Dembski Finds the Transcript

Hilariously, Dembski has now deleted all his previous posts on Shallit "embarassing himself", and in his new post he doesn't even acknowledge that he got to the transcript only after days of whining the ACLU, the NCSE, and Shallit himself were hiding it (this while people kept telling him it was freely available, if he just looked for it). Not a word of apology, not an acknowledgment. The guy just cracks me up.

Someone should ask Salvador Cordova what he thinks of Dembski in light of this dishonest behavior.

My guess is he'll think something like "Bill Dembski is a sexy genius", if his previous sycophancy is any indication.

Did anybody save the Dembski posts before he deleted them? Or do we need to look in Google Cache?

Sin of pride.

I hear it goeth beofre a fall.

google cache:

http://64.233.167.104/search?q=cache:Aat6Dkz7FZwJ:www.uncommondescent.com/index.php/archives/438+site:uncommondescent.com+shallit&hl=en
http://64.233.167.104/search?q=cache:CQJL7DqBdnEJ:www.uncommondescent.com/index.php/archives/439+site:uncommondescent.com+shallit&hl=en

save those pages for posterity.

bets on whether Sal will decide to post in this thread?

> google cache:

Cool. I just printed the pages into PDF.

By the way:

http://web.archive.org/web/*/www.uncommondescent.com/index.php/archives/438

"We're sorry, access to http://www.uncommondescent.com/index.php/archives/438 has been blocked by the site owner via robots.txt."

F'n coward.

Dembski begins to tunnel

BTW, I think someone should download the whole blog.

hell, dembski's claims border on liable, much more so that whats-his-face's claims against Scott.

I wonder if Shallit will sue him?

naw, that's a pussy attitude reserved for IDiots like dembski et. al.

Dembski's revisionist history is no new thing. Didn't he promise to put a timestaped webpage after his next cunning ruse? URL, anyone.

The great irony is of the course that the Fig Newton of information theory who can tell us how to find go.....intelligence in the design of things can't find a publically available document on the web. I eagerly await his next book, "finding your arse with both hands, a guide for christians".

lol. don't doubt he would write just such a book if he thought it would make him some bucks. It's all he's about.

Someone should ask Salvador Cordova what he thinks of Dembski in light of this dishonest behavior.

Street theatre is good description of the entire intelligent design debate.

btw, a synthesis of BD's lies would be a good thing to post on any open reviews of his books. He obviously lives on book incomes and grants from DI, so why not encourage folks to stop sending him money?

or would that be like trying to convince folks to stop sending Pat Robertson money?

Mona Lisa: Don't you wanna know why Trotter gave you his files? Vinny Gambini: I told you why already. Mona Lisa: He has to, by law, you're entitled. It's called disclosure ...

He obviously lives on book incomes and grants from DI, so why not encourage folks to stop sending him money?

In his latest post regarding Shallit's deposition Dembski refers to his "technical" articles on the so-called "mathematical foundation of intelligent design." He asserts that these articles respond to Shallit's critique. This is not true. As far as I know, there are so far three such articles. One of them was dated many years back, so it obviously could not in any way respond to Shallit. The other two - one introducing an allegedly novel measure of information which Dembski dubbed Variational Information or something like that (but which in fact is a well known for over 40 years Renyi divergence of the second order), and the other about a search for a small target in a large search space - contain nothing that can be construed as a response to Shallit's critique. This reference to his other articles as allegedly responding to Shallit is just one more display of Dembski's habitual tactics of evasions and distracting maneuvers instead of a decent response to critique. Besides Shallit, Dembski has never responded in a substantial way to many other critics of his output (and I am just one of such critics)- instead he resorted to supercilious and dismissive remarks - so this most recent story about Dembski supposedly being unable to locate Shallit's deposition adds little to what is known about his concept of honesty anyway. There is ample material documenting Dembski's often unethical behavior both on this blog and on Talk Reason (see here)

I'm dying to hear how his toadies will defend this behavior. It's not defensible on its own, so they can only attempt to distract attention away from it with a tu quoque argument or pointing fingers at others. So let's hear what they have to say. Salvador? O'Brien? DonaldM? Let's hear you defend this dishonest and Orwellian behavior.

— Ed Brayton

Core Values [T]here are many "core values" behind such a God-centered mission. For instance, the seminary wants its students to have a passion for the Great Commission. It also wants its students to maintain personal integrity and to have God-honoring families. -- Personal integrity. "We as an institution must take responsibility to make certain that those who serve here, teach here, lead here and govern here ... know that that is a non-negotiable expectation," he said. "Nothing will destroy a ministry ... so immediately ... than a default in personal integrity."

The position at Southern Baptist may look like a step backward, Dembski said, but it really just requires a different tack. "I see it as a very strategic move in terms of getting my ideas and the conception that I have of science and theology into the mainstream, that is, through people who are very much like-minded,"

I'm not completely clear on your point. Surely you're not suggesting that the DI would cut off grant support for dishonesty, lack of integrity, sleaziness, or anything else this whole exchange highlights? Heck. Those are minimum qualifications to get a DI grant in the first place.

R.O., this is nothing to do with whether or not Dembksi has the right to ban posters with dissenting viewpoints. It's a question of whether Dembski is even capable of admitting he had ever made a mistake.

I've met this kind of person in my own life, and what I've seen borders on the pathalogical. They just can't do it. They evade, cover up, deny, make excuses, trivialise... anything to avoid saying the words "I was wrong".

Every. Single. Time. Dembski has been shown to be incorrect about something he has gone way way out of his way to employ one of these tactics. He's simply incapable of owning up to his mistakes.

He does all his loyal ID acolytes or the ID movement in general any favours with this behaviour. But to be honest, I see no chance of him changing since this pathology appears to be rooted too deep in his personality.

just a general point...

Dembski's whole attack against Shallit is EXACTLY the same strategy used by DI folks in general, it's just a form of projection I like to call "the mirror strategy", also known from elementary school days as, "I know you are, but what am I". All he did was preempt the discussion about his being pulled from testimony (first in Kansas and now Dover), by accusing his opponents of exactly the thing he himself is most representative of. That is, being an embarrasment.

I responded to you here

Slightly but not entirely OT: Seeing as my accounts and comments at Dembski's blog get deleted faster than I can make them (due no doubt to excessive civility and a desire for open intellectual discussion that is so fatal to a good blog conversation), I'll post here. Trying to deal with Dembski is an exercise in frustration. This is in response to Ben Z, comment #4, asking whether or not Dembski answers his critics: http://www.uncommondescent.com/index.php/archives/480#comments

My comment:
"I present these two links for you to decide for yourself whether or not Dembski answers his critics. I think the answer is pretty clear. Go read em!

In this first link, read the second comment. That is my personal experience with Dr Dembski.
http://pharyngula.org/index/weblog/comments/carl_zimmer_speaks/#comments

This second one just popped up a few days ago, and parallels my experience nicely.
http://groups.google.com/group/talk.origins/browse_thread/thread/4e5fd9969e110739/5ab009b3eedd12af#5ab009b3eedd12af

Oh, and Hi Panda's Thumb!

Why would anyone 'respond' to Dembski or comment on his papers, allowing him to revise 'history'? Dembski's approach of 'using critics' has been well documented.
If and when Dembski gets something published in a respectable peer reviewed journal, it will be the time and place to show what's wrong with his arguments this time around.

yeah, uh, your response is to say "no comment".

BD's behavior left you speechless?

Wolpert and Macready (2005) generalize this set-up but don't add anything fundamentally new to it.

On an earlier post, a couple of links were given. I found this interesting little bit of information on one of the posts there:

"A common confusion is between the expert witness statement and the deposition. What is available at the NCSE is the expert witness statements (for all expert witnesses in the case)."

Are you perhaps confusing the expert witness statement--given by Shallit to the ACLU attorneys weeks before Dembski's deposition, with the deposition taken from Shallit by the TMLC weeks after Dembski's deposition?

It's actually funnier, considering the deposition was made by his side in the trial. Wouldn't TMLC give him a copy? He could have got it any number of ways without resorting to "street theater" (i.e., lies, baseless accusations, and whining).

— Paul C

Blast

Here is the link to Shallit's deposition taken from Dembski's blog. You appear to be the one who is confused. Have a read and all will become clear.

Blast being confused is a perpetual state for him. pointing out actual facts will not alleviate his condition. there is no cure.

The only reference to Wolpert is

Wolpert and Macready (2005) generalize this set-up but don't add anything fundamentally new to it.

— Alan Fox

How is this a response?

One approach is to limit the fitness functions(see Igel and Toussaint 2001). Another, illustrated in David Fogel's work on automated checker and chess playing (see, for instance, Chellapilla and Fogel 1999 and Fogel et al. 2004) and, more recently, given a theoretical underpinning by David Wolpert and William Macready (2005), is to limit optimization problems to search spaces consisting of agents that play competi-tively against one another. In this brief note, I focus on the latter attempt to get around the force of No Free Lunch.

Blast being confused is a perpetual state for him. pointing out actual facts will not alleviate his condition. there is no cure.

— Sir Toejam

The facts are the deposition have been available as a matter of public record for a long time, dembski saying

"Dembski has explained on his blog that he can't get a copy from the TMLC because the case is still in the court system, and judges and courts looked badly on these sorts of things."

Was a lie to cover up for his own ineptitude.

This is proven by his deletion of his court system assertion and other threads on his blog to cover up and bury the truth.

Read the facts and do not let Dembski's contortions confuse you. His 'explanations' are just not that credible given the facts.

Hint: These documents are public records

ok - here's you go, Blast. the discussion here is about Dembski lying about:

-why shallit was not allowed to testify
-the fact that his deposition was a matter of public record
-the fact that Dembski quickly removed all traces of his accusations once he received a copy of the Deposition, and calling all his previous posts "theatre".

right, so now that we have thoroughly (and unecessarily, pardon me) established that you have no clue what's going on, can i continue with my invective?

you really are dumb as a box of hammers

happy now?

So let's hear what they have to say. Salvador? O'Brien? DonaldM? Let's hear you defend this dishonest and Orwellian behavior.

Someone should ask Salvador Cordova what he thinks of Dembski in light of this dishonest behavior.

Is gay marriage legal where Dembski resides?

RBH: "No need to ask Salvador. We did the same thing on ARN: deleted a whole multi-post thread that he had started in which he was being embarrassed. He and Dembski are an excellent pair."

??? Did you mean "He" instead of "We?"

Um, yeah, "He did". Love that preview!

RBH

lol. yeah, uh, your response is to say "no comment".

serious question:

do you think their faces get all red and they curl their hands into fists when we laugh at them for being so silly?

I do.

C'mon, give Robert "proud to be ignorant of computational number theory" O'Brien a little credit for not denying his status as Dembski's "toadie."

I should have attributed that to "Paul C," not Toejam.

I do deny that, actually. So sorry to disappoint.

Dembski has explained on his blog that he can't get a copy from the TMLC because the case is still in the court system, and judges and courts looked badly on these sorts of things.

I think it is sad that Dembski is so dishonest. I have posted comments a couple of times on his website - perfectly polite and slightly, but not particularly, challenging - and they have always been deleted. I do not think that design is necessarily unscientific - his chessboard analogy is a good one and if we found something that, after a long period of time, no one could imagine being produced by an evolutionary pathway, then we could entertain "design" as a possibility. But the fact that Dembski, and i presume the rest of the "design" community, refuse to engage in honest, open discussion means that no one will take them seriously even if they really had a point.

if we found something that, after a long period of time, no one could imagine being produced by an evolutionary pathway

To suppose that the eye with all its inimitable contrivances for adjusting the focus to different distances, for admitting different amounts of light, and for the correction of spherical and chromatic aberration, could have been formed by natural selection, seems, I freely confess, absurd in the highest degree. When it was first said that the sun stood still and the world turned round, the common sense of mankind declared the doctrine false; but the old saying of Vox populi, vox Dei, as every philosopher knows, cannot be trusted in science. Reason tells me, that if numerous gradations from a simple and imperfect eye to one complex and perfect can be shown to exist, each grade being useful to its possessor, as is certainly the case; if further, the eye ever varies and the variations be inherited, as is likewise certainly the case; and if such variations should be useful to any animal under changing conditions of life, then the difficulty of believing that a perfect and complex eye could be formed by natural selection, though insuperable by our imagination, should not be considered as subversive of the theory.

how can you disappoint us by saying exactly what we expected you to say?

In fact, why do you think anything you do would "disappoint" us in any way, for that matter?

Dembski certainly doesn't disappoint. We expect a certain behavior from him; it's [sic] been documented MANY times. In fact, rather than disappoint, folks like Dembski and yourself [sic] are so predictable as to very [sic] valuable. Keep it up.

Darwin would be amazed to learn how well his ideas have been and continue to be vindicated by the evidence.

Dear Sir_Toejam
I am a physicist and no fellow-traveler with the ID crowd. On the other hand, I cannot rule out the logical possibility of naturalistic design: after all, its not unthinkable that some day we can ourselves create artificial organisms. I therefore do not think it heretical to allow for the possibility that some sort of "design inference" could be justified and I do not think that appeals to authority rule it out. Although I do not agree with the "reasoning" of Demnski and his crowd, I do think it is healthy to have honest skeptics nipping at the coat tails of scientists - god knows we are used to them in physics. Thus my comment that I think it sad that Dembski et al are not honest in their critisims.

I was being facetious

Comment #56750 Posted by Throwaway Comment on November 12, 2005 01:33 PM (e) (s) Sin of pride.

Rod Flanders: Well, those folks from the senior center sure will love that peach tree we planted. I wish we could see their happy faces. Ned Flanders: Ahh! Sin of pride, Roddy. Rod: I'm sorry! Ned: Ahh! Sin of regret!

Dr. Lutsko:

I see you are a UF alumnus. Welcome to the discussion.

I do think it is healthy to have honest skeptics nipping at the coat tails of scientists

I see you are a UF alumnus. Welcome to the discussion.

oops replace substantially with substantively.

are you sure?

er, i think we are still waiting on you to actually participate substantially in said discussion. ready yet?

it's not on me to do so, the request was extended to yourself by others first. Your response was "no comment".

i am still waiting.

Dear Sir_Toejam,
I find you to be a bit touchy. I think I am quoting when i say that, in regard to god(s), "i have no need of that hypothesis". Purely hypotherically, couldn't we - or any other scientifically sophisticated culture - produce a "designed" organism from scratch or by genetically engineering an existing organism? And couldn't said orgamism then defy explanation via evolution to future human or non-human scientists and thus make a "design inference" justifiable and indeed true? Before you label me a closet troll, let me again say that i do not believe design has any role in modern biology or highschool science and that i am not trying to set up a "gotcha". But I do think it disengenuous to claim that design cannot, in principal, be a reasonable hypothesis.

Unbelievable dishonesty! And this is the first time I ever heard of a "street theater defense". Has he any scruples?

If Bill was in error, he should acknowledge his error. Better?

Robert O'Brien who signs now as R.O. can't respond at this time on the substance of the discussion - he must be very busy teaching Dr. Rachev about Kantorovich metrics; when he is done with Rachev, his next task will be explaining Kantorovich metrics to PT denizens as he promised to do a long time ago. So, don't bother him with questions. Great minds need concentration.

Sir Terriblename, what do you want R.O. to say? There's no exculpatory defense for Dembski's dishonesty in this situation. To his credit, R.O. isn't even trying to make one.

produce a "designed" organism from scratch or by genetically engineering an existing organism

Sir Terriblename, what do you want R.O. to say? There's no exculpatory defense for Dembski's dishonesty in this situation. To his credit, R.O. isn't even trying to make one.

And couldn't said orgamism then defy explanation via evolution to future human or non-human scientists and thus make a "design inference" justifiable and indeed true?

— lutsko

Robert O'Brien who signs now as R.O. can't respond at this time on the substance of the discussion - he must be very busy teaching Dr. Rachev about Kantorovich metrics; when he is done with Rachev, his next task will be explaining Kantorovich metrics to PT denizens as he promised to do a long time ago. So, don't bother him with questions. Great minds need concentration.

If Bill was in error, he should acknowledge his error. Better?

True, he claimed he responded.

This event reminds me that we need a Best Of section on the front of PT. So if new people want the lowdown on Bill Dembski, Mike Behe, etc, they can get, say, the best 10 posts about those guys.

Dear Sir Toe_jam,
(I do not know how to do the fancy quotes so i will content myself with adressing responses to you.)
I agree with you that the method used by the DI crowd is completely subjective and, hence, worthless. However, as a purely intellectual point, it is not outside the realm of possibility that one could prove, in a mathematical sense, that it was impossible to reach a particular genetic sequence from existing, or hypothesised previous sequeneces, via natural selection or any other known evolutionary mechanism. This would always leave open the possibility of some unkown mechanism, but it would also make design by some culture a respectable hypothesis. No?

gees, wouldn't that get about 90% filled by Sal's posts? i think they reflect on dembski about as well as facts do.

I'm going to email Salvador. We need his input on this matter.

However, as a purely intellectual point, it is not outside the realm of possibility that one could prove, in a mathematical sense, that it was impossible to reach a particular genetic sequence from existing, or hypothesised previous sequeneces, via natural selection or any other known evolutionary mechanism. This would always leave open the possibility of some unkown mechanism, but it would also make design by some culture a respectable hypothesis. No?

— lutsko

Here is the link to Shallit's deposition taken from Dembski's blog. You appear to be the one who is confused. Have a read and all will become clear.

— Alan Fox

lutsko,

Welcome to the discussion. For the record, I don't think you're a closet troll.

I think your point is extremely valid, and worth considering: the possibility certainly exists that we could be the creations of a naturalistic intelligence. In fact, the possibility exists that we are the creations of one or more supernatural intelligences.

It's important to realize, though, that this is not what the ID debate is about. ID is not the assertion that life was likely to have been designed. It is the assertion that we can objectively demonstrate that it is so that life was designed. The tools ID proposes as design detectors, however, turn out to be nothing beyond assertions (couched in formalistic mathematical or philosophical jargon) of "purposeful arrangements of parts" or criticisms of the incompleteness of our current evolutionary theory.

ID also suffers from a more significant problem. If (as ID claims) it is impossible in principle for something as complex as life to emerge through naturalistic processes, then we are left with an appeal to supernatural causation. This presents a particular problem for our concept of science, for if you allow yourself to appeal to the supernatural in one instance, there is nothing stopping you from appealing to it ever after. And the supernatural is simply not accessible to scientific investigation, even if (like the Kansas Board of Education or Alvin Plantinga) ouy redefine science to mandate the supernatural's inclusion.

I hope you stick around. The invective around here can get a little tiresome, but I think we could use some thoughtful questioners challenging our own presentations of the debate.

-Matt

Dear PvM,
I think that new hypothesis are accepted, despite being an argument from ignorance, when existing hypothesis fail to explain the facts. Even the proposal of a new evolutionary mechanism can be described as an argument from ignorance ("The existing mechanisms do not explain the facts so i propose the new mechanism ..."). The scientific tests are whether or not it predicts new phenomena and whether or not a simpler (in a particular sense) hypothesis is available. I agree that design will almost always seem the least-simple alternative. But there is no doubt we can imagine ourselves in a world "tainted" by the genetic engineering of some previous culture and therefore not truely explained by evolution. In fact, just to stir things up, let me propose the possibility of a world with designed organisms that can, also, be explained by evolution.

Please don't respond until you've read the deposition. Thank you.

— Blast

Bother. address, substantive. Sorry hit post before spell check

" it is not outside the realm of possibility that one could prove, in a mathematical sense, that it was impossible to reach a particular genetic sequence from existing, or hypothesised previous sequeneces, via natural selection or any other known evolutionary mechanism"

lutsko,

I disagree that all attempts to propose a new hypothesis are "arguments from ignorance". An argument from ignorance is one in which a conclusion is assumed to be true simply because it has not been proven false. New hypotheses are accepted (or should be) because they better account for the evidence than do the old hypotheses.

This is related to the fallacy of the false dilemma. ID proponents assume that by poking enough holes in evolutionary theory, they have sufficient warrant for ID.

ID is proposing an unknown mechanism (rather, it is proposing no mechanism -- see Behe's cross examination) to account for evidence that (it is said) the mechanisms of modern evolutionary theory have not yet accounted for. (And ID is not merely saying that evolutionary biology has failed; it's saying that evolutionary biology cannot in principle succeed.)

-Matt

This would always leave open the possibility of some unkown mechanism, but it would also make design by some culture a respectable hypothesis. No?

Futhermore whilst relativistic and quantum mechanics can be considered a Kuhn Paradigm shift, they were not accepted just because they were different than the status quo, but better than the status quo. Better in the sense they could predict, be tested and were useful.

ID on the otherhand is different but so is FSM, the key fact is that ID doesnt predict, cant be tested and isnt useful.

max - gotta use < brackets instead of [ to enclose your markups

lol. i mean angle brackets (shift of comma and period) instead of square brackets.

sorry.

Dear PvM, I think that new hypothesis are accepted, despite being an argument from ignorance, when existing hypothesis fail to explain the facts. Even the proposal of a new evolutionary mechanism can be described as an argument from ignorance ("The existing mechanisms do not explain the facts so i propose the new mechanism ...").

— lutsko

The scientific tests are whether or not it predicts new phenomena and whether or not a simpler (in a particular sense) hypothesis is available. I agree that design will almost always seem the least-simple alternative.

But there is no doubt we can imagine ourselves in a world "tainted" by the genetic engineering of some previous culture and therefore not truely explained by evolution. In fact, just to stir things up, let me propose the possibility of a world with designed organisms that can, also, be explained by evolution.

I've read the deposition in its entireity. From page 150 on, and for about twenty more pages, yes, the deposition is a little embarassing. Shallit is made to seem like he has no substantive arguments against Dembski, save one; and that one is, more or less, trivial. Dembski's characterization is not completely unfounded.

btw, i thought we were talking about DEMBSKI here, not shallit.

you can post on debmski's blog where he has an area all set up for your commentary on Shallit's deposition, Blast. However, any substantive comments based on fact will surely be deleted.... oops, then you have nothing to worry about. forget i mentioned it.

The funny thing is proposing designers created life that is indistinguishable from evolutionary processes reduces dembki to nothing more than a Nominalist that has nothing at all to do with empirical science. Apparently Dembski is a distinguished Philospher and should understand these undergraduate concepts.

But then again for someone who abuses Kuhn to such an extent its no surprise.

Lutsko says:

Although I do not agree with the "reasoning" of Demnski and his crowd, I do think it is healthy to have honest skeptics nipping at the coat tails of scientists - god knows we are used to them in physics.

I say:

Well, I partially agree with you. Especially when its directed by rational opposition and followed up with a healthy resultant dialectic--you know, science. Alas, I'm sure you agree that we can't always expect rationality to be the nutrient in the soil of the competition. As you say, physics has its share of loonies keeping the physicists on their toes, and yeah, that's probably a good thing.

But to call the antics of the creo gallery "honest skeptics nipping at the coat tails" is a serious distortion. To have anything similar to what the evolutionary biologists are dealing with, physicists would be up against one of the most powerful religions in the world trying every dirty trick in the book to teach Genesis creation in equal standing with astronomy class. "Seven days, are you nuts!?!?!" You'd have to drag some of your best minds away from the lab and into court every couple decades to deal with this crap in an increasingly hostile political landscape. Everything the physicists say makes good sense to them, because they are educated but the public at large seems to get it less and less as the decades roll on.

So while I agree with you in spirit, there really is no comparison. Ask yourself this: if the creationists win the fight against biological evolution, which scientific discipline is next in line?

hmm. not sure i would ever use the words "dembski" and "distinguished" in the same sentence, but that's just me.

Yeah sorry, i forgot to put the quotes around 'distinguished'. I considered the obvious letter substition to Dumbski, but thats way too easy.

letter substition to Dumbski, but thats way too easy

D*mbski is my personal favourite.

in fact, now that i think back, the whole "dumbski" debacle was related to yet another of Dembski's Dishonesties (TM)

Well, he's certainly distinguished himself as a dishonest, pseudo-intellectual twit.

in Comment #56832, by Sir_Toejam:

"show me an honest supporter of ID as real science"

All skepticism is healthy, but when couched in terms including Nigerian bankers and arguments from incredulity, which apparently are a dime a dozen, we get into pissing matches, not science. Science, based on data, but depend only on data and not personal belief. One can actually support, as Dr. Lutsko suggested, any so called "improbable" theory and still be doing science, as long as one is DOING science. Instead, we are heading down the long and damning road of the argumentum ad hominem and congratulating ourselves for our insight. Sins of pride, indeed.

"However, I'm sure if god decided to stick around and contol everything that happens in the world in a demonstrable fashion, then science would no longer be necessary at all, would it?"

Since when did one have to support continual creation and designing to support initial creation and design?

Since when did one have to support continual creation and designing to support initial creation and design?

We all hang out here and get toxic doses of creationism*, so when someone like Lutsko comes by who isn't deeply familiar with the ID Project, and doesn't know how foul and malevolent it is, we perhaps overreact.

_________________________________________
*The FDA recommends a maximum limit of 300 milliTards of creationism per year. On Panda's Thumb we get 1700--2000 milliTards. It doesn't affect mortality, but it does increase clinical signs of rage.

who's overreacting? don't you find lutsko's premise a bit disturbing, coming from a physicist?

got nothing to do with ID biases, I find his singular evidentiary inferences to be disturbing all on their own.

I never implied he was a troll, tho.

Myself, I use a TLD badge provided from Panda's Thumb's Creationism Exposure Safety department. It's very unobtrusive, and every quarter, you can see how many milliTards of creationism you were exposed to.

The FDA recommends a maximum limit of 300 milliTards of creationism per year

We are fortunate in this day a Google world can allow us to never permanently destroy all digital data, or at least that which Google's webcrawlers can find. So, Google's caches maintain that Dembski's words are immortal, at http://66.102.7.104/search?q=cache:Aat6Dkz7FZwJ:www.uncommondescent.com/index.php/archives/438++site:www.uncommondescent.com+Dover+Shallit&hl=en

don't you find lutsko's premise a bit disturbing, coming from a physicist?

And I didn't mean to single out you, Sir Terriblename, I generally agree with your comments (though I think you've occasionally misunderstood me in the past) I just didn't want Lutsko to get a bad impression of Panda's Thumb the moment he shows up. People like us are so close to the problem, and familiar with the force of ignorance supported by ID, that we have hair triggers.

and i agree with your (and lutsko's) assesment that I'm getting a bit too touchy these days.

I'm just gonna take a breather and come back after i do something a bit more productive ;)

cheers

One example is, I knew a physics grad student at NCSU who heard about the moon landing skeptics. And so he thought about it, and at first came up with a list of conditions which would imply that they were right. And he analysed the radiation, and the physics of landing on the moon, and such details, and initially actually said he thought these skeptics might have a point. Eventually, he realized that the case against the moon landings depended on a much more unlikely set of conditions, than the truth, and dismissed the skeptics. I remember this event because after he made the case for how the skeptics could be right, some wag pointed out that the proffered scenario was so complicated, and involved so much work, that "it would be easier just to go to the damn moon and be done with it."

The thing I have to keep remembering is, for every malevolent jerk like Dembski, there are 1000 Cordovas and Wagners, people who just don't get it, but really are trying to do what they think is right. That keeps me from getting too mean. Though occasionally something happens so offensive, I start instantly channelling Great White Wonder, and have to talk myself down.

BTW, Sir Terriblename, you are invited to the Waterloo Party, which shall be a night of drinking and celebrating, to take place the weekend the Dover verdict is issued.

Sir_Toejam wrote:

"that wasn't the argument. the argument is, if there were other mechanisms demonstrable to explain observable phenomena, like a physical deity that snaps his fingers to make changes and shows all how it's done, then why would we even need science."

And that point was made after the post I replied to you in, not by you, so I was arguing on what YOU said. After all, you had already implied that there is no honest support of ID, and this itself was an unproven, biased slur against particulars, not a scientific statistical assessment of the data presented (if I am wrong, show me). This is why I used the comment regarding the argumentum ad hominem, and also why I included an reference to Dr. Lutsko's earlier comment.

"What is the function of science in your mind? maybe then your argument might be a bit clearer."

Investigation, seeking knowledge, and doing so with the minimum of bias allowable in a system. But then, P. D. Medawar wrote in 1969 that "Innocent, unbiased observation is a myth." Science must be observed, it cannot be done without an operator to examine any output, and to get an output, you require an input. To test a theory, for example, you require not only the theory (input), but how to observe it (input), criteria of observation (input), and so forth. All of which can be biased by eliminating options another may include. By rejecting a potential outcome -- e.g., carbon-dating is correct -- one ends up with a biased result: carbon-dates are crap.

"i think you are conflating arguments here."

I think I am arguing about what YOU said, and read an earlier comment from Lutsko that fed into my reply that, as far as I saw in my biased viewpoint, mattered into what I wrote.

"Lutsko did not even suggest any theory, let alone an improbable one."

Why would he have needed to explicate a particular theory to remark on how to theorize and collect data? My use of the term improbable, also in quotes, was to bring attention to this thread of thinking I have described in this post, that people bring their biases to the table to "discuss" their opinions about data, not to clinically assess the data itself (which Ed Brayton, Mark Perakh and others HAVE done with less vitriol).

For the record, while it is possible Toejam may beleive otherwise by now, my initial look into the data has brought me to the opinion that intelligent design is wrapped up creationism, I can only argue FROM the data, and not my opinion. I am, apparently, agnostic in the nature of God, and have sought only to seek science for it's ability to distill data, rather than support my own theories or opinions, and since I work in biomechanics to at least some degree, with evolutionary biology to a larger degree, I am directly involved in determining how processes develop and relate to one another. So this philosophy of input and output matters implicitly, which is why one needs to have an open outlook and not locking oneself into Plato's Cave and throwing away the cross-shaped key.

Also invited is Lenny Flank (hey Lenny, I was born in Lake City, and lived there for 20 years), professor Steve Steve, who I think might hit it off with my Pookie Bear and get a little lovin down by the fire, and any and all PT regulars and irregulars, creationists excepted.

but why, if his ideas have merit, doesn't Bill adress Shallit, Perakh, Wolpert, Elsberry on the subsantive points they make?

— Alan Fox

These probability spaces are multidimensional and highly complex---it's hard to get a mental picture of what it all looks like. And, so, it's entirely possible that Wolpert, et. al, aren't quite getting what Dembski is saying (or, trying to say) and Dembski is not doing a good enough job of communicating it, yet realizes that, nonetheless, their arguments are wrong and then decides not to take the time to correct it. Just a theory.

This would always leave open the possibility of some unkown mechanism, but it would also make design by some culture a respectable hypothesis. No?

By the way, I have a letter to the editor in on Perakh's article in the Skeptical Inquirer. To me his logic is all wrong.

I do not think that design is necessarily unscientific - his chessboard analogy is a good one and if we found something that, after a long period of time, no one could imagine being produced by an evolutionary pathway, then we could entertain "design" as a possibility.

I cannot rule out the logical possibility of naturalistic design

it is not outside the realm of possibility that one could prove, in a mathematical sense, that it was impossible to reach a particular genetic sequence from existing, or hypothesised previous sequeneces, via natural selection or any other known evolutionary mechanism.

Even the proposal of a new evolutionary mechanism can be described as an argument from ignorance ("The existing mechanisms do not explain the facts so i propose the new mechanism ...").

But I would go further: such a proof isn't possible, because "natural selection or any other known evolutionary mechanism" is not well enough specified to be amenable to mathematical proof. Deductive proofs require every single detail to be nailed down unambiguously. So your statement is incorrect, such a proof is not within the realm of possibility --- no possible string of mathematics can be a proof that some genetic sequence cannot evolve "via natural selection". Don't forget that "natural selection" includes things like cosmic radiation and meteor strikes. What sorts of rearrangements of the genome by any possible physical cause might be provably impossible, hmmm? Really, the claim is quite silly.

his chessboard analogy is a good one

So BillD calls his missteps street theatre? He is giving that lively and rich art form a bad name. We have better term in Hindi to describe this sort of behaviour - nautanki.

Dembski simply confirmed that he's a clown.

One might argue that, by this logic, ToE is unfalsifiable. But falsification need not be deductive; precambrian rabbit fossils aren't logically inconsistent with ToE. Ok, so instead of a deductive proof, perhaps it could be proven that evolution of some genetic sequence was incredibly unlikely --- as unlikely as precambrian rabbit fossils. Such a proof would falsify ToE. But all this says is that it is within the realm of possibility that the ToE could be falsified, which is not news. Certainly no such proof has been presented.

William Dembski finally managed to find the transcript of Shallit's testimony. ..

As a couple of commenters have noted on Dembski's blog, pages 74 to 77 of the deposition are missing from his copy, while the one posted on the NCSE web site is complete. Coincidentally, pages 74 to 77 are one of the few places in the Deposition where Thompson's questions manage to stray into relevance, thus giving Shallitt the opportunity to make a few telling points about the worthlessness of the concept of specified complexity.

P.S. Just to warn-- something is buggy about David Wilson's link just above my post here. Maybe the NSCE website doesn't like deeplinking or something, a lot of websites don't. As of the time of this post, if you follow Mr. Wilson's link above you will not be able to download the deposition (every link on the page will return a 404). However if you begin at the NSCE's top-level Kitzmiller documents page and navigate to the "APPENDIX III Tab O.pdf" file from there, you will correctly be able to download. So if you experience problems try doing that.

P.S. Just to warn-- something is buggy about David Wilson's link just above my post here. ....

However if you begin at the NSCE's top-level Kitzmiller documents page and navigate to the "APPENDIX III Tab O.pdf" file from there, you will correctly be able to download. So if you experience problems try doing that.

> We are fortunate in this day a Google world can allow us to never permanently destroy all digital data, or at least that which Google's webcrawlers can find. So, Google's caches maintain that Dembski's words are immortal, at http://66.102.7.104/search?q=cache:Aat6Dkz7FZwJ:...

You are wrong. Google cache expires eventually.

Coincidentally, pages 74 to 77 are one of the few places in the Deposition where Thompson's questions manage to stray into relevance, thus giving Shallitt the opportunity to make a few telling points about the worthlessness of the concept of specified complexity. Was the omission a chance accident resulting from blind naturalistic forces, or was some sort of designing intelligence involved?

To lutsko, I am willing to give the benefit of the doubt to you as a physicist who has just stumbled into the matter and whose interest has been piqued. However, you have made some points that cry out for a response. Following in the footsteps of others, here's my take:

1. There is no way of mathematically proving that an evolutionary step is impossible. You can try to estimate its probability, but even then you might find you have underestimated the chances if you treat evolution as a progression of base pairs in a fixed sequence. If you learn a little about evolution and genetics, you will be surprised at the number of mechanisms that can lead to evolutionary change, such as gene duplications and chromosomal dysjunctions and viral insertions and transposons, and so on and so on. It is not as easy as it sounds to estimate the probability of a given gene sequence evolving, let alone "disprove" it mathematically.

2. Even if you could mathematically prove that a certain set of genetic code could not have arisen by standard evolution, that does not prove intelligent design. It simply proves that there is a gap in our knowledge of evolution. And even if you could prove that evolution was not the mechanism, you still haven't ruled out some other naturalistic phenomenon. This is no different, in physics terms, to the incompatibility of Maxwell's equations and Newtonian physics. Physicists didn't deduce that an intelligent designer kept pushing electrical fields around. They tried to find a solution. Lorenz got in first with a mathematical adjustment, but it wasn't until Einstein that we got an explanatory theory to match the Lorenz contraction. Likewise, if intelligent design wants to be seen as a science it cannot be satisfied with finding flaws in evolutionary theory, or even with methodological naturalism. It has to come up with *positive* testable hypotheses. Lorenz derived a formula for contraction derived from the ether theory. Einstein found a better theory that dispensed with ether and was consistent with the Lorenz contraction. Hundreds of scientists constructed experimental to test relativity. Nobody said "Maxwell's equations are inconsistent with Newton's, therefore my Theory of Intelligent Light is correct by default." Now imagine the Theory of Intelligent Light being given equal time to Maxwell's equations and Newtonian physics in American schools in the 1880s because a bunch of powerful preachers said "teach the controversy"...

3. There are many flaws in evolutionary theory -- you only have to read a few issues of NATURE or SCIENCE to see genuine points of disagreement between theorists and real mysteries that remain unexplained. Given these flaws, it is easy to come up with examples of findings that appear to contradict standard evolutionary theory published in respected scientific journals. So you don't even need to construct artificial mathematical proofs of evolution's shortcomings. All you need to do is to read the literature. IDists see these as marketing tools ("A Theory in Crisis"). But real scientists see these flaws as opportunities to make exciting discoveries. They try to develop new theories and new testable hypotheses to extend our knowledge. They don't throw up their hands and say, "What happened in the Cambrian explosion? Who knows? Obviously it must have been God. We might as well cancel all our research into phylum differentiation."

*The FDA recommends a maximum limit of 300 milliTards of creationism per year. On Panda's Thumb we get 1700---2000 milliTards. It doesn't affect mortality, but it does increase clinical signs of rage.

I haven't read through all of the comments on here (so if this is repetitive, please excuse me), but isn't it ironic that Dembski calls calls Shallit obsessive and an internet stalker in the meanwhile Dembski has put so much effort into "exposing" Shallit. I disagree that Shallit is obsessive for questioning Dembski, but Dembski "should" be able to see the obsessiveness in his actions. I mean, he even admitted that, "The previous postings were a bit of street theater. I now have what I needed."

Doesn't that statement reflect that of an obsessive, stalking fool who repeats his actions until one gets what he so dearly needs?

Brian

Your reactions to honest questions are quite interesting. FWI, I am not a neophyte but have followed this issue for years: my interest in biology was first piqued when Dawkin's Self Gene and Wilson's Sociobiology came out and I have read extensively since then.

To Chris in particular, you say:
"1. There is no way of mathematically proving that an evolutionary step is impossible."

Really? Putting aside the question of whether anyone can issue such a catagorical statement, what if a sequence was found in the junk part of a chromosone of some organism which gave pi to a 100 digits in binary coding? Granted, that would not be a "mathematical proof" per say, but you get the point. And, despite your categorical statement, a mathematical proof may be unlikely, but is not beyond the realm of imagination.

I mean, be real. I am certainly not advocating ID in any form and I think Dembski is a poor, deluded figure, but the underlying question is not completely stupid, however improbable and I am surprised at the alarmed reactions my original post elicited.

To return to my point: personally, if pi where found encoded in a genome, my conclusion would only be that it proved there was life elsewhere in the universe but i would have little doubt that that life evolved by natural mechanisms.

Steve S wrote: "We all hang out here and get toxic doses of creationism*, so when someone like Lutsko comes by who isn't deeply familiar with the ID Project, and doesn't know how foul and malevolent it is, we perhaps overreact."

A reasonable excuse, but this has got to be one of the worst threads I've read on Panda's Thumb for evolutionary arguments no matter what the excuse. It really is a petty pissing contest.

However, the humour isn't bad at all.

Norman Doering wrote:

"A reasonable excuse, but this has got to be one of the worst threads I've read on Panda's Thumb for evolutionary arguments no matter what the excuse. It really is a petty pissing contest."

I agree, and to be honest, all the mathematical/philosophical/logical arguments were WAY over my poor spinning head. The American public doesn't deal with things on that level. The ID issue can be dealt with in plain terms: Science is science and ID proponents cannot "play" unless they follow the rules like everyone else. (I don't expect the NBA to change its requirements so that I, female and 5'1", can play with the Bulls) Scientific theories are not challenged or replaced in the high school science classroom or university lecture hall.

Oh, well, on the other hand, there needs to be a forum for pissing contests, too! =)

I guess I shouldn't be surprised, but I am, though not so much over Dembski's behaviour, but rather that of his followers. I.e., that he still has some.

I wish I knew how to make these people go away. I read somewhere years ago that if you can persuasively promote pseudoscience youv'e got it made (cf. Freud). I guess Dembski is an example ... In some ways his case is worse, since Freud didn't get much influence in political matters.

this has got to be one of the worst threads I've read on Panda's Thumb for evolutionary arguments no matter what the excuse.

Lutsko,

It seems to me that as in much of this evolution controversy people are using the same words to mean different things. The resaon Dembski and all are able to get so much traction is that they use the trappings of objective science to pursue a political end. In standard science this just isn't done - everything starts with the assumption of honesty. Every so often someone is discovered having cooked the data to get the desired result, with disastrous consequences to his/her career. So we don't really have the tools within science to address someone who doesn't particularly care where the evidence leads, because his goals are different. It's about politics, not science.

The distinction can be seen in the way that on Dembski's blog there are posts about whether Eugenie Scott is an atheist, and a transcription of Bush's veteran's day speech.

I agree that if you get a few graduate students together and consume several beers, it's perfectly reasonable and even scientific to start pondering "What if an alien lifeform or supreme being poked our DNA to make our brains so big?" But, the scientific response is to wake up with a headache and go back to teasing out the little bits of truth under our microscopes.

The discussions here at PT are really all about the politics, not the science. At least PT doesn'thave discussions about Dembski's religion.

Dear Lutsko
I don't know how up to date you are on

".....not beyond the realm of imagination"

Watching your thought process is like watching the beginning of (a) man bootstrapping a creation Myth. The greater the knowledge he has the more sophisticated it gets.

Some physicists seem to have the peculiar habit of thinking they can see into the mind of God. And theistic religion relies so much on this that as one wag put it
"religion ? isn't that a branch of physics?"

http://www.firstthings.com/ftissues/ft9508/davies.html

Of course those "insights" are metaphysical musings empty of meaning except for those who's received wisdom is theistic and useful only in self worship (prayer) but when hooked to Fundamentalism (the rigid interpretation of Gen1.and Gen2. - the imagined collective history of the Jewish people which for some passes as religion) fueled with insecurity and and a schizophrenic detachment from reality and "Identity Politics{Look it up)" ...provide a dangerous cocktail, Think:- the death of world science as it was then and arguably the death of Islam around 1000 years ago, Germany 1933, Sept 11.

For a better insight into why we are the way we are, a tour thru man's Myths with J. Cammpbell will give much richer insights than any scientist will and doesn't require any supernatural twiddling, get hold of "The Hero With A Thousand Faces".

http://www.jcf.org/

Religion comes from the Latin word for "That which binds us together" some would argue the contrary of course however faced with problems of fundamentalism in their own ranks, the collective sane center are finally getting around to cross faith/culture dialog to try and head off the clash of horizons and the rise of fundamentalism. Look up "one world religion"

You may already be aware of your fellow physicist Sokal who heroically debunks pseudoscience and metaphysics
if not then read the first 3 pages of
(Right click and download this next line).
http://www.physics.nyu.edu/faculty/sokal/pseudoscience_rev.pdf
The top page is here.
http://www.physics.nyu.edu/faculty/sokal/index.html#impostures

For more info on information theory and its applicability to Biology have a look at this.
http://www.hubertpyockey.com/

Hope that helps.

Dear Mr Brayton,

I object to your use of the word scumbag. I think that word, to have the proper punch, should be reserved for people with actual power, like politicians and CEOs, especially the latter.

Careful and judicious use of language, even the slurs, is important.

Dembski's deletion of some pages only compounds his idiocy. He's crossed the line from calculated deception to what looks like a pathological inability to tell the truth to save his life. (He may have crossed it long ago, but I have only been following him since his mention in an NYT story last August.) I can't even figure out what he is trying to accomplish beyond maintaining the loyalty of whatever deluded folks get all their information from his blog.

My guess is that Dembski found the deposition after Elsberry's comment at Dispatches made it clear that the transcript could be found at NCSE. My reason for assuming so is that this comment caught my own interest, and I was able to find it after some google searching.

But it should also be said that it's been known at least since Oct. 31 that a PDF copy was available for emailing. Ed Brayton commented that he received such a file in email. It's also been stated repeatedly that it is part of the public record and available through the standard means of obtaining court records. My stake in the matter was too small to do this, but this would not be true of Dembski.

Dembski could have obtained it any number of ways, so his claim of "street theater" makes absolutely no sense. We're to accept the following as explanation? 'I discovered I might have to get off my tush, use a telephone, ask my legal contacts, or (gasp!) pay a nominal fee to obtain this part of the public record. Therefore, I am entitled to lie, accuse, contradict myself, and whine over the internet as part of my guerilla "street threater" strategy to get someone else to do my work for me. After all, if google can't find it, it doesn't exist.'

Hey, is anyone sure Dembski really exists? The strategy of dissembling for weeks on the Internet to obtain a document available by simple means offline doesn't make a lot of sense for a human being, but it is consistent with an advanced bot.

Offtopic: if anyone needed more evidence that ID is creationism, here it is http://www.iscid.org/papers/deJong_EvolutionExperience_051005.pdf

Ah, the do-nothing parasites, er, I mean, philosophers have arrived to tell physicist Lutsko and the rest of us what science is really about. I am reminded of the following aphorism I came up with:

Those who can do. Those who can't become philosophers of the discipline in question.

Those who can do. Those who can't become philosophers of the discipline in question.

There is something encoded in the genome that is a lot more remarkable than pi to 100 digits.

Creationism is like vitamin C the LD 50 is so high that it isn't likely that anyone will ingest those levels. After a certain amount most people just piss it out of their system.

To Chris in particular, you say: "1. There is no way of mathematically proving that an evolutionary step is impossible." Really? Putting aside the question of whether anyone can issue such a catagorical statement, what if a sequence was found in the junk part of a chromosone of some organism which gave pi to a 100 digits in binary coding? Granted, that would not be a "mathematical proof" per say, but you get the point. And, despite your categorical statement, a mathematical proof may be unlikely, but is not beyond the realm of imagination.

— lutsko

OK so Doctor Dembski makes several false statements, accuses someone of incompetence, claims documents have disappeared and then, when caught lying; passes it all off as street theatre.

Not only that, but this sort of behaviour is normal from the main ID proponents. Yet I have yet to see a media article that reports these shenanigans when dealing with the ID/Evo issue (except those Dover reports).

How is this possible?

Is nobody on the Evo side pointing to these tactics?

Just wondering.

Dembski could have obtained it any number of ways, so his claim of "street theater" makes absolutely no sense. We're to accept the following as explanation? 'I discovered I might have to get off my tush, use a telephone, ask my legal contacts, or (gasp!) pay a nominal fee to obtain this part of the public record. Therefore, I am entitled to lie, accuse, contradict myself, and whine over the internet as part of my guerilla "street threater" strategy to get someone else to do my work for me. After all, if google can't find it, it doesn't exist.'

Ah, the do-nothing parasites, er, I mean, philosophers have arrived to tell physicist Lutsko and the rest of us what science is really about.

I've read the deposition in its entireity. From page 150 on, and for about twenty more pages, yes, the deposition is a little embarassing. Shallit is made to seem like he has no substantive arguments against Dembski, save one; and that one is, more or less, trivial. Dembski's characterization is not completely unfounded. Please don't respond until you've read the deposition. Thank you.

— BlastFromThePast

I have nothing against whoever lutsko is, but when a physicist presents such mental masturbation as this, I find it almost necessitates a very critical response.

There is plenty enough confusion about how science works out there already, without scientists themselves using extremely artificial constructs to try and elucidate issues that don't really exist.

there are places for mental masturbation about scientific evidence and theory, but this is supposed to be a thread about Dembski's dissembling and lies, and is really an inappropriate place for that type of discussion.

I would suggest to lutsko that he start a thread in the "after the bar closes" area if he wants to actually explore this avenue of thought.

How is this possible? Is nobody on the Evo side pointing to these tactics? Just wondering.

"1. There is no way of mathematically proving that an evolutionary step is impossible." Really? Putting aside the question of whether anyone can issue such a catagorical statement, what if a sequence was found in the junk part of a chromosone of some organism which gave pi to a 100 digits in binary coding? Granted, that would not be a "mathematical proof" per say, but you get the point.

Your reactions to honest questions are quite interesting

Your example may eliminate chance but does it eliminate regularity? I'd say that finding pi to a hundred digits by itself would not prove that an evolutionary step is impossible.

Stephen Elliott wrote: "... this sort of behaviour is normal from the main ID proponents. Yet I have yet to see a media article that reports these shenanigans ..."

Oh, they report on similar shenanigans, like that comment about standing up for Jesus and then claiming ID is not about religion. What they don't report on is Dembski's blog.

And you're right. The behavior is common, but not exclusively IDian, it's human, all too human and more common than any of us want to admit.

I mean, he even admitted that, "The previous postings were a bit of street theater. I now have what I needed." Doesn't that statement reflect that of an obsessive, stalking fool who repeats his actions until one gets what he so dearly needs?

What they don't report on is Dembski's blog.

There is something encoded in the genome that is a lot more remarkable than pi to 100 digits.

Sir Toejam,

How am I suppose to qualify my remark? I really do not know what you are getting at. In any case, here are a few remarks:

First, I agree - this discussion has wandered off-topic and may be better continued somewhere else.

Second, one man's "mental masturbation" is another man's "thought experiment".

Third, and example of what I consider interesting is morbius, if i understand his last comment correctly, accusing me of being what i explicitly deny - namely, some sort of proponent of ID.

Fourth, I am a naturalist, period. But i think that people who are defending any position do us all a dis-service by making dogmatic, unsupported, categorical statements like "ID is not science" or "such and such could never be proven". True, "god of the gaps" arguments are not science, but the basic question being asked is legitimate - could there be "design" and how would you detect it? I do not think Dembski or Behe or the others have advanced the solution of these problems one iota, but that is a different matter.

Well, anyways, I am not sure that replying accomplishes much since we do not have any real disagreements. I actually, started with a fairly innocuous comment about how I thought it a shame that Dembski was so dishonest and the lack of honest critics and got dragged into this conversation by replies to the effect that honest criticism was impossible which just seems like nuts to me.

jim

Sir_Toejam wrote: "That wasn't his point, Norman."

It wasn't?

Well, maybe I missed the point, but I thought the point was that the media was not reporting on ID shenanigans. That's not true. During the Dover case there was a lot of reporting on similar shenanigans -- like trying to hide the creationist roots of ID -- and that's why those guys were voted out before the case was judged.

I don't think the public even knows Dembski has a blog.

Dembski gets very few comments, far fewer than Panda, and those are mostly from his syncophant regulars.

It's one of those little facts that make this whole thread a petty pissing contest.

Third, and example of what I consider interesting is morbius, if i understand his last comment correctly, accusing me of being what i explicitly deny - namely, some sort of proponent of ID.

lutsko wrote: "... the basic question being asked is legitimate - could there be "design" and how would you detect it?"

I agree, that's a legit question. It has been discussed at length in other threads -- but they're closed now.

I also agree, this isn't the right thread for that topic.

If you want to take that question to another thread or forum, let me know and tell me where. I might show up.

if i understand his last comment correctly, accusing me of being what i explicitly deny - namely, some sort of proponent of ID.

Well, anyways, I am not sure that replying accomplishes much since we do not have any real disagreements. I actually, started with a fairly innocuous comment about how I thought it a shame that Dembski was so dishonest and the lack of honest critics and got dragged into this conversation by replies to the effect that honest criticism was impossible which just seems like nuts to me.

— lutsko

I don't think the public even knows Dembski has a blog. Dembski gets very few comments, far fewer than Panda, and those are mostly from his syncophant regulars. It's one of those little facts that make this whole thread a petty pissing contest.

moreover, characterizing the entire criticism of lutskos commentary as a "pissing match" is disingenuous at best.

Just because you don't understand the arguments involved, doesn't make it a pissing match.

I personally have no problems in continuing lutsko's tract in another thread, where it could officially become a "pissing match" if that is the desire.

The basic question being asked is legitimate - could there be "design" and how would you detect it?

could there be "design" and how would you detect it?"

Sir_Toejam wrote: "Norman, you don't read well, do you?"

Ummm... you don't think the writers of "Of Pandas and People" are some of the "main ID proponents"??

You said: "...his point was that the media has done little to show the same level of dissembling in "the main ID proponents", not the school board of dover."

My example was from main proponents, the school board paid the price.

Maybe you're the one who doesn't read well?

Now I'm in a pissing contest.

he was only using Dembski as a specific case in point, not expecting the media to necessarily focus on Dembski himself. clearer?

I was also surprised at some of the animosity on this site when I first started to visit.

if we found something that, after a long period of time, no one could imagine being produced by an evolutionary pathway don't you think that would more reflect limits in our own imaginations, than on reality? Not for the first time, i give you Darwin Himself: [...]

I am a physicist and no fellow-traveler with the ID crowd. On the other hand, I cannot rule out the logical possibility of naturalistic design: after all, its not unthinkable that some day we can ourselves create artificial organisms. I therefore do not think it heretical to allow for the possibility that some sort of "design inference" could be justified and I do not think that appeals to authority rule it out. Although I do not agree with the "reasoning" of Demnski and his crowd, I do think it is healthy to have honest skeptics nipping at the coat tails of scientists - god knows we are used to them in physics. Thus my comment that I think it sad that Dembski et al are not honest in their critisims.

morbius:
Hmmm ... perhaps Dembski's chessboard analogy is good, after all, to illustrate the error in design reasoning.
And not just the chessboard, but Mt. Rushmore, SETI... I can't think of an analogy that D*mbski has propped up in his "popular" writings that doesn't work better as an argument against design.

But, bring it up and you're "not dealing with the technical aspects of [his] work"

And if you do deal with those aspects, a la Shallitt, then you're a stalker and the spew of lies that come out in WAD's defense are "street theater." Well, I walked out of the show, Bill, and I want my money back.

Second, one man's "mental masturbation" is another man's "thought experiment".

True, "god of the gaps" arguments are not science, but the basic question being asked is legitimate - could there be "design" and how would you detect it? I do not think Dembski or Behe or the others have advanced the solution of these problems one iota, but that is a different matter.

morbius wrote: "That categorical claim (anyone else catch the whiff of hypocrisy?) is highly debatable, when the nature of "design" is unspecified."

I agree. In order to talk about design you have to talk about motive, goals, methods, tools, and such. You really can't deal with it in the abstract.

It leads you to thinking things like "God had a purpose for creating AIDS."

Would anyone like to switch the context of that kind of disscussion and take it to this forum:

After the Bar Closes
http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?act=SF;f=14

http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=43776201eece4a11;act=ST;f=14;t=38

Think about how you might tell an artificially designed virus from a naturally evolved one.

Then his next post accused STJ of "being touchy". And so it goes. Reminds me of someone else from a recently closed thread about an op-ed in the LA Times.

I think lutsko is very different from the guy you are referring to. lutsko, I believe is genuinely thinking things through. Whereas the other fella was wanting to lead a sorty against ID and gain publicity, possibly increasing book sales.

Second, one man's "mental masturbation" is another man's "thought experiment".

[W]hat if a sequence was found in the junk part of a chromosone of some organism which gave pi to a 100 digits in binary coding?

— lusko

Second, one man's "mental masturbation" is another man's "thought experiment".

no, the use of the term "mental masturbation" is not meant to imply anything more negative than "thought experiment". it's just a more slang term for it.

In an earlier off-topic comment, John posted this link:

http://www.iscid.org/papers/deJong_EvolutionExpe...

I read this paper, and though the flaws in the argument against evolution using the 2nd law of thermodynamics were obvious (the "direction" he is seeking is natural selection, the energy is sources of radiation, mostly solar), it wasn't so obvious to me how to answer his other challenge.

That in instances of high exposure to radiation, the subsequent mutations have never been observed to add a selective advantage to
an organism. He writes:

"Cancer researcher Prof. Plasterk (1996, p. 28) makes clear that this is a misconception: 'There are bunches of biologists who think that evolution happens by the emergence of a mutation somewhere in the species, that brings a selective advantage. It is known for half a century yet that it does not go like this, and cannot go like this..... The forming of a species goes by the selection of combinations, not of mutations.'"

Now, before everyone jumps on me all at once, please know that I am aware that there is more than one type of mutation, there are duplication mutations, for instance, which demonstrate how "information" is not always lost because of a mutation, as well as chromosomal crossover, etc. But my question is, how important are germ-line mutations, and how important is sexual reproduction, what is meant by "combinations," and what impact does it all have on evolution? Broad question, I know, and I apologize.

If anyone can direct me to a place where I can learn about this in more detail, please do so. Thanks.

I realized that my link is broken. The full link is

http://www.iscid.org/papers/deJong_EvolutionExperience_051005.pdf

and the comment I was referring to by john is comment # 56596.

I have nothing against whoever lutsko is, but when a physicist presents such mental masturbation as this

— Sir_Toejam

no, the use of the term "mental masturbation" is not meant to imply anything more negative than "thought experiment". it's just a more slang term for it. or, we could start another thread to discuss the definition of terms?

Not only that, but this sort of behaviour is normal from the main ID proponents. Yet I have yet to see a media article that reports these shenanigans when dealing with the ID/Evo issue (except those Dover reports).

Ed wrote "Okay, let's call a spade a spade here. Dembski is a lying scumbag with no regard for the truth whatsoever. Period. Just when you think he's hit rock bottom, Dembski begins to tunnel."

Tell us how you feel Ed.

What did someone say about pissing matches? If you're going to simply naysay, you might try it when your claim isn't so obviously wrong.

"The term you are looking for is pulling a Penrose."

Is that a reference to the "Emperor's New Mind" ?

At this point, no responsible science writer should refer to Dembski without including phrases like "habitual liar" in the description. His behavior is so well documented and so thoroughly at odds with academic practice that it deserves a story or at least a sidebar for itself. Unfortunately, I guess it's unlike to happen as journalists crank out "he said, she said" stories.

— PaulC

The term you are looking for is pulling a Penrose.

At this point, no responsible science writer should refer to Dembski without including phrases like "habitual liar" in the description.

Using complex statistics, intelligent-design theorists contend that natural selection fails to fully explain life's complexity, thus alternative explanations to evolution should be considered. As a rule, they don't speculate over who or what did the designing.

The term you are looking for is pulling a Penrose.

When I first read a book that was pro ID, I got the impression that the proponents were actually serious scientists

The previous postings were a bit of street theater.

Positively Pythonesque.

Which applies to Michael Balter's atrocious op-ed in the LA Times, where he uncritically presented ID talking points

— moribus

Is that a reference to the "Emperor's New Mind" ?

They don't speculate because they know.

really? That would be a topic worthy of discussion here: what is it exactly that leads to the impression of ID proponents being serious scientists? Is it just their credentials in print? I think it would be worthwhile to pinpoint exactly where that impression comes from.

— Sir TJ

Katarina, you may have to wait a while for an answer. I'm waiting with you.

Did you suspect he was after some self publicity perchance?

so, correct me if I'm wrong, but it would imply that we all are susceptible to "argument from authority" reasoning, yes?

But yes; it was the high grade qualifications that led me to believe they were serious scientists

"so are they just playing to a common psychology? Intentional or not?"

Was that addressed to me?

Honest engagement with criticism doesn't seem to be part of his repertoire.

Sir TJ,

Yes the Authority did hold some weight.
Plus I suspect that my own desire for a purpose for the universe made me want to believe them.
I knew there were some flaws in the reasoning, but I guess a scientific bunch of evidence to indicate God: was appealing to my psychological makeup.

Was that addressed to me?

it's a general question. I'm looking for opinions on whether folks think that specific use of credentials is an actual tactic being deliberately used by the DI (as an example) to present 'authority' to their arguments, or whether it is just accidental.

ah, thanks Stephen.

do you now feel there to be any specific intent to appeal to you in that fashion?

lol. i'm posting a little behind you, sorry.

ah, thanks Stephen. do you now feel there to be any specific intent to appeal to you in that fashion?

The primary purpose of Phase II is to prepare the popular reception of our ideas. The best and truest research can languish unread and unused unless it is properly publicized. For this reason we seek to cultivate and convince influential individuals in print and broadcast media, as well as think tank leaders, scientists and academics, congressional staff, talk show hosts, college and seminary presidents and faculty, future talent and potential academic allies. Because of his long tenure in politics, journalism and public policy, Discovery President Bruce Chapman brings to the project rare knowledge and acquaintance of key op-ed writers, journalists, and political leaders. This combination of scientific and scholarly expertise and media and political connections makes the Wedge unique, and also prevents it from being "merely academic." Other activities include production of a PBS documentary on intelligent design and its implications, and popular op-ed publishing. Alongside a focus on influential opinion-makers, we also seek to build up a popular base of support among our natural constituency, namely, Christians. We will do this primarily through apologetics seminars. We intend these to encourage and equip believers with new scientific evidence's that support the faith, as well as to "popularize" our ideas in the broader culture.

Posted by morbius on November 13, 2005 08:13 PM (e) (s) "so are they just playing to a common psychology?" The primary purpose of Phase II is to prepare the popular reception of our ideas. The best and truest research can languish unread and unused unless it is properly publicized. For this reason we seek to cultivate and convince influential individuals in print and broadcast media, as well as think tank leaders, scientists and academics, congressional staff, talk show hosts, college and seminary presidents and faculty, future talent and potential academic allies. Because of his long tenure in politics, journalism and public policy, Discovery President Bruce Chapman brings to the project rare knowledge and acquaintance of key op-ed writers, journalists, and political leaders. This combination of scientific and scholarly expertise and media and political connections makes the Wedge unique, and also prevents it from being "merely academic." Other activities include production of a PBS documentary on intelligent design and its implications, and popular op-ed publishing. Alongside a focus on influential opinion-makers, we also seek to build up a popular base of support among our natural constituency, namely, Christians. We will do this primarily through apologetics seminars. We intend these to encourage and equip believers with new scientific evidence's that support the faith, as well as to "popularize" our ideas in the broader culture.

thanks for reminding us of the wedge document, but I was specifically curious to find out what folks thought about IDers before they learn of things like the wedge document. can folks come to the conclusion they are being manipulated without having seen things like the wedge document?

I think Stephen's response is exactly what i was looking for.

from the other end of the spectrum, I never took ID seriously at all until i started paying attention to the politcal bedfellows involved with it; that's when i ran across the 'thumb. so i guess i had completey refuted the argument long before any "authority" was lended to it.

what about yourself, morbius?

I don't think the public even knows Dembski has a blog. Dembski gets very few comments, far fewer than Panda, and those are mostly from his syncophant regulars. It's one of those little facts that make this whole thread a petty pissing contest.

Don Quixote is visibly crazy to most people. He believes ordinary inns to be enchanted castles, and their peasant girls to be beautiful princesses. He mistakes windmills for oppressive giants sent by evil enchanters. He imagines a neighboring peasant to be Dulcinea del Toboso, the beautiful maiden to whom he has pledged love and fidelity. Sancho Panza, his simple squire, believes his master to be a bit crazy, in particular he knows that there is "really" no Dulcinea, but he plays along, hoping to get rich. He and Quixote agree for instance that because Dulcinea is not as pretty nor does she smell as good as she should, she "must have been enchanted", and from that point on the mission is to disenchant her. Both master and squire undergo complex change and development throughout the story, and each character takes on attributes of the other as the novel goes on. At the end of the second book, Quixote decides on his deathbed that his actions have been madness. Sancho begs him not to give up, but to no avail. Master and squire have numerous adventures, often causing more harm than good in spite of their noble intentions. They meet criminals sent to the galleys, and are victims of an elaborate prank by a pair of Dukes, when Sancho is made "governor" of fake Barataria.

We are expected to believe that creationism, or intelligent design, or whatever it's going to be called after the Kitzmiller decision

I am a bit worried that ID is being taken too complacently by the scientific community.
ID is not science...true.
But it does not have to be.
To achieve it's aims; ID only has to appear scientific.
Get the majority vote and BAM, they have won.

I am starting to get worried by it now.
Especially with the fundamental views expressed by some of your religious groups.

It seems there are people that would like to send us back to the dark ages and reintroduce the inquisition.

I am not joking. Just check some of the posts on Doctor Dembski's own site.

STJ
The whole beautiful irony of the IDDIots (or any other god botherers for that matter) is that if they didn't tell you [whatever it was they wanted you to believe]
they wouldn't be needed.

The typical advertising message

Buy me!

why?

This product will fulfill your dreams!

Why?

Because I'm spending zillions telling you... stupid!

The DI uses that new "bible" of business "The Art of War"

Blast,

To be fair, my question was off topic. I may ask it elsewhere.

Stephen Elliott

You are very right to be concerned

The Catholic Church (and I'm not a Catholic BTW)
have warned that DI ID crowd are a fundamentalist risk.
Plus the DI ID have the added twist of "Identity Politics" (Think Germany 1933)

Look up Fundamentalist religious schizophrenia

It seems there are people that would like to send us back to the dark ages and reintroduce the inquisition.

Blast, To be fair, my question was off topic. I may ask it elsewhere.

Plus the DI ID have the added twist of "Identity Politics" (Think Germany 1933)

i seem to recall "sudden emergence" as being bantered about, anyone confirm/deny that rumor?

— Sir_Toejam

Personally, though, while I do kind of suspect Panda's Thumb somewhat trivializes itself by spending so much time on blog wars with Dembski, the entire thing is somewhat fascinating in terms of what it says about the people running ID.

what about yourself, morbius?

it wasn't so obvious to me how to answer his other challenge. That in instances of high exposure to radiation, the subsequent mutations have never been observed to add a selective advantage to an organism.

To clarify a point about the "challenge": the relevant mutations are those that occurred (randomly or otherwise) before the Chernobyl accident, and which contributed to genetic survivability -- via resistance to radiation damage of gametes, for instance. Those mutations that the accident caused are not relevant -- that's a red herring.

what is it exactly that leads to the impression of ID proponents being serious scientists?

There is also the confusion of radiation damage and mutations in general. Once again we see how ID is scientifically vacuous, even when it discusses science.

That in instances of high exposure to radiation

I think that the IDiot's use of outright lies, coupled with distortions contribute to the impression. Those that aren't familiar with the details of some experiment/evidence can be suckered when the IDiots mis-characterize it while providing a reference that they know 99% of readers won't check. When the IDiots put together an argument that appears to be supported by their fake evidence, with substantial supporting literature (that disprove everything they're saying mind you), it looks to the average Joe like serious science.

— Conspiracy theorist

Try to google "beneficial mutations" and read the results that contain references to peer-reviewed papers.

or visit talk origins list of standard responses. (This seems to be another one of Henry Morris's claims (lies))

Why do you think that scientist would say that beneficial mutations exists if it was not true ?

Why do you think that the "paper" you refered to would be true ? Why was it not send for peer-reviewing ?

and this brings us back on topic. Why do you trust anything from the ID-community ?

I really wonder who in their right minds would think that the kinds of damage accrued from exposure to high radiation levels would produce anything other than a heavily damaged organism, likely without the ability to reproduce any more at all.

thanks for reminding us of the wedge document, but I was specifically curious to find out what folks thought about IDers before they learn of things like the wedge document.

Why do you think that the "paper" you refered to would be true ? Why was it not send for peer-reviewing ?

But in fact some of the organisms are able to reproduce. And the offspring of those organisms may well be more radiation resistant than the offspring of organisms that weren't exposed to the radiation (although they may suffer from other genetic damage). The problem lies with the strawman teleological notion that mutations produce "improvement". People with this mistaken notion would think that your point about heavy damage is an argument against evolution.

Radiation breeding is chracterized by its merits; creation of new mutant characters, addition of very few traits without disturbing other characteristics of variety, and improvement of vegetatively propagated and even sterile plants. The Institute of Radiation Breeding (IRB) is engaged in the development of new crop strains through mutation induction, and is conducting research into more efficient methods for inducing mutation. While working to contribute to the breeding of new varieties of various seed-propagated, vegetatively propagated and woody crops, the IRB is conducting fundamental research to elucidate the mechanism of mutation. The IRB has also pursued irradiation service and energetic joint research programs at the request of universities, private industries and local governments.

On the one hand, his financial benefactors make him seem like a typical partisan thinktank hack (like a "supply-side" economist)

different case, as far as i can tell, i think the original post was referring to extreme radiation.

However, if you go there, we should also include the dozens of years that have been spent irradiating drosophila to cause mutations for genetic and selection experiments.

Hell, i used to set up labs at UCSB to do that very thing for undergraduate biology.

It was my understanding that radiation is sometimes used in agriculture to generate mutations from which desired cultivars are selected and breed.

Plant breeders have used mutation breeding to induce mutations and select the beneficial ones (FAO/IAEA 1977).

Sir_Toejam: Just to clarify, so am I.

Right, but it's the selection pressure that produces the desired improvement.

Sorry, I should have realized that.

It was my understanding that radiation is sometimes used in agriculture

2.1 Waste cleanup Deinococcus radiodurans is known as the world's toughest bacteria and it is the most radiation resistant organism known. Scientists are interested in this organism because of its potential usefulness in cleaning up waste sites that contain radiation and toxic chemicals

However, i believe the point of the original post was more aiming at the effects of "high" or extreme irradiation.

Morbius re # 57096

I was not discussing science, I was discussing the paper on ISCID. Why would anyone spend time on that? Obviously, the author (de Jong) did not.

A google search is far more efficient, and authors that refers to reviewed papers tend to be more reliable. A google search starting with
"Cancer researcher Prof. Plasterk " easily shows that the quote of de Jong is a misquote, at least I found a page where Plasterk describes the importance of mutations for evolution (in Dutch).

Erik

However: (57115)

Morbius re # 57096 I was not discussing science, I was discussing the paper on ISCID. Why would anyone spend time on that? Obviously, the author (de Jong) did not.

yeah, but that isn't really agriculture in the sense i meant (food or ornamental crops). tho it is an interesting note.

BTW Katarina. I think Blast was trying to divert attention.

— morbuius

BTW Katarina. I think Blast was trying to divert attention.

— Steven Elliot

The Emporer's New Mind is atour de force. There is no misapplication of Turing whatsoever. It's pure brilliance. And incontrovertible.

Morbius

My final comment in this "interesting" discussion.

Yes, I assumed that Katerina thought that de Jongs claim was true about missing evidence of "positive" mutations due to radiation. Of course, I should have thought that she wanted to be able to explain it even though it was incorrect. I stand corrected. I am glad you understand her better than I do.

Erik

For once I agree with you Blast!

BWAHAHAHAHAHAHAAHAHAAH....

HAHAHAHHAHAHHAHHA

ehhahaah
hahah
ha

Did you figure out that Zen Koan

http://www.ibiblio.org/zen/cgi-bin/koan.pl

be careful, you have to be using the same crystal ball i am to assume that blast intended his post in the only rational way he could, as a joke.

I'll loan you mine if yours is broke.

Yes, I assumed that Katerina thought that de Jongs claim was true about missing evidence of "positive" mutations due to radiation. Of course, I should have thought that she wanted to be able to explain it even though it was incorrect. I stand corrected. I am glad you understand her better than I do.

I read this paper, and though the flaws in the argument against evolution using the 2nd law of thermodynamics were obvious (the "direction" he is seeking is natural selection, the energy is sources of radiation, mostly solar), it wasn't so obvious to me how to answer his other challenge.

morbuius wrote: BTW Katarina. I think Blast was trying to divert attention.

The Emporer's New Mind is atour de force. There is no misapplication of Turing whatsoever. It's pure brilliance. And incontrovertible.

The crystal ball again: I just don't think you have any kind of answer to give to her question. I'm very curious to see what kind of response she gets.

STJ
Blast doesn't do irony :)

Dembski's deletion of some pages only compounds his idiocy. ...

... My guess is that Dembski found the deposition after Elsberry's comment at Dispatches made it clear that the transcript could be found at NCSE. ...

I thought I'd better send some
flowers for Katarina

Do you need more evidence for radiation induced mutations ?

Erik

Do you need more evidence for radiation induced mutations ?

Thanks everyone for your responses.

You have addressed the standard creationist question "Can mutations be beneficial to an organism/population?" very satisfactorily. But I still do not completely understand how the point that was quoted by de Jong, "The forming of species goes by the selection of combinations, not of mutations," helps his case. What did Plasterk mean by this phrase, "selection of combinations"? What are "combinations"?

In more complex multicellular organisms, do these combinations count more than do direct mutations, as in prokaryotes? Of course, every variation ULTIMATELY goes back to a genetic mutation.

Do creationists expect multicellular organisms to react to mutations the same way that bacteria and yeast do?

OK, so let me get more specific with my question. Are mutations as immediately important for variation in multicellular life like vertebrates, as they are for single-celled organisms?

And just to clarify, of course the paper I referred to has no scientific merit. In fact, it is a good example of the deceit that is the topic of this thread. It is made to look like a peer-reviewed paper, it is made to sound (vaguely) like one, but it has no content beyond mild discussion and a few drawings. It's ridiculous and only someone who's never even done a small browsing of any scientific journal would mistake it for a scientific paper. Nevertheless, I expect these questions to come up and I want to make sure I can address them honestly and thoroughly for people.

Wowee! This thread has really taken off since I was here yesterday.

To Lutsko: if you are still reading: if you are interested in discussing the little sub-debate further, please let the PT crowd know so that they can set up an appropriate thread. I do believe you are trying to come to grips with the matter honestly. I am somewhat disappointed to see you claim that you are not a neophyte in these matters since you are using arguments that you should have seen rebutted many times over by now. But if you would like to debate this further, please say so.

To Blast: I think that even Roger Penrose himself would decline your description of THE EMPEROR'S NEW MIND as "incontrovertible." Incontrovertible is a *very* powerful word. It wouldn't even be applied to quantum theory or relativity theory, for instance, even though they are the best experimentally-established theories in the history of physics. It may be applied (carefully!) to certain mathematical proofs, but EMPEROR'S NEW MIND wasn't that. It certainly shouldn't be used for philosophical arguments, which is what ENM was. I'd say that "incontrovertible" is quite possibly the mathematical-logical equivalent of "unfalsifiable." I wonder if your choice of words gives your game away. Anything you agree with is "incontrovertible" because you just know it is, and therefore anything that disagrees with your world view is by definition a false argument, regardless of the state of the evidence.

And in case you're thinking of answering back, a simple question: what is Penrose's definition of an algorithm in ENM and what does that say about the logical foundation of his argument?

Katarina

Why don't you try to contact

Plasterk to get the correct quote and the explanation ?

Erik

I think that even Roger Penrose himself would decline your description of THE EMPEROR'S NEW MIND as "incontrovertible."

It may be applied (carefully!) to certain mathematical proofs, but EMPEROR'S NEW MIND wasn't that.

what is Penrose's definition of an algorithm in ENM and what does that say about the logical foundation of his argument?

Interesting thread this. I too have found myself kicked off Dembski's blog with no real explanation (apart from my anti-ID sentiments ;) ), and I share the overall opinion of his actions.

Having said all that, I'm also surprised to see the levels of vitriol being directed at lutsko, who was making some interesting points. Some people on here seem to be of the opinion that 'all design hypotheses are bad' and will jump on anyone who suggests otherwise. I realise that this is in response to many arguments with ID proponents, but it still doesn't do anyone any real credit.

If a scientist found a bacterium with a gene in it that was an exact match of the human insulin gene, and the bacteria was producing insulin for which it had no purpose, what would the scientist conclude? Based on the evidence of this page he would conclude it 'was not beyond the realms of probability' and that there was 'a natural explanation' for it. But of course, this bacterium has actually been designed - by humans in a lab.

So - these days - design is a perfectly good hypothesis for something we see in nature, given our ever-growing ability to change the nature of the organisms around us. I predict here and now that some underhand ID 'scientist' will deliberately create a very unlikely combination (whale gene in a bacterium or something) and then claim it was found in the 'wild' and this discovery 'blows evolution out of the water' or other such hyperbole. We have to be prepared for that.

If the binary sequence of PI, or the binary sequence of the first two dozen prime numbers, was found embedded in DNA, the mostly likely hypothesis available at the moment is that a human scientist created it.

Tim Hague
I second your suggestion.
Propose a whole raft of scams to unhinge ID and maybe make some money out of it at the same time. All you would need is some loony billionaire (Dr Evil ?) to back you.
On Lutsko I think the most telling comment is, why has he not solved a very basic logical problem before now ?

k.e.

I don't follow you. What is my suggestion that you are seconding? What is the 'basic logical problem' that you think lutsko had?

Tim,

I don't think your analogy is a fair one. Finding an insulin gene in bacteria is indeed evidence of design, but that is because we know a priori that such a bacterium has been designed. Design is used by scientists all the time in the fields of anthropology, archeology, and forensic investigation and when design flops over into biology (as in the insulin-secreting bacterium), nobody has a problem with it. But Lutsko's question was what would happen if a *wild* bacterium had the binary sequence of pi in a noncoding part of its genome. The wild part is the critical aspect of the question. It's also the part that applies to evolutionary theory.

I wasn't saying there *couldn't* be evidence for design in evolution, just that IDers haven't provided any, haven't developed a good model of what to look for, and that Lutsko was using a poor example (and confounded matters by calling it a mathematical proof when he didn't really mean that).

Humans are prone to seeing design all over the place. A long time ago when I was designing a computer game, my co-designers wanted to develop extensive strategies that the monsters would employ in hunting down the players. I suggested we just make them move randomly. We tested it with a couple of friends, and lo and behold they all exclaimed on how clever the monsters were.

Lutsko asked about the existence of pi to 100 places in wild genetic code. It would certainly raise some interesting questions. But until someone comes up with a satisfactory test for designedness, all we're doing is playing the game of "this is highly unlikely, so it must be design." I'll reply by asking five questions:

1. What sequence of pi could not be explained by known genetic events?

2. What sequence of pi could not be explained by as-yet-unknown naturalistic processes?

3. What is more likely, 100 binary places of pi or 1700 consecutive GAA triplets on a chromosome?

See http://www.ich.ucl.ac.uk/cmgs/neuro99.htm

4. How far into pi does your phone number occur?

See http://www.angio.net/pi/piquery

5. What are the chances of finding self-referential loop sequences in transcendental numbers? Would this be evidence for design?

See http://www.angio.net/pi/piquery

I'm also surprised to see the levels of vitriol being directed at lutsko, who was making some interesting points. Some people on here seem to be of the opinion that 'all design hypotheses are bad' and will jump on anyone who suggests otherwise.

If the binary sequence of PI, or the binary sequence of the first two dozen prime numbers, was found embedded in DNA, the mostly likely hypothesis available at the moment is that a human scientist created it.

Morbius
are you aware of Penrose's

human consciousness is the result of quantum gravity effects in microtubules

If that's the case then Britney Spears has invented her own anti gravity machine.

Dembski did not delete any pages. They are missing in the copy held on the Pennsylvania Middle District court's publicly accessible electronic filing system.

Sir_Toejam wrote: i seem to recall "sudden emergence" as being bantered about, anyone confirm/deny that rumor? It started out as a humourous observation made by Eric Rothschild during his cross-examination of Behe - http://www.talkorigins.org/faqs/dover/day12pm.ht... Unfortunately, I think his hope may be rather optimistic.

— Tevildo

"Katarina

Why don't you try to contact

Plasterk to get the correct quote and the explanation ?

Erik"

Thank you Erik. So I did. If anything interesting comes out of it, I will keep you posted.

Blast, stay tuned.

Ahem. This has already been refuted by Cubist in #57008. Like Lutsko, you seem to live in your own little mental world, not bothering to pay any attention to the counterarguments that people have posted.

Would it be "vitriol" to point out that this is dishonest hyperbole?

— morbius

You seem to live in your own little mental world, not bothering to pay any attention to the counterarguments that people have posted

— morbius

Oops, I meant to say 14 functions that encode from {A,C,T,G} to {0,1}. I.e., there are 2^4=16 functions, but the two constant value functions aren't useful for encoding.

There may be other errors, but let me restate my general claim that there are reasonable circumstances in which "finding pi in the DNA sequence of a bacterium" could hypothetically be well-defined and would require an explanation not covered by current scientific theory. Until someone "finds pi" (or e, or a list of primes, etc.), this kind of speculation is not very interesting, but it would be disingenuous in the extreme to suggest that such an occurrence would easily be explained by evolutionary theory.

If anything, that makes the thought experiment supportive of evolution as science. If evolution could be used to explain *anything* than it would be unfalsifiable. If fact, it is limited to explaining features that contribute to fitness and are reachable through a series of incremental selection events. The features that IDers like to point out (e.g. bacterial flagella) fall into this category. It's difficult to imagine how an encoding of pi would do so. Empirically, we've founds lots of features like flagella, and none analogous to finding pi in junk DNA.

Having said all that, I'm also surprised to see the levels of vitriol being directed at lutsko, who was making some interesting points. Some people on here seem to be of the opinion that 'all design hypotheses are bad' and will jump on anyone who suggests otherwise. I realise that this is in response to many arguments with ID proponents, but it still doesn't do anyone any real credit.

"If fact" above should be "In fact." I apologize for other typos. I hope there is something readable in all that.

As a postscript, I just want to get back to my old hobbyhorse about ID. I wrote "[evolution] is limited to explaining features that contribute to fitness and are reachable through a series of incremental selection events."

I would add that the "theory of design by intelligent humans" is also similarly limited in a way that IDers ignore entirely. A complex feature created by humans should have some explanation in terms of "fitness", which might just mean that the human mind finds it beautiful or else might mean it has practical applications. Moreover, the feature must be reachable by a sequence of incremental refinements. Each incremental step can be due to chance or the exhaustive search of a small enough combinatorial space, but humans usually do not follow a garden path of useless modifications forever and when they do they have a vanishingly small probablity of coming up with anything of value as a result.

IDers seem to acknowledge that human beings, and not just the anonymous designer can produce "complex specified information", but it is a mystery to me how their formalism could ever make a distinction between the creative power of these processes.

I agree. Lutsko raises some interesting questions and while one may disagree with his arguments, the best way of showing him to be wrong is by actually presenting one's own argument.

Since it looks like I have the floor to myself, here's one big clarification and then I'm out of here (there are several uncorrected typos):

I wrote "it is a mystery to me how their formalism could ever make a distinction between the creative power of these processes."

I mean it is a mystery how IDers propose to distinguish between the creative power of evolution and that of human intellect, since both are limited in remarkably similar ways with respect to finding optimal solutions in a large combinatorial search space.

I agree. Lutsko raises some interesting questions and while one may disagree with his arguments, the best way of showing him to be wrong is by actually presenting one's own argument. I was also a bit discouraged by the level of the response to lutsko's statements.

To Chris Lawson, PaulC and even old skeptical Toejam,
I am not a troll and take the rules seriously. It was proposed that this subject would be better persued on the "after the bar closes" forum so I have opened a thread there. If anyone cares to persue it, I am game.

PaulC: you are right - i imagined k=1 all along. I didn't spell it out, expecting that any honest critic would address that case but hey, its OK to be surprised.

So, to those of you interested in honest give and take, I hope to see you there. To everyone else, ... dream on.

jim

thanks, lutsko.

see you there.

cheers

HiYa Panda's Thubites,

Are you calling Bill's editorial changes to his weblog as dishonest? Guess you guys don't have anything better to do. He offered a speculation, not a claim of absolute fact.

I'd like to thank Ed Brayton for assisting in the editorial process of Bill's Weblog. Good work Ed. No apology from our side forthcoming, but rather thanks for improving the factual content of what we write.

cheerio :-)

Salvador

PS
And for the record, I deleted threads at ARN because I was tired of seeing the typical thread jamming tactics being waged by Darwinist sock puppets.

Well, we fixed that at ARN with Rule 9. Cleaned that place up. Yesiree sir.

As far as the outcome of those claiming I ran away, I took on 20 Darwhinists on in the 3rd longest thread in ARN history. I didn't run away from the discussion. Several of my opponents are no longer there. Heck, they didn't even own or read the books we were discussing.

But in any case did you here the latest fine bit of reporting by NPR:
Progess of the Darwinist Inquisition

I'm surprised you all did protest this fine work of reporting by NPR! We're cleaing you're clocks in the PR wars, and I just had this bit of heart warming news, 1/3 of bio freshman at ISU diss Darwin.

Hey! Slaveador! we were beginning to doubt you would ever deign to grant us your presence here.

are you staying or just dropping by to show us yet again how a proper sycophant behaves?

Narcissicism is a personality disorder and that means that narcissists' personalities aren't organized in a way that makes sense to most people, so the notes below do not necessarily go in the order I've listed them or in any order at all. Interaction with narcissists is confusing, even bewildering -- their reasons for what they do are not the same as normal reasons. In fact, treating them like normal people (e.g., appealing to their better nature, as in "Please have a heart," or giving them the chance to apologize and make amends) will make matters worse with a narcissist. [For general discussion of cognition, affectivity, interpersonal functioning, and impulse control in personality disorders and NPD. It's also interesting to compare these traits below with characteristics of normal six-year-olds.] amoral/conscienceless authoritarian care only about appearances contemptuous critical of others cruel disappointing gift-givers don't recognize own feelings envious and competitive feel entitled flirtatious or seductive grandiose hard to have a good time with hate to live alone hyper-sensitive to criticism impulsive lack sense of humor naive passive pessimistic religious secretive self-contradictory stingy strange work habits unusual eating habits weird sense of time The most telling thing that narcissists do is contradict themselves. They will do this virtually in the same sentence, without even stopping to take a breath. It can be trivial (e.g., about what they want for lunch) or it can be serious (e.g., about whether or not they love you). When you ask them which one they mean, they'll deny ever saying the first one, though it may literally have been only seconds since they said it -- really, how could you think they'd ever have said that? You need to have your head examined! They will contradict FACTS. They will lie to you about things that you did together. They will misquote you to yourself. If you disagree with them, they'll say you're lying, making stuff up, or are crazy. [At this point, if you're like me, you sort of panic and want to talk to anyone who will listen about what is going on: this is a healthy reaction; it's a reality check ("who's the crazy one here?"); that you're confused by the narcissist's contrariness, that you turn to another person to help you keep your bearings, that you know something is seriously wrong and worry that it might be you are all signs that you are not a narcissist]. NOTE: Normal people can behave irrationally under emotional stress -- be confused, deny things they know, get sort of paranoid, want to be babied when they're in pain. But normal people recover pretty much within an hour or two or a day or two, and, with normal people, your expressions of love and concern for their welfare will be taken to heart. They will be stabilized by your emotional and moral support. Not so with narcissists -- the surest way I know of to get a crushing blow to your heart is to tell a narcissist you love her or him. They will respond with a nasty power move, such as telling you to do things entirely their way or else be banished from them for ever.

NPD would be considered to be a common psychological disorder amongst sycophants tho, yes?

Some jerk's bragging about cleaning a clock or something. Paley's watch evidently has been found, but in the hands of a gang of desp-p-p-p-picable,vandalism-prone brats the "cleaning" is unlikely to leave even a functioning chronometer, much less evidence of the manufacturer.

You are a fanatic in very nearly the worst sense of the word, STC. You would have to add the use of violence to your resume to sink lower, and you don't seem the type, unless the victim was helpless and "everyone" put you on the spot and expected you to join in the lynching.

Salvador,

I don't remember Dembski qualifying his claims as speculation. Perhaps you could talk him into reposting them so you can point out what I missed.

desp-p-p-p-picable

You would have to add the use of violence to your resume to sink lower, and you don't seem the type

Where's the hyperbole? That?s my opinion having read this thread. I'm still allowed to have one of those, at least last time I checked?

— Tim Haley

Some people on here seem to be of the opinion that "all design hypotheses are bad" and will jump on anyone who suggests otherwise.

the best way of showing him to be wrong is by actually presenting one's own argument

— PvM

We're cleaing you're clocks in the PR wars

— Sal T. C.

I think it's par for the course that someone new who shows up asking questions that seem naive, or uses nomenclature that seems idiosyncratic to regular PT readers, is sort of assumed to have a crypto-ID agenda.

Sal T. C. wrote: We're cleaing you're clocks in the PR wars Does that make ID any more scientific? (Emphasis added.)

— Stephen Elliott

There may be other errors, but let me restate my general claim that there are reasonable circumstances in which "finding pi in the DNA sequence of a bacterium" could hypothetically be well-defined and would require an explanation not covered by current scientific theory. Until someone "finds pi" (or e, or a list of primes, etc.), this kind of speculation is not very interesting, but it would be disingenuous in the extreme to suggest that such an occurrence would easily be explained by evolutionary theory.

Morbius: that discussion has moved to the ABC area:

http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=4378ca781d80427f;act=ST;f=14;t=71

have fun :)

No. And the fact that we're cleaning ID's clock in the grammar wars is telling.

We're cleaing you're clocks in the PR wars

Oh, bother. Missed that one. My bad.

Cubist's point was that you could choose the encoding to produce any sequence you like. This criticism isn't entirely unfair since lutsko never defined the encoding, but he suggests incorrectly that there is no sense in which "finding pi in DNA" could be a surprise requiring some kind of explanation.

Your proposed test here isn't particularly meaningful. Too much opportunity for cherry-picking, of both the translation protocol and the species whose genome you're gonna use that protocol on.

Given that, and given the number of such strings you have looked at, given that you are looking specifically for famous transcedental constants and won't make up a post hoc story for anything else you find

If the above failed, there would be kind of a glaring anomaly that science would have to note and claim no provisional explanation for. However, no such anomaly is currently known, and in no case would science fill in the lack of provisional explanation with a specific non-scientific belief.

I therefore do not think it heretical to allow for the possibility that some sort of "design inference" could be justified and I do not think that appeals to authority rule it out.

Salvador has really outdone himself this time.

No. And the fact that we're cleaning ID's clock in the grammar wars is telling.

HiYa Panda's Thubites

We're cleaing you're clocks in the PR wars

You would not know that from Toejam's posts.

actually, maybe i should be asking somebody else that question, since you never actually answer any questions put to you.

so, does anybody here know if RO ever contributes substantive input?

But his behavior with respect to the deposition puts him at about the level of my favorite Usenet kooks back in the good old days

How, exactly, do you market something that is illegal?

You, like Haley and Lutsko, seem to have paid no attention to the arguments that were presented. Rather than addressing substance, you all make out like there's some unthinking dogmatic opposition. This is just like the charge Michael Balter made, and it stinks. Indeed, the best way of showing people they are wrong is to present an argument, not to engage in this ad hominem crap about jumping on people or "level" of response.

— morbius

PvM wrote: the best way of showing him to be wrong is by actually presenting one's own argument

Sir_Toejam - thanks for the pointer. I was the 'Tim Haley' he quoted earlier in his post (at least he quoted something I said under the wrong name) and mentioned again later 'Haley and Lutsko'. I've moved over to after the bar closes now. It's a bit more civil over there so far ;)

You can't even spell my name right. I have been making points, you have not addressed them.

Morbius,

Which points of yours have I not addressed? You directed a rebuttal at one of three examples I gave for complex sequences in DNA (the one Cubist wrote). I also mentioned two other examples which you have ignored. I happen to disagree with Cubist and I also note that Paul C has written an extensive response to you and Cubist in comment 57217 which neither of you has responded to. As Paul C has expressed the point better than I could, I will leave that issue open until such as time as you get round to addressing it. To use your own words: "Is reading comprehension really that difficult?"

I can't see anywhere else where you have done anything other than get on your high horse... you also exhibit a tendency to insult everyone you don't agree with, which makes it ironic to see that you are getting upset (boo hoo ad hominems, they're calling me dogmatic) and also ironic that YOU are calling ME a hypocrite.

Dembski's idea of factual correction:

Dembski: "2+2 is 5."

[[Demonstration that 2+2 is clearly 4]]

Dembski: "I have always said that 2+2 is 4."

Oceania has always been at war with Eastasia.

What would it mean if scientists found PI in DNA? Does the theory of evolution have an answer to why we might find PI encoded in the DNA? Can we figure out how an Intelligent designer would encode PI into DNA?

Lets say we have some crazy graduate student that has nothing better to do with his/her time then look for weird sequences in genomes.

We will call this student Robin.

Robin decides he/she is hungry and thinks
"I would really like some apple pie....AH!!!! I've got it! I'll look for PI"

Next question for Robin should be something like.
How do I actually look for it?
Does Robin look for it at the nucleotide level? (base 4)
Does Robin look for it at the amino acid level? (base 22)

Depending on which one Robin picks will determine the next step.

Now some people have given some arbitrary precision of PI to be unlikely. I don't believe that the precision really matters and in practical terms you will see why.
For simplicity I will use

3.141592653589793 as my precision. The reason I picked this precision is this is the largest precision I can get PI without loosing precision and not have to spend hours coding.

Robin thinks "What the hell. I'll look at both the nucleotide level and amino acid level."

Robin then goes about the work of converting PI into a nucleotide sequence and amino acid sequence.

First thing Robin realizes is that Robin has to not only look for 1 sequence but 24 actual different sequences. This is because Robin does not actually know what nucleic acid would have what value.
Is adenine = 0,1,2, or 3?
Is guanine = 0,1,2, or 3?
Is cytosine = 0,1,2, or 3?
Is thymine = 0,1,2, or 3?
Given that Robin doesn't know Robin is forced to use all 24 combinations.
This gives Robin the issue of finding the following sequences all of which could be interpreted as PI

CTACCGGAATAACCACGGGCTGACAG
TCATTGGAACAATTATGGGTCGATAG
GTAGGCCAATAAGGAGCCCGTCAGAC
TGATTCCAAGAATTATCCCTGCATAC
GCAGGTTAACAAGGAGTTTGCTAGAT
CGACCTTAAGAACCACTTTCGTACAT
CTGCCAAGGTGGCCGCAAACTAGCGA
TCGTTAAGGCGGTTGTAAATCAGTGA
ATGAACCGGTGGAAGACCCATCGAGC
TAGTTCCGGAGGTTGTCCCTACGTGC
ACGAATTGGCGGAAGATTTACTGAGT
CAGCCTTGGAGGCCGCTTTCATGCGT
GTCGGAACCTCCGGCGAAAGTACGCA
TGCTTAACCGCCTTCTAAATGACTCA
ATCAAGGCCTCCAACAGGGATGCACG
TACTTGGCCACCTTCTGGGTAGCTCG
AGCAATTCCGCCAACATTTAGTCACT
GACGGTTCCACCGGCGTTTGATCGCT
GCTGGAATTCTTGGTGAAAGCATGTA
CGTCCAATTGTTCCTCAAACGATCTA
ACTAAGGTTCTTAATAGGGACGTATG
CATCCGGTTATTCCTCGGGCAGTCTG
AGTAACCTTGTTAATACCCAGCTATC
GATGGCCTTATTGGTGCCCGACTGTC

Robin thinks "WOW that wasn't as a straight forward search as I thought it would be!"

Robin then goes about the task of figuring out the amino acid sequences that could equal PI.

Robin gets a bit of a shock and realizes that again he/she can not rightly assign values to the amino acids thus would have to search for all the possible combinations. With a bit of simple math Robin realizes that there are
1,124,000,727,777,607,680,000 different sequences that could represent PI at the amino acid level.

Now the base 22 representation of PI with 16 digits is
58651B59AFD7
And because we don't know what amino acid represents what value then Robin's search then become much like the bible codes. With 1,124,000,727,777,607,680,000 different combinations Robin is bound to find it somewhere if Robin could actually do a search on this scale. Until quantum computers become affordable Robin decides to spend his/her time on more worth while endeavors.

Now even if you wanted to do either of these searches to try to prove your "Intelligent Designer" then you have a problem. The likely hood of finding a sequence of PI to some precision of valuable length is pretty good, just think of real world applications and the precision of PI used for them. Say we will look for PI to 100 digits. What does this mean? Why do you think the "Intelligent Designer" would pick PI to 100 digits? Why couldn't the Intelligent Designer pick 99? If you then searched for 100 you would miss the ID message! Picking a precision is completely arbitrary.

OK so what does evolution have to say about an organism you find PI in the genome? Well evolution says that we should find signs of PI in closely related organisms around the same location. This does not mean we have to find PI just a sequence in the same area that could have be mutated into PI.

I'll take one of the, roughly, 1.12 sextillion amino acid sequences that represent PI to 16 digits
CGQAKCHLSFE or CysGlyGlnAlaLysCysHisLeuSerPheGlu
What should we look for in the closely related organism? Well there are many different things we would have to look for. Basically all the different mutations that we know can occur to DNA. Let us take a single nucleotide frame shift. There now is 36 different positions where this insertion could have taken place and 4 different values it could have taken. Thus there are 144 different sequences that could bridge the gap just from a single nucleotide frame shift. Maybe it was 2 nucleotides that where added. Maybe it was one removed. Maybe it was and inversion. Maybe this sequence is completely new in one organism due to a retro virus. Maybe the sequence is there exactly. It all depends on the mutations accrued by both populations since the last common ancestor. It in no way is simple but the science of phylogenetic trees is well developed and the data supports common descent.

Forgive any spelling/grammer errors....it is 3:30am and I'm bad at writing at the best of times.

Given that, and given the number of such strings you have looked at, given that you are looking specifically for famous transcedental constants and won't make up a post hoc story for anything else you find, given those conditions you can reasonably claim to be surprised at finding pi.

— PaulC

Dembski's idea of factual correction: Dembski: "2+2 is 5." [[Demonstration that 2+2 is clearly 4]] Dembski: "I have always said that 2+2 is 4."

— ben

To Blast: I think that even Roger Penrose himself would decline your description of THE EMPEROR'S NEW MIND as "incontrovertible." Incontrovertible is a *very* powerful word. It wouldn't even be applied to quantum theory or relativity theory, for instance, even though they are the best experimentally-established theories in the history of physics. It may be applied (carefully!) to certain mathematical proofs, but EMPEROR'S NEW MIND wasn't that. It certainly shouldn't be used for philosophical arguments, which is what ENM was. I'd say that "incontrovertible" is quite possibly the mathematical-logical equivalent of "unfalsifiable."

— Chris Lawson

An algorithm is defined formally as the steps carried out by a Turing Machine. A better question, I think, is what is his definition of the human mind. Of course, he doesn't have one, and so it isn't possible to come to any formal conclusion about its computational power.

— morbius

Not is only your crystal ball is broken, but so is your browser, or your glasses --- there has already been an extensive discussion addressing her question. You're just yanking our chains, right? Surely no one can be THAT moronic.

— morbius

"Katarina Why don't you try to contact Plasterk to get the correct quote and the explanation ? Erik" Thank you Erik. So I did. If anything interesting comes out of it, I will keep you posted. Blast, stay tuned.

— Katrina

Blast,

1. I do not think Plasterk's quote strengthenes any of ID's arguments. I am merely curious about what he meant by "combinations" causing variation.

2. Plasterk is an active scientists, busy with producing resaerch, publishing articles, and writing grant proposals. I am sure one e-mail from someone he doesn't know isn't on top of his list. Many people regularly delete e-mails from people they do not know!

3. What does your challange to PT'ers prove? Why would they be responsible for knowing why Plasterk didn't respond to my e-mail within 24 hours?

Besides, you have nothing to say about the excellent responses PT'ers have already given to the main part of my inquiry. Read, man.

Blast,

Penrose is a physicist, not an expert in computation and formal language theory. If you tell me your understanding of his argument, I'll point out the fallacies.

Penrose is a physicist, not an expert in computation and formal language theory. If you tell me your understanding of his argument, I'll point out the fallacies.

— Worldwide Pants

There are no fallacies. His argument is unassailable

If you sincerely feel that there are fallacies, you would be doing Dr. Penrose a favor by pointing them out to him.

— BlastfromthePast

I'll use my "crystal ball" here.

no, blast has been repeatedly documented as refusing to read ANYTHING that would burst his little personal worldview bubble. One can quite reasonably assume he refuses to read rebuttals to Penrose as well.

don't bother.

then quote-mine or misconstrue for anti-evolution insinuations.

I.e, to go from binary code to the genetic code, you'd have to set up some kind of one-to-one sequence between the one code and the other. And this one-to-one correspondence is, by necessity, arbitrary.

Would you like to explain why she's still awaiting an explanation? And would you like to apologize for your invective?

Penrose clearly demonstrates that the human mind is capable of doing things that no Turing Machine could ever do. He doesn't have to define what a human mind is. All he has to do is show that the human mind can do what no algorithm can ever do. It's straight forward.

What would it mean if scientists found PI in DNA?

Picking a precision is completely arbitrary.

I don't know if people miss understood me so I'll make it more clear.

Finding PI in some genome means NOTHING. This is because
1) The number of genomes out in nature is HUGE
2) That the number of ways PI can be translated into binary code is huge.
3) The translation we use and the precision we choose is 100% completely arbitrary
4) In practical terms we don't have the computational power at this time to perform a useless experiment like this

At the nucleotide level there are 24 different sequences for any value of PI you are looking for.
At the amino acid level there are 1,124,000,727,777,607,680,000 different sequences that could represent PI

Finding PI to 1000 digits has no meaning. With 1,124,000,727,777,607,680,000 different combinations that PI could translate to how long do you think it would take to search all the genomes?

Compound this with the fact that we have no idea what numerical constant an Intelligent Designer would put into the genetic code you would have to be crazy to seriously consider the search.

Which genome do we search? I guess logically if you think Humans are the pinnacle of the ID's design process then you would search us.

As far as finding PI as pertained to the theory of evolution. I meant that evolution doesn't really care if PI is in a genome with a precision of 16 digits or 16,000 digits. All evolution is going to say is if you look at closely related species that you should be able to find evidence of a path way from the 2 species LCA that explains the PI in one and the either absence or presence of PI in the other and that there will be at least one pathway that is not lethal to either species.

Since I'm also not 100% sure about this next part I'll ask the biologist here
Given the human genome is there any stretch of .....lets say 150 nucleotides or 150 amino acids that is present in all humans that is exactly the same? My understanding is at that level there can be changes that do not effect the proteins being produced significantly. If this is the case then you can not even find PI in every human even if you found the sequence in 1.

Finding pi in the genome is not an experiment we carry out, it's just a hypothetical event, and is thus akin to finding bible codes, jesus's face in cheese, and so on.

A priori probability calculations aren't relevant

Penrose tries to deal with this by asserting that the mathematical community, through its error correcting process (akin to the scientific method), can be assured of eventually establishing the factuality of its statements. But this is at best circular; he certainly can't assure that his statement is factual.

Blast, 1. I do not think Plasterk's quote strengthenes any of ID's arguments. I am merely curious about what he meant by "combinations" causing variation.

As best we've been able to discern, Blast has a strict reading regimen:

Wooops
2) That the number of ways PI can be translated into binary code is huge.
above should read
2) That the number of ways PI can be translated into genetic code is huge.

Wayne, did you post your excellent analysis over here:

http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=437a4af9d5ed11f5;act=ST;f=14;t=71

I think that might finally convince lutsko.

Darwin thought evolution was simply animal breeding written in large letters. But, of course, we've known, and for a long time, that there are barriers to variation that species cannot cross. Which, of course, invalidates Darwin's theory. It's really as simple as that

You could only find it there if you devised a translation of the code that puts it there.

to my satisfaction Penrose demonstrates

Ok I'm done Blast bashing now.

please note that I am not objecting to anyone who actually wishes to argue with him, but i do wonder what the point is when he keeps repeating the same level of ignorance and laziness in his thinking over and over and over again.

it gets so tiresome.

But, of course, we've known, and for a long time, that there are barriers to variation that species cannot cross.

You forgot the websites written by self-proclaimed "ecological visionaries".

No, it's not arbitrary if you make reasonable restrictions on the mapping, as I did in my long post. In particular, if you interpret individual bases as encoding bits according to a uniform mapping, there are only 14 ways of doing this. If they encode base-4 digits (0-3) then there are 24 ways to do it (all permutations of four elements). You also want to make restrictions about the substring encoding pi, such as requiring it to be contiguous.

And Blast's painfully-public refusal to learn continues, ironically, to provide a nationwide audience with the opportunity to obtain a considerable evolutionary education.

your decision to encode using base-4 digits is itself arbitrary

Blast,

Thanks for answering my question. I believe that is what was meant.

I don't know, but maybe mutations resulting in variation is more obvious and directly observed in single-celled organisms than in multicellular ones. When you don't know the answer to a question though, maybe it's easiest to invoke ID.

What barriers. How do they work.

ready to tell us why you continue posting here yet? it seems such a simple question, yet you haven't ever answered it.

there's that vaunted opinion of your's again, Blast. I thought you said earlier his conclusions were completely unassailable?

I don't know, but maybe mutations resulting in variation is more obvious and directly observed in single-celled organisms than in multicellular ones.

Blast,

I am not that knowledgable myself, but I trust the consensus of the National Acadamies of Sciences. Why don't you?

I was trying a bit of magnanimity. Silly me.

And again, for the umpteenth time, I don't consider myself that wedded to ID. It's just one way of pointing out the insufficiency of Darwinian theory.

I keep waiting for somebody to give me a good explanation of what I see are errors in Darwinian theory.

sorry i can't resist:

I don't consider myself that wedded to ID.

Honestly, what's so funny?

you need a fly in the ointment

Honestly, what's so funny?

liar. we've done this many times, and others have done it before us, and put it print, and in peer reviewed journals. you just can't be honest, can you.

I've been watching your posts for months now, and have yet to see one. not even one. even when we actually TRIED to help you make one (refer back to the discussion about front-loading and the evolution of snake venom we had). or here, when Katarina is being so patient with you. you are still failing to make any valid points.

Blast, Thanks for answering my question. I believe that is what was meant.

— Katrina

you're kidding, right? encode base-4 digits (0-3) a c g t now do you see why blast saying that choice was arbitrary is funny?

Blast

I appreciate your interest in Katarina's efforts. You're wondering why Katarina have not yet heard from Plasterk.

Actually, you can help her. When you pass by your library, just obtain this article

Plasterk, R. 1996. Signaal (column). Intermediair, 25 oktober, p. 28.

and reproduce the quote to us, so we can get the full context.

As you know from reading de Jongs "paper", this is where Plasterk's quote is found. Actually "Intermediair" seems to be a business magazine. Plasterk is a leading expert on induced mutations and has a comprehensive scientific publication list, from at least 20 years of research.
So it's perfectly natural to cite from a business magazine, or ....

I look forward to see the result of your search within the next 24 hours

Erik

So instead of participating in the science hearings before a state board subcommittee and presenting testimony about evolution, they stood out in the hall and talked to the media about how the Ph.D. scientists who are presenting testimony about the criticisms "aren't really scientists" and that "they really don't know anything." Instead of discussing the issues of evolution, noisy critics go into attack mode and do a character assassination of anyone who happens to believe that evolution should actually be subject to critical analysis.

As you know from reading de Jongs "paper", this is where Plasterk's quote is found. Actually "Intermediair" seems to be a business magazine. Plasterk is a leading expert on induced mutations and has a comprehensive scientific publication list, from at least 20 years of research. So it's perfectly natural to cite from a business magazine, or .... I look forward to see the result of your search within the next 24 hours Erik

Just in case anyone has any doubt about blasts argument from ignorance and why he refuses to engage in logical thought and building a personal sanity based on the collected wisdom of man, both scientific and theological

This will help

http://hannes.domainplanet.at/fusi/BunnySuicide/Bunny%20suicides.html

Comment #57944 Posted by BlastfromthePast on November 15, 2005 09:35 PM (e) (s) ... Katrina, there was a paper recently out about bacteria (I think that's what you have in mind when you say single-celled organisms) which was reporting that 20% of every bacterial genome is constantly changing! In other words 20% of the genome is constantly "mutating", and no real change takes place: they're just bacteria. So, you can see, that if 20% is constantly changing and nothing really changes, then some simple "point" mutation---that is, a single nucleotide change, in all probability, wouldn't show any change at all ...

— BlastfromthePast

Comment #57985 Posted by BlastfromthePast on November 15, 2005 11:10 PM (e) (s) liar. we've done this many times, and others have done it before us, and put it print, and in peer reviewed journals. ... How about this: a= 0 c= 1 g= 2 t= , (comma) This is to base-3, separated by commas. How about this: aa= 0 ac= 1 ag= 2 at= 3 cc= 4 ca= 5 cg= 6 ct= 7 This is to base-8 (0-7). Do you see how simple it is to invent a code? Would you like to apologize now?

— BlastfromthePast

The critics are wrong.

— Blast

Ahem. This has already been refuted by Cubist in #57008. Like Lutsko, you seem to live in your own little mental world, not bothering to pay any attention to the counterarguments that people have posted.

— paulc, in post 57217,

Cubist's point was that you could choose the encoding to produce any sequence you like. This criticism isn't entirely unfair since lutsko never defined the encoding, but he suggests incorrectly that there is no sense in which "finding pi in DNA" could be a surprise requiring some kind of explanation.

...given the number of such strings you have looked at, given that you are looking specifically for famous transcedental constants and won't make up a post hoc story for anything else you find, given those conditions you can reasonably claim to be surprised at finding pi.

— paulc, in post 57217,

As I've said before, when you can turn a cat into a dog using artifical selection, then I'm a Darwinian for life! But, if not.....

— BlastFromThePast

This all sounds familiar, doesn't it?

"We've been attacked by the intelligent, educated segment of the culture." ----- Ray Mummert, creationist from Dover, Pennsylvania, 2005

Umm Blast all that says is that about that is that 20% of the DNA may have little to no effect, that we know of, in many species of bacteria.

Saying "they're just bacteria." is not the same as "they are just the same species of bacteria". I'm sure we can find 20% of one species DNA to change that will easily qualify said bacteria as a new species bacteria....... Much to your disappointment we have seen a single nucleotide change in a bacteria that produced a new species.

Blast what use is the ","? When applying Occam's Razor one should not increase, beyond what is necessary, the number of entities required to explain anything. what does the "," explain in your first translation? Why would we assume that a ID would put in commas?

Which critics have you read, Blast?

Evolution doesn't say that you can turn a cat into a dog. Evolution says that - at some point in the distant past - dogs and cats had a common ancestor. Over time that common ancestor diverged into two different species, one which became more dog like and one which became more cat like, and these sub-species also then diverged to give us the dogs and cats (and all other creatures in the order Carnivora) we have today.

Just in case anyone has any doubt about blasts argument from ignorance and why he refuses to engage in logical thought and building a personal sanity based on the collected wisdom of man, both scientific and theological

Beggin' yer pardon, Paul, but I was responding to lutsko's specific claim: Namely, that it would be significant if we found a stretch of DNA which encoded 100 binary digits of pi. And no, someone's finding 100 binary digits of pi encoded into DNA would not be significant if the specific nucleotide-to-bits translation protocol they used was not defined ahead of time. In the case of a translation protocol that was selected after the fact, how could anyone tell whether or not that protocol had been cherry-picked to yield the desired result? Thus, if you want your discovery of 100 nucleotide-encoded bits of pi to be taken seriously, you simply have to nail down, ahead of time, exactly which translation protocol you're using.

Good one Blast, but its too late they found the bones.
By the way you left out the most important part of my quote.

Firstly, in response to what you said before this quote, if it weren't for artificial selection, there likely wouldn't be dogs, just wolves. So, let's not sell artifical selection short compared to NS.

— BlastFromThePast

Secondly, let's assume that you are able to turn a cat into a dog. Let's suppose it takes hundreds of generations, an on-going experiment left to your disicples. [leaving out the details...] Looking back on this "experiment", I am completely justified in saying that, "at some point in the distant past - dogs and cats had a common ancestor. Over time that common ancestor diverged into two different species, one which became more dog like and one which became more cat like, and these sub-species also then diverged to give us the dogs and cats".

So, this is completely do-able according to Darwinian theory. I, like Huxley, await.

Erratum: "n bits inspected, length m of contiguous pi prefix ..." should be "m nucleotides inspected, length n of contiguous pi prefix ..." to be consistent with my original formulation.

There are probably some other errors.

Blast: To begin with, scientists don't commonly speak of having "disciples." They have students, colleagues, assistants, and other collaborators, none of whom are called disciples. And spare me the "Webster's defense" that disciple is synonymous to student, because you know very well (if you have any ear for language) that it's a provocative word suggesting a follower of a religious belief.

Second, you seem to be very confused about evolution. Evolution says that cats and dogs have a common ancestral species that existed at some time in the distant past, and that there are plausible pathways (involving natural and artificial selection) from that ancestral species to the modern domesticated species.

It does not say that there is any plausible pathway from the cat or dog back to the ancestral species. Selection events don't work in reverse.

It does not say that any individual of the ancestral species is now living. I.e., if you could do a "Jurassic Park" and get an individual of that species, it would probably not be able to breed with an individual of any modern species.

Therefore, one cannot conclude that there is a plausible pathway from cat to dog. Why? Well, the first pathway that comes to mind is back to the ancestor and forward to the other species. But we know that the reverse of a plausible pathway is not necessarily plausible. Indeed it is as implausible as the reverse of any other complex event such shattering a vase; much of the information about the ancestor has been lost. We may find more to like in a kitten than in a broken vase, but both are the result of thermodynamically irreversible events.

No other cat-to-dog pathway is predicted by evolution either. The only pathways that must exist according to evolution are the ones going forward from an ancestor.

Note that under certain environmental conditions, it's conceivable that a cat or dog population would produce a new species with a phenotype and behavioral niche similar to their ancestral species. However, the likelihood that it would be the same species--i.e., capable of breeding with an ancestral individual--is vanishingly small. Evolutionary processes will introduce many chance differences if these differences are independent of fitness. These differences cannot be miraculously reversed to go back to the ancestral species or somehow directed to make it possible to breed with some other unrelated species.

Likewise, you could conceivably breed cats for dog-like characteristics, but whatever the result of your efforts, the probability is vanishingly small that it would be a member of the dog species--i.e., able to breed with dogs.

and even Darwin's bulldog, Thomas Huxley, was discomfitted by the absence of what I call "transpeciation" events.

— Blast

Apology to Blast: My previous post was snarky and uncalled for. Sorry.

I'll come up with a short list of rebuttals to Penrose for you.

(BTW, I love Penrose's books. As a non-physicist, I think The Road to Reality is the best and most demanding pop physics book out there.)

Which critics have you read, Blast?

There's no reason for me to read the critics

Katrina, there was a paper recently out about bacteria (I think that's what you have in mind when you say single-celled organisms) which was reporting that 20% of every bacterial genome is constantly changing! In other words 20% of the genome is constantly "mutating", and no real change takes place: they're just bacteria. So, you can see, that if 20% is constantly changing and nothing really changes, then some simple "point" mutation---that is, a single nucleotide change, in all probability, wouldn't show any change at all.

Apology to Blast: My previous post was snarky and uncalled for. Sorry.

Let me go back to basics first. You can make claims of finding patterns in nature without your claims always being dismissed as cherry picking. This is not always an easy thing to do, but if you could not ever do it, then science would be impossible.

This pertains to the point Cubist made about cherry picking. Finding pi in the genome is not an experiment we carry out, it's just a hypothetical event, and is thus akin to finding bible codes, jesus's face in cheese, and so on. A priori probability calculations aren't relevant, any more than they are relevant when two people at a party discover they share a birthday. What are the odds of that? Wrong question. So, what are the odds that we can find some sequence in some DNA that seems, well, "designed"? Much much higher than the a priori question about 100 digits of pi.

P.S. I can log in to ABC but I can't post to the Lutsko thread --- I tried to register, but never received a confirmation email. Is there else I'm supposed to do?

If all we were doing is "finding patterns in nature", rather than doing directed observation by setting up conditions for tests and experiments, then indeed science would be impossible.

And, again, even if finding pi in the genome would be a genuine falsification of ToE --- so what?

(BTW, I love Penrose's books. As a non-physicist, I think The Road to Reality is the best and most demanding pop physics book out there.)

To begin with, scientists don't commonly speak of having "disciples."

Second, you seem to be very confused about evolution. Evolution says that cats and dogs have a common ancestral species that existed at some time in the distant past, and that there are plausible pathways (involving natural and artificial selection) from that ancestral species to the modern domesticated species. It does not say that there is any plausible pathway from the cat or dog back to the ancestral species. Selection events don't work in reverse.

Likewise, you could conceivably breed cats for dog-like characteristics, but whatever the result of your efforts, the probability is vanishingly small that it would be a member of the dog species---i.e., able to breed with dogs.

Are Homo sapiens and Helacyton gartleri the same "kind?"

Finding any one of these things in a string rules out with high probability that the string came from a uniform random process

If I had a sufficiently long strand of DNA from wild type bacteria, claimed to "find pi" in it and when you asked me what I mean by that I said: "I wrote this much shorter code segment in the standard TM that I wrote to generate pi and encode it in nucleotide bases, and when I run it, it generates the same sequence that I found in the DNA." then you could ignore my wild rantings about pi and about encoding schemes but would still have to take the shortness of the program that generated it as evidence that my finding had significance. Ergo, no opportunity whatsoever for cherry picking.

Dawkins' petwhac?

petwhac = Population of Events That Would Have Appeared Coincidental

Indeed. I haven't read the book but I would expect that Dawkins' treatment would apply here, and is explained far better than any of us are managing.

But I don't see the point to any of this; we can just specify an encoding of pi beforehand, we don't need a program to generate it, as numerous such programs have already been written and run.

What we're left with is a very silly hypothetical: suppose we prespecified one particular encoding of pi, for no particular reason at all, and we arbitrarily picked some DNA sequence from some arbitrary organism --- all for no reason at all --- and the DNA sequence matched encoding. Wouldn't that be something!

Oops. In the above "rule of objection" should be "rule out objection" and "in the concept of" should be "in the context of."

Finally, I have to wonder how one would go about cracking encrypted text or detecting steganography (concealed messages) if every pattern found in strings were to be dismissed as cherry picking. Both of these are rigorous subdisciplines of applied math (I'll leave open if it counts as science), and routinely make the distinction between apparently random strings and strings suspected of carrying information between human parties. They do this without a priori assumptions about what content is expected to be found in the decrypted strings.

Now looking for secret messages in DNA is clearly a game for cranks (or at least those with way too much time on their hands) but if you included a sufficiently long prefix of pi in any simple encoding in a string sent to reasonably motivatied decryption experts, I would give them a reasonably good chance of finding it. If they did, they would consider it part of the content and not dismiss it as cherry picking.

Wait, let me make this more specific. Suppose I'm wrong and decryption experts wouldn't find it. Then I've invented the unbreakable PandasThumb cipher. All I do is take my message, XOR it with the bits in an equal length prefix of PI and include it somewhere in the middle of a much longer string. Then the NSA will never find my plaintext, because the encoding of pi in the string is easily dismissed as cherry picking.

They do this without a priori assumptions about what content is expected to be found in the decrypted strings.

How about this syllogism: Blast doesn't understand nonsense. The theory of evolution is nonsense. Therefore, Blast doesn't understand the theory of evolution.

Let me make it easier for you: turn a cat into anything else. Turn it into a car muffler, a peach tree, an as yet unknown ungulate, anything, just something that's not a cat. (And, of course, you know that's not possible because in-breeding eventually produces sickly lines.)

Are Homo sapiens and Helacyton gartleri the same "kind?"

— BlastfromthePast

Cancer is a loss of cell differentiation, i.e., a loss of what it's "supposed" to be. Doctors routinely remove cancerous growths.

So what is the purpose of such a question?

If you found a highly compressible substring in bacterial DNA that contributed to fitness of the organism in no plausible way, seemed very difficult to explain in terms of DNA copy mechanisms, and coincidentally could be transformed by substituting bases for digits into a string known to be of interest to humans, then the most reasonable starting hypothesis is that a human put it there.

Finally, I have to wonder how one would go about cracking encrypted text or detecting steganography (concealed messages) if every pattern found in strings were to be dismissed as cherry picking.

Another point about cryptography: it is based upon the highly reasonable expectation that there is an encoded message. In the case of the genome, that is not a reasonable expectation, and we shouldn't expect to find one. If we do find something that we think is a message, that's a very different situation than finding something we think is a message in some gibberish in an Al Qaeda email.

If someone says they have a DNA sequence that encodes 100 digits of pi, it's most likely a hoax. If they present a pre-mailed envelope containing that encoding, most likely it's still a hoax. No matter how firm the evidence that the encoding was pre-known, the most obvious question is, how was it known? This would not tell us something about DNA and evolution, it would instead suggest that we have either a very talented trickster or a psychic among us.

They do this without a priori assumptions about what content is expected to be found in the decrypted strings.

Cryptography is based on prespecified criteria such as letter frequencies.

But consider cypher text produced via a one time pad. Any possible pattern can be found in such texts, but none of them mean a thing --- one time pad encryption is theoretically unbreakable.

Any possible pattern can be found in such texts, but none of them mean a thing

Finally, I have to wonder how one would go about cracking encrypted text or detecting steganography (concealed messages) if every pattern found in strings were to be dismissed as cherry picking.

"found a highly compressible substring in bacterial DNA", is not at all unlikely, without specifying it strictly. We're going in circles.

As an aside, for most cryptographic systems, it takes about 30-40 messages, all ciphered with the same key, to give a cryptanalyst enough material to have a decent chance of cracking the cipher relatively quickly.

So one good way to beat the codebreakers is to change your key after every 15-20 messages. It doesn't give the analyst enough material to work with, and makes it very difficult to use mathematical methods to break the cipher.

They will still be able to do it, but it will take much longer (much more trial and error and "brute force"). And by the time the cipher is finally broken, the information it contains will already be old and useless ---- the standard by which a successful cipher system is measured.

Any possible pattern can be found in such texts, but none of them mean a thing --- one time pad encryption is theoretically unbreakable.

If someone says they have a DNA sequence that encodes 100 digits of pi, it's most likely a hoax.

A one-time pad is only unbreakable if it comes from a true random source. I.e., is incompressible. If I used a periodic string like 010101....010101 as my pad it would be very breakable even if I used it just once.

Even a pseudorandom source is breakable unless its based on a very secure algorithm.

Sorry about my lack of discipline in continuing to respond.

Even if you found a "message/pattern/random artifact" it would be meaningless except in prayer(self worship) the metaphysical interpretation would be colored totally by culture. An opinion.

To have it accepted you would need to "convert" the disciples. It would only be accepted if it had value.

No different to finding god in a snowflake.

Blast (Parsifal) again leaves the enchanted castle without the holy grail all for want of a question.

I found it quite interesting, actually.

To clarify your definition of "kinds." H. gartleri is, again, a free-living unicellular organism, not dependent on a human host to grow or replicate itself. So is it the same "kind" of organism as Homo sapiens? Or not?

— Anton Cates

One variation of the onetime pad, used by Soviet spies, used a particular date, a five digit number, and a short phrase from a popular song to generate a long pseudorandom key text that was then used to cipher the message. The FBI never broke it, and learned how it worked only when the spy confessed and showed them how it was done. But, with enough captured material using the same system, it would have been vulnerable to cryptanalysis.

They aren't Homo sapiens cells.

It isn't a Homo sapien cell. It's a cell that is derived from a Homo sapien cell.

I am quite confused about the cryptography comments.
Are you encoding words with words?
Or changing letters to numbers?

My main experience with crpto is digital, where you take plain text then digitise it. then this plain (digitised) message is put through an exclusive OR gate along with a pseudo random key. The XOR gate then gives out the encrypted text. Further encryption can be carried out by repeating the process (XOR) with either the same key or yet another key of the same or different number of chars.

While it is possible to eventualy break such encryption is only going to happen with raw computer power. No cryptologist is reasonably likely to be able to do this.

Even with plenty of computer power; without any knowledge of how many chars are in the key or how many times the original message was encrypted anyone/computer trying to get back to the original (plain text) is in for a very hard time.

While it is possible to eventualy break such encryption is only going to happen with raw computer power. No cryptologist is reasonably likely to be able to do this.

To clarify your definition of "kinds." H. gartleri is, again, a free-living unicellular organism, not dependent on a human host to grow or replicate itself. So is it the same "kind" of organism as Homo sapiens? Or not?

But, of course, we've known, and for a long time, that there are barriers to variation that species cannot cross.

In other words 20% of the genome is constantly "mutating", and no real change takes place: they're just bacteria. So, you can see, that if 20% is constantly changing and nothing really changes, then some simple "point" mutation---that is, a single nucleotide change, in all probability, wouldn't show any change at all..

And, tell me, what would happen if scientists in labs didn't culture these cells, wouldn't they just die? They're really on life-support.

Even if you found a "message/pattern/random artifact" it would be meaningless except in prayer(self worship) the metaphysical interpretation would be colored totally by culture. An opinion.

you could make the statistical inference that with very high probability, the source was not a uniform random process

Even with plenty of computer power; without any knowledge of how many chars are in the key or how many times the original message was encrypted anyone/computer trying to get back to the original (plain text) is in for a very hard time.

am quite confused about the cryptography comments. Are you encoding words with words? Or changing letters to numbers?

My main experience with crpto is digital, where you take plain text then digitise it. then this plain (digitised) message is put through an exclusive OR gate along with a pseudo random key. The XOR gate then gives out the encrypted text. Further encryption can be carried out by repeating the process (XOR) with either the same key or yet another key of the same or different number of chars.

While it is possible to eventualy break such encryption is only going to happen with raw computer power. No cryptologist is reasonably likely to be able to do this.

They're human cancer cells. They aren't Homo sapiens cells.

I can't argue with anything Lenny said about cryptography. The part that rings a bell sounds right to me, and there's an awful lot I don't know (e.g. Kasiski and Kerkhoff attacks). (Lame but true excuse: back when I was in grad school, my department was about to offer a cryptography course, but the professor who was going to teach it moved to another university.)

I wish I had not brought up cryptography, though, since I think the related field of randomness testing (e.g. http://www.ciphersbyritter.com/RES/RANDTEST.HTM ) is more pertinent to what I've been trying to say here. I added more comments on ABC as well.

If the key is very long, it's still vulnerable. Since the first letter (or number) of every message is always encrypted with the first letter (or number) of the key, the second text letter with the second key letter, etc, a cryptanalyst can, with enough intercepted material, set each of these up as a column, and then use frequency analysis to break each one, eventually reconstructing the entire key.

But the first letter/number in digital encryption is encoded by several (usually 8) bits of the key. IE. The letter a might be 1010 0011 in binary code. This will then be encrypted using the first 8 bits of the key. eg. if plain text is 1010 0011 and the first 8 bits of key are 1100 1010 the cypher text becomes 0110 1001. so you have gone from 1010 0011 to 0110 1010 and this is only the first letter.

If you add to this a double (or more) encrypted transmission, it becomes very difficult to break. Yes it can be done, but only practical with knowledge of the encryption method and plenty of computer power and time.

If you add to this a double (or more) encrypted transmission, it becomes very difficult to break. Yes it can be done, but only practical with knowledge of the encryption method and plenty of computer power and time.

A public-key system that has been found to be unsafe, and which is therefore of primarily historical interest today, is the knapsack method. Unlike RSA and Diffie-Hellman, this system was based on a mathematical problem which was known to be NP-complete, and thus one that was tougher to crack than either factoring or the discrete logarithm problem.

Because the knapsack cipher was based on disguising such a set of numbers, called a superincreasing knapsack as an ordinary knapsack, although solving the general knapsack problem had been proven to be an NP-complete problem, someone attacking a knapsack cipher had one piece of information that someone trying to solve the general knapsack problem did not: that the knapsack to be solved was a disguised version of a superincreasing knapsack. Thus, the flaw was that the security of the cipher depended not only on the difficulty of the knapsack problem, but on the security of the disguise.

The purpose of an encryption system, of course, is simply to delay unauthorized entry until such a time as the information it contains is no longer useful. The intention is usually to DELAY breaking the cipher, not to PREVENT it. After all, the onetime pad is the only system that is absolutely completely unbreakable even in principle ------ and virtually no one uses it. Too many logistical problems with it.

I can't argue with anything Lenny said about cryptography. The part that rings a bell sounds right to me, and there's an awful lot I don't know (e.g. Kasiski and Kerkhoff attacks). (Lame but true excuse: back when I was in grad school, my department was about to offer a cryptography course, but the professor who was going to teach it moved to another university.)

By selecting a favorable key, I would think that you could probably manage to "recover" almost anything you wished.

I said: "the most you could 'recover' with it is anything with Kolmogorov complexity k or less."

To clarify, I take quote-recover-unquote to mean "confabulate by means of cherry picking." This will not prevent you from actually recovering however many bits of information may be found in the ciphertext itself.

Actually, they frequently pop up without lab scientists culturing them. They've contaminated many other cell cultures unbeknownst to the researchers (which usually leads to the poor researcher being super-happy at how well his culture is suddenly growing!) They're now a successful invasive species of a very specialized and recent environment---the culture plate.

Where, exactly, do human cancer cells come from?

By selecting a favorable key, I would think that you could probably manage to "recover" almost anything you wished.

Where, exactly, do human cancer cells come from?

The question being posed wasn't "whence", but "what."

And I can't believe it; you actually sound intelligent in your discussion with Paul C. Who would have thought?

Actually, they frequently pop up without lab scientists culturing them. They've contaminated many other cell cultures unbeknownst to the researchers (which usually leads to the poor researcher being super-happy at how well his culture is suddenly growing!) They're now a successful invasive species of a very specialized and recent environment---the culture plate.

Anton, this is so strained an argument that I can't believe you're making it.

If this is your definition of crossing the species barrier

Here's where I beg to differ with Lenny (and nearly everyone else here, so it seems).

I don't want anyone to think I don't understand the issue of cherry picking. The problem with "Bible codes" and other exercises in numerology and specious pattern discovery is that they propose a scheme more complex than the pattern they claim to discover. This is akin to any other over-specified explanation. Give me any n points and I can give you an (n-1)-degree curve that interpolates them perfectly.

However, it is possible to develop statistical models and other explanatory theories for datasets of unknown origin. E.g. if I find a straight line that goes through 1000 points, I have a parsimonious explanation for them in far fewer degrees of freedom than the data. If it doesn't quite go through them, but shows a good least squares fit, I have a linear regression model. This is not numerology, but a well-accepted modeling technique that appears in numerous peer-reviewed papers every year.

By analogy, "degrees of freedom" can be restricted in discrete parameters connected to a model. Cherry picking is a real problem, and shows up in a lot of pseudoscience, but it is not an all-powerful way of producing any bogus claim from data, provided you restrict your model to few parameters relative to the amount of data to explain.

you actually sound intelligent in your discussion

Or, Blast, you could always head over to the Charles-Darwin-In-A-Pan thread and explain to them how, of course, God would never miraculously "cause" Darwin's image to appear in any such mundane device and, of course, how this is just one more of an endless series of examples of the human mind imposing pattern on noise.

And then you could explain to us again how you DO believe God miraculously "caused" various statues to bleed, sculptures to weep, and images of saints to appear in various holy artifacts and relics, and so on.

The only difference being, of course, that YOU can tell a "real" miracle from a "fake" one, since YOU are infallible--your word, not mine--in such matters, while the rest of us mere mortals are not.

Curious, though, how your "real" miracles always support your ingrained religious beliefs, isn't it?

Maybe if your faith were a little firmer, you wouldn't feel this compulsive need to fill the chinks in your armor by pointing out the gaps in someone else's thinking.

How's it go? Something about the mote and the beam?

In, of all things, an eye, that, um, holy grail of the anti-evolutionary. Wouldn't you just know...

Posted by PaulC on November 18, 2005 07:59 PM (e) (s) By selecting a favorable key, I would think that you could probably manage to "recover" almost anything you wished. I'm starting to feel like I'm on a merry-go-round here, but to be brief, it depends on the size of the key. If you picked a k-bit key (*), then the most you could "recover" with it is anything with Kolmogorov complexity k or less. Thus, if you restrict such "cherry picking" to short keys, then you are effectively limited in what you could claim to "recover." This is a rigorous defense against objections of cherry picking, and is related to Solomonoff induction, the modern, rigorous theory that subsumes intuitive notions of scientific induction and Occam's razor. (*) In this context, key would mean a k-bit representation of the key and the decryption protocol in such a form that it could be run on an a priori chosen universal machine.

For instance, you could, with one key applied to a nine-codon sequence of DNA, produce the nine-letter "message": GODISREAL But by simply changing to a different key, you could also produce the nine-letter "message": GODISFAKE And with still another key, you can produce the nine-letter "message": ZEUSISGOD

Depending on which key you choose, you can produce *any* combination of letters and/or numbers that happens to fit within the allotted space.

Your technical knowledge far exceeds mine. I did not understand that at all.

Your technical knowledge far exceeds mine. I did not understand that at all.

to be brief, it depends on the size of the key. If you picked a k-bit key (*), then the most you could "recover" with it is anything with Kolmogorov complexity k or less.

Are we talking about lutskos' proposition about looking for encoded information in DNA?

If so; what possible information would anybody have about the the "key code" used or the type of encryption used?

DNA has 4 "letters" does it not?
Yet only 2 need to be considered as 1 letter always oposes another.

If I remember right DNA has the letters CAG&T. Right or wrong doesn't matter..call them ABC&D where A always oposes B and C oposes D. That is in effect a binary system on any one side (helix) or am I missing something important there?

If you wanted to look for encoded information; how could you possibly choose length of key, how many times message was encrypted, type of encryption used etc.?

By the way. My questions in this post are not facetious. I just don't know enough biology.

An an interesting aside (I was watching "Contact" on cable last night), all of these problems will become crushingly apparent if/when we ever receive a textual "message" from an advanced space civilization.

It seems to me that, unless we have a fairly large number of messages, all using the same "coding" algorithm, we will never be able to "decode" it because we will never be able to tell what patterns are the right ones or not.

If so; what possible information would anybody have about the the "key code" used or the type of encryption used?

I can see no reason why there should not be advanced civilisations on other planets.

Making contact might be problematic though.

Looking at the age of the Earth and how short a time it has creatures capable of advanced research on it, we are looking at a very small timescale. Add to that the effect we are having on the sustainability of our species. The outlook seems glum. Shame.

I can see no reason why there should not be advanced civilisations on other planets. Making contact might be problematic though.

Add to that the effect we are having on the sustainability of our species.

My goodness, we certainly have strayed awfully far afield of the original topic of this thread. ;>

Most people do not really understand how vast interstellar space actually is.

Actually, they frequently pop up without lab scientists culturing them. They've contaminated many other cell cultures unbeknownst to the researchers (which usually leads to the poor researcher being super-happy at how well his culture is suddenly growing!) They're now a successful invasive species of a very specialized and recent environment---the culture plate.

— BlastfromthePast

Anton, this is so strained an argument that I can't believe you're making it.

You have an artificial environment, with a cell line that is no more than degraded human cells. If this is your definition of crossing the species barrier, then all it does it further point out what we already know: most variations are harmful. This hardly helps Darwinism.

Lenny only a 100 years turn around ?

The nearest inhabitable solar system is how far away ?
20,000 -40,000 light years if the message was via radio(not sure on actual nearest imaginary planet)
Turn around time 80,000 years (lets say)
twice the time we went from nomads to now and who knows what in another 40,000 years.

What should an interstellar message have

a simple fax would do it repeated over and over

A picture of my family with and my dog.

Guess what ?

we are already doing it

the first "I love Lucy's are what ? 50 Light years on their way to some nomad on the planet Zork or 2 brains in a bottle on a remote star-ship in a solar system far far away

As for whether the genetic changes between H. sapiens and H. gartleri were "harmful"...well, Henrietta Lacks is dead. H. gartleri is not, and probably won't be for the foreseeable future, and by some estimates now packs more total biomass than Mrs. Lacks' body ever did. It seems that, far from being "harmed" by its evolution, H. gartleri has if anything enhanced its fitness. (Of course, to balance that out, Mrs. Lacks had children.)

Anton, Henrietta Lack walked and talked. H. gartleri never will.

Isn't that an awful lot of "loss of fitness"?

Vous etes francais, ne-c'est pas?

— BlastfromthePast

Anton, Henrietta Lack walked and talked. H. gartleri never will. Isn't that an awful lot of "loss of fitness"?

On the other hand, maybe by "harmful" and "degraded" you simply mean that human beings are better/cooler/smarter/more lovable than H. gartleri. I'm not sure I can argue with that, but that really has no relevance to evolutionary theory.

This is the kind of ad hoc hypothesis that makes neo-Darwinism unfalsifiable

William Bateson, in his critique of Darwinism...

This hardly helps Darwinism

William Bateson, in his critique of Darwinism

I suggest that since IDiots endlessly try to use the 'Darwinism' straw man against evolutionary theory ('Darwinism' being a straw man because evolutionary theory has evolved far past Darwin and because evolution isn't an '-ism' at all but a scientific theory), it would be appropriate to start obstinately referring to their beliefs as 'Dembskiism' or 'Beheism'

decades-old young-earth creation "science".

I suggest that since IDiots endlessly try to use the 'Darwinism' straw man against evolutionary theory ('Darwinism' being a straw man because evolutionary theory has evolved far past Darwin and because evolution isn't an '-ism' at all but a scientific theory), it would be appropriate to start obstinately referring to their beliefs as 'Dembskiism' or 'Beheism', no matter how many times it may be pointed out that Dembski or Behe is not an accurate representative of their particular viewpoint

— ben

So I wouldn't imagine that calling it "Dembski-ism" or something would really bother them that much. Well, it'd probably bother Behe...

Bateson has been dead for almost 80 years. He never even knew what "DNA" was. (shrug) Once again, we see Blast's basic dishonesty, by citing century-old "science" and claiming that it represents state of the art. Hey Blast, I'm still waiting for you to answer my questions about HeLa, Blast. Or have you run away already?

So, aside from your feelings on whether H. gartleri is fit or lovable or suited for political office---would you consider it within the Homo sapiens "kind" or not? I think your answer was still no, but I'm not sure.

Anton, Henrietta Lack walked and talked. H. gartleri never will.

Isn't that an awful lot of "loss of fitness"?

About HeLa: Lenny, answer this for me: let's say a man decides he wants to become a woman. He has a sex change operation---the whole works. Is he now a man or a woman?

(This should be good... . . )

Now, cancer cells, these cells which "killed" this woman, these same cells---death itself---are now some kind of new LIFE-form?

Posted by BlastfromthePast on November 22, 2005 06:44 PM (e) (s) There's a strange kind of logic... Now, cancer cells, these cells which "killed" this woman, these same cells---death itself---are now some kind of new LIFE-form?...

Three phrases should be among the most common in our daily usage. They are: Thank you, I am grateful and I appreciate.