to do on whether or not you trust Fisherian mathematics or not. About HeLa: Lenny, answer this for me: let's say a man decides he wants to become a woman. He has a sex change operation--the whole works. Is he now a man or a woman?

    BlastfromthePast · 22 November 2005

    So, aside from your feelings on whether H. gartleri is fit or lovable or suited for political office---would you consider it within the Homo sapiens "kind" or not? I think your answer was still no, but I'm not sure.

    There's a strange kind of logic that permeates the world of Natural Selection. Life, in its many-splendored forms, comes about through (as Dawkins puts it) Death!--the Grim Reaper at work. Now, cancer cells, these cells which "killed" this woman, these same cells--death itself--are now some kind of new LIFE-form? And is it really possible for "true believers" to so cover their eyes from reality that they can't determine whether human life is superior to cultured cancer cells?

    Steviepinhead · 22 November 2005

    The good Rev asked Blast about HeLa as follows:

    Anton, Henrietta Lack walked and talked. H. gartleri never will.

    Um, how do you know that? After all, it already has ALL the genetic information necessary to do so. The ultimate example of "frontloading", eh Blast? (snicker) (giggle)

    Isn't that an awful lot of "loss of fitness"?

    Isn't that "two different kinds"? One of which, uh, evolved from the other? Or do you think the walking talking Henrietta and the non-talking non-walking single-celled life form gartleri are the SAME "kind" . . ? Which is it, Blast. Same kind, or not. And how can you tell? Blast's devastating response, compsed after four days of, um, deep thought, was to answer Lenny's questions with a question:

    About HeLa: Lenny, answer this for me: let's say a man decides he wants to become a woman. He has a sex change operation---the whole works. Is he now a man or a woman?

    Lenny's sarcastic prediction about Blast's response:

    (This should be good... . . )

    Judge for yourselves. (Sigh.)

    argy · 22 November 2005

    Blast said:

    Now, cancer cells, these cells which "killed" this woman, these same cells---death itself---are now some kind of new LIFE-form?

    Are you saying that cancer cells aren't alive? Or are they of the "Death Kind?"

    Stephen Elliott · 22 November 2005

    Blast

    Posted by BlastfromthePast on November 22, 2005 06:44 PM (e) (s) There's a strange kind of logic... Now, cancer cells, these cells which "killed" this woman, these same cells---death itself---are now some kind of new LIFE-form?...

    Is a lion that kills a zebra a life form? Have I missed something fundamental here?

    penis enlargement · 11 January 2006

    Three phrases should be among the most common in our daily usage. They are: Thank you, I am grateful and I appreciate.