In my last post, Common Design Errors, I proposed a problem for biblical creation. I received one response from a creationist, who cited Inai et al. (2003). This paper compared the largest set of homologous exons between humans, guinea pigs, and rats. You see, guinea pigs, like most primates and a few other taxa, lack L-guluno-gamma-lactone oxidase. Two sections were quoted to me.
15 Comments
Matt · 6 September 2004
Wow, that's a pretty big blunder to make, both for the authors and the reviewers. I wonder how that slipped past the reviewers? I guess the editors of the Journal of Nutritional Science and Vitaminology don't know any bioinformaticists. Incidently, according to this site, the journal has an impact factor of 0.701, which is higher than the now-infamous Proceedings of the Biological Society of Washington (0.508). If that doesn't testify that peer-review isn't perfect, I don't know what will.
I hope you're going to talk a little trash to whomever sent you that link.
Reed A. Cartwright · 6 September 2004
The wierd think is that most of the data I used came from the same lab (Nishikimi) that did this paper. From looking at other papers coming from the lab, I get the impression that molecular evolution is not its primary research focus. I think this is another example of a biochemist not fully understanding how to study molecular evolution.
Response To Cartwright · 25 November 2004
Well, there is much to discuss here. First, how did you select that sequence segment? Of course your conclusions are sensitive to this since you are taking a small sample.
Reed A. Cartwright · 25 November 2004
Response To Cartwright · 25 November 2004
You are looking at a tiny fraction of the data analyzed in the Inai paper. I'm not defending the Inai paper as I have not read it. However, the sequence segment you selected is quite different from other segments. In your segment there is high similarity. This is not characteristic. Elsewhere one finds a hodge-podge: poor alignments, segments with high human-guinea pig similarity but low similarity to the rat, etc. There are various possible explanations. The substitutions occurred in the rat lineage, insertions and deletions, etc.
This all makes interpreting the data a bit difficult. I suspect things will become clearer with more research, but, as you are probably aware, pseudogenes in general have not proven to be as straightforward as once thought. The Inai paper may be in error, but the idea of mutational hotspots is not controversial.
We need to be careful about claiming what pseudogenes do and do not portend for creation, or any other model for that matter. The creationists you spoke with were apparently unaware of this. It is certainly not a stretch for a creationist to point to mutational hotspots as the cause of the primate GULO pseodugene.
Hotspots are a reality, but we don't understand them fully yet (to my knowledge anyway). We don't well understand their cause, species dependence, etc. Hence no one has done a credible probability analysis of the primate GULO pseodugene.
Also, of course, we can't be certain the primate GULO pseodugene is functionless. It seems obvious that it would be, but we need to be careful as other pseudogenes are being found to have indications of function.
Response To Cartwright · 25 November 2004
You are looking at a tiny fraction of the data analyzed in the Inai paper. I'm not defending the Inai paper as I have not read it. However, the sequence segment you selected is quite different from other segments. In your segment there is high similarity. This is not characteristic, and more species doesn't help. Elsewhere one finds a hodge-podge: poor alignments, segments with high human-guinea pig similarity but low similarity to the rat, etc. There are various possible explanations. The substitutions occurred in the rat lineage, insertions and deletions, etc.
This all makes interpreting the data a bit difficult. I suspect things will become clearer with more research, but, as you are probably aware, pseudogenes in general have not proven to be as straightforward as once thought. The Inai paper may be in error, but the idea of mutational hotspots is not controversial.
We need to be careful about claiming what pseudogenes do and do not portend for creation, or any other model for that matter. The creationists you spoke with were apparently unaware of this. It is certainly not a stretch for a creationist to point to mutational hotspots as the cause of the primate GULO pseodugene.
Hotspots are a reality, but we don't understand them fully yet (to my knowledge anyway). We don't well understand their cause, species dependence, etc. Hence no one has done a credible probability analysis of the primate GULO pseodugene.
Also, of course, we can't be certain the primate GULO pseodugene is functionless. It seems obvious that it would be, but we need to be careful as other pseudogenes are being found to have indications of function.
Response To Cartwright · 27 November 2004
Following up on my previous message, note for example the multiple alignments just up and downstream of the segment you show in your above post. Just upstream, we have the rat, mouse, cow, pig and chicken all with "CATCCC", but human ang guinea pig with "TGAGTG". Just downstream we see the same groups with "CCCT" and "TGAC", respectively. This is not unusual and, for these cases, evolution is left with the explanation that while the ancestral sequence was preserved in the rat, mouse, cow, pig and chicken, the human and guinea pig independently made identical changes. The pattern, and especially its dependence on segment location is rather striking.
Reed A. Cartwright · 27 November 2004
Great White Wonder · 28 November 2004
Response To Cartwright · 28 November 2004
Yes, I understand you were not doing a comprehensive analysis. You did, however, make a comprehensive conclusion that, interestingly, is supported by the segment you posted but not by the immediately adjacent upstream and downstream sequences. Furthermore, you claim that sample size is not a problem since diverse taxa are represented. This simply is not true. In fact, it is precisely those diverse taxa that reveal the problem. At several points the rat, mouse, cow, pig and chicken all align well while the human and guinea pig must have independently diverged from that consensus, yet they align rather well.
Responding to Great White Wonder, I'm afraid I don't follow your point.
Great White Wonder · 28 November 2004
Reed A. Cartwright · 29 November 2004
Response To Cartwright · 29 November 2004
Here is an alignment that is a superset of your alignment (there are roughly an additional 90 residues upstream and 40 downstream). Of course you'll need to format with a monospace font (~ represents inserts).
204149________GCAAGAAGGAGAGCAGCAACCTCAGTCACAAGATCTTC~~ACCTACGAGTGTCGCTTCAA_Rat
38325769______GCAAGAAGGAGAGCAGCAACCTCAGCCACAAGATCTTC~~TCCTACGAGTGTCGCTTCAA_Mous
24637282______GGAAGAAGGAAAACTGCAACCTCAGCCACAAGATCTTC~~ACCTACGAGTGCCGCTTCAA_Pig
5924388_______GGAAGAAGGAAAACTGCAACCTCAGCCATAAGATCTTC~~ACCTACGAGTGCCGCTTCAA_Cow
14994234______CAAAGGCTGAGCAGGTCAAGCGCAGTGATAAGGCTTTC~~AACTTTGACTGTCTCTTCAA_Shrk
46425804______~~~~~~~~~~~~~~~~CAATGTCAGCTACAAGATCTTC~~AACTACGAGTGCCGCTTCAA_Chkn
220300________GGGC~~~~AACCCGG~~AGAGCTGTG~GGGAGGGTGCC~~GGCATCCCTTCCTGCCCTGA_GPig
493656________AGGCTGGGAACCTGTGCAGAGTCTTGAGGGAGGGCACCCAGCGGTCCCTTCCCACCCTGA_Humn
_______________________________*____________**_____*___________*____*____*
204149________G~~~CAGCATGTACAAGACTGGGCCATCCCTAGGGAGAAGACCAAGGAGGCCCTACTGGA
38325769______G~~~CAGCATGTCCAAGACTGGGCCATCCCCAGGGAGAAGACCAAGGAGGCCCTGCTGGA
24637282______G~~~CAGCATGTCCAGGACTGGGCCATCCCCAGAGAGAAGACCAAGGAGGCCCTCCTGGA
5924388_______G~~~CAGCATGTCCAGGACTGGGCCATCCCCAGAGAGAAGACCAAAGAGGCCCTGCTGGA
14994234______G~~~CAACATGTGTCGGACTGGGCTCTTCCTATTAAGCAGACTAGAGCAGCTCTGGAGCA
46425804______G~~~CAGCATGTGCAAGACTGGGCCATCCCCATTGAGAAGACAAAGGAAGCACTGCTGGA
220300________GGTCCAGATGGCATCCCC~TGCCCTGAGTGCAGAGAGAAGACCAAGGAGGCCCTGCTGGA
493656________GTTCTAGATTCTGTCCCCCTGGGCTGAGTGCAGAAAGAAGACCACGGAGGCCCTGCTGGA
______________*____*_____________**__*_______*___**_****_*__*__**_**___*_*
204149________GCTAAAGGCCATGCTGGAGGCCCACCCCAAAGTGGTAGCCCACTACCCCGTAGAGGTGCG
38325769______GCTAAAGGCCATGCTGGAGGCCCACCCCAAGGTGGTAGCCCACTACCCCGTGGAGGTGCG
24637282______GCTGAAGGCCATGCTGGAGGCCCACCCCAAGGTGGTGGCCCACTACCCCGTGGAGGTGCG
5924388_______GCTGAAGGCCATGCTGGAGGCGAGCCCCAAGGTAGTGGCCCACTACCCCGTGGAGGTACG
14994234______GCTGAAGGATTGGCTGGACAACAATCCTAATGTGCGAGCACATTTTCCTGTCGAGGTTCG
46425804______GCTGAAGGCTGCCCTGGAGAACAACCCCAAGATGGTGGCCCACTACCCTGTGGAGGTGCG
220300________GCTGAAGAGCATGCTGGAAGCTCACCCCAAGGTGGCAGCCCACTACCCTGTGGGGGTGCG
493656________GCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACG
______________***_***______*****_______**__*__*_____*_**_*__*__**_*_***_**
204149________CTTCACCCGAGGCGATGACATTCTGCTGAGCCCCTGCTTCCAGAGGGACAGCTGCTACAT
38325769______CTTCACCCGAGGTGATGACATCCTGCTGAGCCCGTGCTTCCAGAGGGACAGCTGCTACAT
24637282______CTTCACTCGGGCGGACGACATCCTGCTGAGCCCCTGCTTCCAGAGGGACAGCTGCTACAT
5924388_______CTTCACTCGCGGGGACGACATCCTGCTGAGCCCCTGCTTCCAGCGAGACAGCTGCTACAT
14994234______GTTTGTTCGTGCAGACGATATTCTGCTCAGCCCCTGTTACAGACAGGACAGCTGCTACAT
46425804______CTTTGCTCGAGCGGATGAGATCTGGCTGAGCCCCTGCTTCCAGAGGGACAGCTGCTACAT
220300________CTTCACCCGGGGGGACGACATCCTGCTGAGCCCCTCCTTCCAGAGGGACAGCTGCTACAT
493656________CTTCACCTGGAGG~ATGACATCCTACTGAGCCCCTGCTTCCAGTGGGACAGCCGCTACCT
_______________**_____*_____*_**_**____**_*****_*__*_*______******_*****_*
204149________GAACATCATTATGTACAGGCCCTATGGAAAGGACGTGCCTCGGCTAGACTACTGGCTGGC
38325769______GAACATCATTATGTACAGGCCCTATGGGAAGGATGTGCCTCGGTTGGATTACTGGCTGGC
24637282______GAACATCATCATGTACAGGCCCTACGGCAAGGACGTGCCTCGGCTGGACTACTGGCTGGC
5924388_______GAACGTCATCATGTACAGGCCCTATGGCAAGGACGTACCGCGGCTGGACTACTGGCTGGC
14994234______TAACATCATCATGTACAGACCCTACGGGAAGGAGGTGCCACGCGAGGGGTACTGGGCAAT
46425804______GAACATCATCATGTACAGGCCCTATGGGAAGAACGTGCCCCGGCTCAACTACTGGCTGAC
220300________GAACATCTGCATATACAGGTGACAGGCTGCTCCATGGGATTTAGGAG~~~~~~~~~~~~~
493656________GAACATCAACCTGTACAGGTGACAGCTCACTGGGAGGTGGAGATGGGCCTGGGAGCCGGC
_______________***_**____*_*****_____*_____
Reed A. Cartwright · 29 November 2004
Reed A. Cartwright · 29 November 2004
Another note:
I'm going through the GULO data and producing an alignment of the cds region. Some of the genebank files are a little confusing. For instance the cavie exon sequences include introns. I suspect that the upstream and downstream regions that Responder is refering to are places where the alignment is wrong because introns are being aligned with exons.